Building databases: GTF / GFF details
In this section we show some specific details on the GTF and GFF file format required by SnpEff to build databases.
Warning
Most people do NOT need to build a database, and can safely use a pre-built one. So unless you are working with a rare, custom, or new genomes you most likely don't need to do it either.
Summary
As seen in the previous Building databases, there are three main steps when building a database:
- Step 1: Configure a new genome in SnpEff's config file
snpEff.config. - Step 2: Build using gene annotations and reference sequences
- Step 3: Checking the database: SnpEff will check the database by comparing predicted protein sequences and CDS sequences with ones provided by the user.
In this section we'll go into the details of the GTF and GFF format requirements for Step 2. As a general rule, GTF format is preferred over GFF, so if your genome provides both GTF and GFF, use GTF whenever possible.
GTF format example
This is a snippet example from a GTF file that fulfills SnpEff's requirements. The example (from ENSEMBL's human genome GTF file) shows the definition of one gene, one transcript and its exons, as well as the transcript's start codon, stop codon, and UTR regions.
# Note that tabs have been replaced by spaces for readability
chr1 ensembl gene 10472288 10630758 . + . gene_id "ENSG00000142655.13"; gene_type "protein_coding"; gene_name "PEX14";
chr1 ensembl transcript 10474950 10630758 . + . gene_id "ENSG00000142655.13"; transcript_id "ENST00000356607.9"; transcript_type "protein_coding";
chr1 ensembl exon 10474950 10475002 . + . transcript_id "ENST00000356607.9";
chr1 ensembl CDS 10474967 10475002 . + 0 transcript_id "ENST00000356607.9";
chr1 ensembl start_codon 10474967 10474969 . + 0 transcript_id "ENST00000356607.9";
chr1 ensembl exon 10495274 10495321 . + . transcript_id "ENST00000356607.9";
chr1 ensembl CDS 10495274 10495321 . + 0 transcript_id "ENST00000356607.9";
chr1 ensembl exon 10536213 10536297 . + . transcript_id "ENST00000356607.9";
chr1 ensembl CDS 10536213 10536297 . + 0 transcript_id "ENST00000356607.9";
chr1 ensembl exon 10599238 10599366 . + . transcript_id "ENST00000356607.9";
chr1 ensembl CDS 10599238 10599366 . + 2 transcript_id "ENST00000356607.9";
chr1 ensembl exon 10618332 10618417 . + . transcript_id "ENST00000356607.9";
chr1 ensembl CDS 10618332 10618417 . + 2 transcript_id "ENST00000356607.9";
chr1 ensembl exon 10623019 10623121 . + . transcript_id "ENST00000356607.9";
chr1 ensembl CDS 10623019 10623121 . + 0 transcript_id "ENST00000356607.9";
chr1 ensembl exon 10624340 10624437 . + . transcript_id "ENST00000356607.9";
chr1 ensembl CDS 10624340 10624437 . + 2 transcript_id "ENST00000356607.9";
chr1 ensembl exon 10627272 10627363 . + . transcript_id "ENST00000356607.9";
chr1 ensembl CDS 10627272 10627363 . + 0 transcript_id "ENST00000356607.9";
chr1 ensembl exon 10629531 10630758 . + . transcript_id "ENST00000356607.9";
chr1 ensembl CDS 10629531 10629984 . + 1 transcript_id "ENST00000356607.9";
chr1 ensembl stop_codon 10629985 10629987 . + 0 transcript_id "ENST00000356607.9";
chr1 ensembl UTR 10474950 10474966 . + . transcript_id "ENST00000356607.9";
chr1 ensembl UTR 10629985 10630758 . + . transcript_id "ENST00000356607.9";
For a more detailed example, check ENSEMBL's GTF files, for instance this one for GRCh38.107 (the human genome)
GTF format details
The full GTF format specification is beyond the scope of this section, and it is assumed you are familiar with it. It's probably a good idea to take a look at the format specification before reading the rest of this section, here are some links:
GTF File name
SnpEff expects the GTF file to be located at
$SNPEFF_HOME/data/GENOME_NAME/genes.gtf
where:
$SNPEFF_HOMEis the directory where SnpEff is installed (usually$HOME/snpEff)GENOME_NAMEis the genome name of the genome you are trying to build, which MUST match the name you added in the config filesnpEff.config
Note: The file name can be genes.gtf.gz if it's compressed using gzip.
GTF lines
In a nutshell, GTF files are text files and each line is parsed separately.
Lines that start with # are treated as comments (i.e. ignored).
Each (non-comment) line is parsed as a tab-separate list of fields, for example:
#!genome-build GRCh38.p13
1 protein_coding gene 69091 70008 . + . gene_id "ENSG00000186092"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
1 protein_coding transcript 69091 70008 . + . gene_id "ENSG00000186092"; transcript_id "ENST00000335137"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-001"; transcript_source "ensembl_havana"; tag "CCDS"; ccds_id "CCDS30547";
1 protein_coding exon 69091 70008 . + . gene_id "ENSG00000186092"; transcript_id "ENST00000335137"; exon_number "1"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-001"; transcript_source "ensembl_havana"; tag "CCDS"; ccds_id "CCDS30547"; exon_id "ENSE00002319515";
1 protein_coding CDS 69091 70005 . + 0 gene_id "ENSG00000186092"; transcript_id "ENST00000335137"; exon_number "1"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-001"; transcript_source "ensembl_havana"; tag "CCDS"; ccds_id "CCDS30547"; protein_id "ENSP00000334393";
1 protein_coding start_codon 69091 69093 . + 0 gene_id "ENSG00000186092"; transcript_id "ENST00000335137"; exon_number "1"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-001"; transcript_source "ensembl_havana"; tag "CCDS"; ccds_id "CCDS30547";
1 protein_coding stop_codon 70006 70008 . + 0 gene_id "ENSG00000186092"; transcript_id "ENST00000335137"; exon_number "1"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-001"; transcript_source "ensembl_havana"; tag "CCDS"; ccds_id "CCDS30547";
It should be noted that lines do NOT have a specific order. Usually information defining a gene tends to be together, but this is not required by the GTF format.
GTF fields
The nine tab-separated fields in each (non-comment) line are:
- seqname: name of the chromosome or scaffold; chromosome names can be given with or without the 'chr' prefix. Important note: the seqname must be one used within Ensembl, i.e. a standard chromosome name or an Ensembl identifier such as a scaffold ID, without any additional content such as species or assembly. See the example GFF output below.
- source: name of the program that generated this feature, or the data source (database or project name)
- feature: feature type name, e.g. Gene, transcript, exon, etc.
- start: Start position* of the feature, with sequence numbering starting at 1.
- end: End position* of the feature, with sequence numbering starting at 1.
- score: A floating point value.
- strand: defined as + (forward), or - (reverse).
- frame: One of '0', '1' or '2'. '0' indicates that the first base of the feature is the first base of a codon, '1' that the second base is the first base of a codon, and so on..
- attribute: A semicolon-separated list of tag-value pairs, providing additional information about each feature.
Info
Also note that '.' denotes an empty field, you cannot just use an empty string to denote an empty field.
GTF field requirements
SnpEff requires that the fields are:
- seqname: Must match the name of the chromosome / scaffold in the reference genome sequence FASTA file (with or without a
chrprepend). - source: This field is ignored by SnpEff.
- feature: These feature types, such as
gene,exon,cds, etc. See details in section GTF Feature - start: One-based chromosome position of feature start (base included).
- end: One-based chromosome position of feature end (base included).
- score: SnpEff ignores this field.
- strand: Considered negative strand if
'-', otherwise interpreted as positive strand. - frame: Interpreted as 'phase', can be
{0, 1, 2}. If empty ('.') or-1is interpreted as "missing". See "GTF Frame details" section below. - attribute: Attribute list, see GTF Attributes section below
GTF Feature
These feature types will be translated to SnpEff entities the following way (case ignored):
| Feature Type | Feature value |
|---|---|
| GENE | gene, protein |
| TRANSCRIPT | pseudogene, transcript, mrna, trna, snorna, rrna, ncrna, mirna, snrna, pseudogenic_transcript |
| EXON | exon, pseudogenic_exon |
| CDS | cds |
| START_CODON | start_codon |
| STOP_CODON | stop_codon |
| UTR5 | five_prime_utr, 5'-utr, 5'utr, 5utr |
| UTR3 | three_prime_utr, 3'-utr, 3'utr, 3utr |
| INTRON_CONSERVED | intron_CNS, intron_cns |
| INTERGENIC_CONSERVED | inter_cns |
GTF Frame
The frame field indicates the number of bases that should be removed from the beginning of this feature to reach the first base of the next codon.
This is typically used in EXON or CDS features within in coding genes.
Possible values are:
0: indicates that the feature begins with a whole codon at the 5' most base.1: means that there is one extra base (the third base of a codon) before the first whole codon and2: means that there are two extra bases (the second and third bases of the codon) before the first codon.: Missing value, SnpEff will infer this value from the feature's coordinates
Info
Sometimes this is called 'phase' instead of frame, to distinguish form the "coding base modulo 3" definition.
Frame correction
SnpEff performs a "frame correction".
If the frame value calculated using the feature (exon) coordinates differs from the one given in the start / end coordinates, the coordinates will be corrected.
This correction is performed in two stages, for each transcript:
i) First exon is corrected by adding a fake 5'UTR
ii) Other exons are corrected by changing the start (or end) coordinates. We drop bases from either the start coordinate (if the exon is on the positive strand) or end coordinate (if the exon is on the negative strand) until the frame matches the one from the GTF.
Check zero frames:
If all frames are zero, there is a high chance that the frame values are incorrectly labeled as zero instead of "missing values" (i.e. '.').
SnpEff will check if all frame values are zero. If there are more than MIN_TOTAL_FRAME_COUNT frame values set (by default 10) and all of them are zero, it will show a warning.
GTF Attributes
The "attributes" field is parsed as a semicolon-separated list of key-value pairs, providing additional information about each feature.
Required attributes are:
| Feature type | Required attributes | Optional attributes |
|---|---|---|
| GENE | ID / GeneID, GeneBioType, | GeneName |
| TRANSCRIPT | ID / TranscriptID, TranscriptBioType, ParentID | transcript_support_level, transcript_version |
| CDS, EXON, STOP_CODON, START_CODON | ID, ParentID / TranscriptID | |
| UTR, UTR5, UTR3 | ID, ParentID / TranscriptID | |
| INTRON_CONSERVED | ID, TranscriptID / TranscriptID | |
| INTERGENIC_CONSERVED | ID |
GTF Attribute: ID
The attribute name can be (not case sensitive, in search order):
idgene_id(if feature type isGENE)transcript_id(if feature type isTRANSCRIPT)exon_id(if feature type isEXON),db_xrefname
If none is available, SnpEff will generate an ID as
feature + "_" + chromosomeName + "_" + start + "_" + end
where feature is the parse "Feature type" .
GTF Attribute: ParentId
The attribute name can be (not case sensitive, in search order):
parentgene(if feature type isTRANSCRIPTorINTRON_CONSERVED)- same as TranscriptId (if feature type is any of 'EXON', 'CDS', 'START_CODON', 'STOP_CODON', 'UTR3', or 'UTR5')
Warning
The value of ParentID must match exactly the ID of the parent feature (e.g. the ParentID for a transcript, must match the ID of the parent gene).
It is a common mistake in some GTF / GFF files to add or remove some characters.
If the IDs don't match, the GTF/GFF file is invalid for SnpEff.
GTF Attribute: GeneId
The attribute name can be (not case sensitive, in search order):
gene_idid(if feature type isGENE)
GeneId value must be a unique ID for each gene in the genome. If the value is repeated, SnpEff will add a dot ('.') followed by an integer number to make it unique.
GTF Attribute: TranscriptId
The attribute name can be (not case sensitive, in search order):
transcript_idid(if feature type isTRANSCRIPT)- or the same as
ParentIDif feature type isEXON
GTF Attribute: GeneName
The attribute name can be (not case sensitive, in search order):
gene_namename(if feature type isGENE)
GTF Attribute: BioType
The attribute name can be (not case sensitive): biotype
Possible values are:
| BioType | Possible attribute values |
|---|---|
| protein_coding | mrna, protein, cds, trna, start_codon, stop_codon, five_prime_utr, 5'-utr, 5'utr, 5utr, three_prime_utr, 3'-utr, 3'utr, 3utr |
| transcribed_processed_pseudogene | pseudogenic_transcript, pseudogenic_exon |
| lincRNA | ncrna |
| rRNA | rrna |
| miRNA | mirna |
| snRNA | snrna |
| snoRNA | snorna |
| prime3_overlapping_ncrna | 3prime_overlapping_ncrna |
If the BioType field is not found, the GTF source field will be parsed, otherwise the feature type will be parsed.
GTF Attribute: GeneBioType
This is similar to BioType, used specifically for feature type GENE
The attribute name can be (not case sensitive, in search order):
gene_biotypegene_typebiotype
Attribute values are parsed the same manner as BioType.
If GeneBioType is protein_coding, then the gene is assumed to be a protein coding (all transcripts within will be also considered protein coding).
GTF Attribute: TranscriptBioType
This is similar to BioType, used specifically for feature type TRANSCRIPT
The attribute name can be (not case sensitive, in search order):
transcript_biotypetranscript_typebiotype
Attribute values are parsed the same manner as BioType.
If TranscriptBioType is protein_coding, then the transcript is assumed to be a protein coding transcript.
GFF
SnpEff treats GFF files the same way as GTF files.
The GFF format is more flexible / lax than GTF. Unfortunately, this extra flexibility also means that it is difficult to find GFF files that fulfill the requirements to build a genomic database, as many people add the information in different ways.
Info
Generally GTF files are preferred to build databases
GFF3 is the currently supported version, the old GFF2 format is deprecated
GFF File name
SnpEff expects the GFF file to be located at
$SNPEFF_HOME/data/GENOME_NAME/genes.gff
$SNPEFF_HOMEis the directory where SnpEff is installed (usually$HOME/snpEff)GENOME_NAMEis the genome name of the genome you are trying to build, which MUST match the name you added in the config filesnpEff.config
Note: The file name can be genes.gff.gz if it's compressed using gzip.
GFF lines and fields
GFF lines and fields are very similar to GTF ones.
The main difference is that the attributes field is formatted as semi-colon separated key=value pairs (in GTF key and value are separated by a space instead of an = sign).
Info
Other than the minor difference in attributes formatting, SnpEff parses and interprets all the fields and attributes exactly the same way as in GTF files.
GFF genome sequence
GFF files can have the reference genome sequence in the same file.
After a special comment ##FASTA you can concatenate the whole genome FASTA file.
For example (see GFF3 Sequence Section):
##gff-version 3
ctg123 . exon 1300 1500 . + . ID=exon00001
ctg123 . exon 1050 1500 . + . ID=exon00002
ctg123 . exon 3000 3902 . + . ID=exon00003
ctg123 . exon 5000 5500 . + . ID=exon00004
ctg123 . exon 7000 9000 . + . ID=exon00005
##FASTA
>ctg123
cttctgggcgtacccgattctcggagaacttgccgcaccattccgccttg
tgttcattgctgcctgcatgttcattgtctacctcggctacgtgtggcta
tctttcctcggtgccctcgtgcacggagtcgagaaaccaaagaacaaaaa
aagaaattaaaatatttattttgctgtggtttttgatgtgtgttttttat
aatgatttttgatgtgaccaattgtacttttcctttaaatgaaatgtaat
cttaaatgtatttccgacgaattcgaggcctgaaaagtgtgacgccattc
...
This makes it easier to distribute the genome reference together with the genome annotations in one file.