##fileformat=VCFv4.1
##CombineVariants="analysis_type=CombineVariants input_file=[] sample_metadata=[] read_buffer_size=null phone_home=STANDARD read_filter=[] intervals=[/seq/references/HybSelOligos/whole_exome_agilent_1.1_refseq_plus_3_boosters/whole_exome_agilent_1.1_refseq_plus_3_boosters.Homo_sapiens_assembly19.targets.interval_list, /humgen/gsa-hpprojects/dev/rpoplin/exome_t2d/GoT2D_exomes_batch_005.cleaned.flanks.interval_list] excludeIntervals=null reference_sequence=/seq/references/Homo_sapiens_assembly19/v1/Homo_sapiens_assembly19.fasta rodBind=[/humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-1/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-2/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-3/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-4/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-5/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-6/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-7/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-8/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-9/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-10/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-11/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-12/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-13/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-14/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-15/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-16/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-17/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-18/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-19/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-20/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-21/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-22/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-23/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-24/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-25/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-26/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-27/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-28/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-29/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-30/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-31/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-32/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-33/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-34/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-35/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-36/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-37/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-38/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-39/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-40/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-41/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-42/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-43/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-44/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-45/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-46/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-47/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-48/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-49/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-50/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-51/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-52/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-53/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-54/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-55/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-56/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-57/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-58/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-59/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-60/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-61/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-62/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-63/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-64/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-65/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-66/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-67/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-68/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-69/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-70/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-71/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-72/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-73/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-74/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-75/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-76/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-77/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-78/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-79/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-80/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-81/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-82/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-83/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-84/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-85/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-86/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-87/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-88/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-89/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-90/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-91/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-92/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-93/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-94/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-95/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-96/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-97/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-98/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-99/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-100/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-101/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-102/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-103/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-104/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-105/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-106/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-107/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-108/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-109/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-110/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-111/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-112/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-113/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-114/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-115/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-116/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-117/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-118/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-119/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-120/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-121/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-122/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-123/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-124/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-125/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-126/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-127/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-128/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-129/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-130/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-131/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-132/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-133/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-134/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-135/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-136/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-137/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-138/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-139/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-140/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-141/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-142/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-143/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-144/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-145/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-146/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-147/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-148/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-149/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-150/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-151/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-152/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-153/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-154/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-155/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-156/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-157/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-158/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-159/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-160/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-161/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-162/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-163/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-164/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-165/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-166/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-167/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-168/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-169/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-170/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-171/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-172/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-173/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-174/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-175/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-176/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-177/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-178/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-179/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-180/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-181/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-182/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-183/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-184/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-185/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-186/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-187/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-188/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-189/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-190/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-191/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-192/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-193/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-194/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-195/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-196/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-197/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-198/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-199/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-200/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-201/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-202/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-203/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-204/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-205/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-206/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-207/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-208/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-209/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-210/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-211/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-212/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-213/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-214/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-215/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-216/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-217/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-218/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-219/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-220/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-221/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-222/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-223/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-224/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-225/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-226/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-227/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-228/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-229/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-230/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-231/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-232/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-233/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-234/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-235/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-236/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-237/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-238/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-239/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-240/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-241/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-242/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-243/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-244/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-245/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-246/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-247/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-248/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-249/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-250/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-251/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-252/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-253/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-254/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-255/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-256/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-257/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-258/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-259/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-260/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-261/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-262/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-263/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-264/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-265/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-266/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-267/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-268/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-269/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-270/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-271/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-272/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-273/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-274/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-275/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-276/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-277/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-278/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-279/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-280/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-281/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-282/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-283/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-284/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-285/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-286/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-287/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-288/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-289/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-290/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-291/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-292/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-293/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-294/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-295/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-296/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-297/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-298/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-299/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-300/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-301/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-302/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-303/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-304/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-305/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-306/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-307/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-308/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-309/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-310/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-311/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-312/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-313/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-314/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-315/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-316/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-317/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-318/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-319/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-320/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-321/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-322/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-323/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-324/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-325/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-326/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-327/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-328/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-329/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-330/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-331/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-332/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-333/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-334/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-335/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-336/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-337/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-338/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-339/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-340/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-341/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-342/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-343/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-344/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-345/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-346/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-347/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-348/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-349/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-350/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-351/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-352/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-353/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-354/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-355/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-356/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-357/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-358/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-359/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-360/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-361/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-362/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-363/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-364/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-365/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-366/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-367/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-368/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-369/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-370/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-371/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-372/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-373/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-374/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-375/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-376/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-377/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-378/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-379/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-380/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-381/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-382/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-383/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-384/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-385/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-386/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-387/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-388/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-389/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-390/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-391/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-392/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-393/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-394/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-395/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-396/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-397/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-398/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-399/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-400/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-401/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-402/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-403/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-404/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-405/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-406/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-407/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-408/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-409/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-410/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-411/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-412/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-413/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-414/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-415/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-416/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-417/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-418/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-419/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-420/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-421/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-422/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-423/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-424/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-425/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-426/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-427/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-428/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-429/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-430/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-431/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-432/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-433/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-434/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-435/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-436/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-437/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-438/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-439/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-440/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-441/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-442/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-443/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-444/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-445/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-446/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-447/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-448/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-449/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-450/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-451/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-452/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-453/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-454/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-455/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-456/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-457/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-458/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-459/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-460/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-461/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-462/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-463/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-464/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-465/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-466/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-467/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-468/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-469/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-470/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-471/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-472/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-473/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-474/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-475/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-476/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-477/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-478/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-479/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-480/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-481/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-482/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-483/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-484/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-485/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-486/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-487/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-488/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-489/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-490/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-491/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-492/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-493/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-494/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-495/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-496/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-497/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-498/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-499/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-500/EUR.wex.broad.illumina.20110521.snps.genotypes.vcf] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false DBSNP=null downsampling_type=null downsample_to_fraction=null downsample_to_coverage=null baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub genotypemergeoption=PRIORITIZE filteredrecordsmergetype=KEEP_IF_ANY_UNFILTERED rod_priority_list=input0,input1,input2,input3,input4,input5,input6,input7,input8,input9,input10,input11,input12,input13,input14,input15,input16,input17,input18,input19,input20,input21,input22,input23,input24,input25,input26,input27,input28,input29,input30,input31,input32,input33,input34,input35,input36,input37,input38,input39,input40,input41,input42,input43,input44,input45,input46,input47,input48,input49,input50,input51,input52,input53,input54,input55,input56,input57,input58,input59,input60,input61,input62,input63,input64,input65,input66,input67,input68,input69,input70,input71,input72,input73,input74,input75,input76,input77,input78,input79,input80,input81,input82,input83,input84,input85,input86,input87,input88,input89,input90,input91,input92,input93,input94,input95,input96,input97,input98,input99,input100,input101,input102,input103,input104,input105,input106,input107,input108,input109,input110,input111,input112,input113,input114,input115,input116,input117,input118,input119,input120,input121,input122,input123,input124,input125,input126,input127,input128,input129,input130,input131,input132,input133,input134,input135,input136,input137,input138,input139,input140,input141,input142,input143,input144,input145,input146,input147,input148,input149,input150,input151,input152,input153,input154,input155,input156,input157,input158,input159,input160,input161,input162,input163,input164,input165,input166,input167,input168,input169,input170,input171,input172,input173,input174,input175,input176,input177,input178,input179,input180,input181,input182,input183,input184,input185,input186,input187,input188,input189,input190,input191,input192,input193,input194,input195,input196,input197,input198,input199,input200,input201,input202,input203,input204,input205,input206,input207,input208,input209,input210,input211,input212,input213,input214,input215,input216,input217,input218,input219,input220,input221,input222,input223,input224,input225,input226,input227,input228,input229,input230,input231,input232,input233,input234,input235,input236,input237,input238,input239,input240,input241,input242,input243,input244,input245,input246,input247,input248,input249,input250,input251,input252,input253,input254,input255,input256,input257,input258,input259,input260,input261,input262,input263,input264,input265,input266,input267,input268,input269,input270,input271,input272,input273,input274,input275,input276,input277,input278,input279,input280,input281,input282,input283,input284,input285,input286,input287,input288,input289,input290,input291,input292,input293,input294,input295,input296,input297,input298,input299,input300,input301,input302,input303,input304,input305,input306,input307,input308,input309,input310,input311,input312,input313,input314,input315,input316,input317,input318,input319,input320,input321,input322,input323,input324,input325,input326,input327,input328,input329,input330,input331,input332,input333,input334,input335,input336,input337,input338,input339,input340,input341,input342,input343,input344,input345,input346,input347,input348,input349,input350,input351,input352,input353,input354,input355,input356,input357,input358,input359,input360,input361,input362,input363,input364,input365,input366,input367,input368,input369,input370,input371,input372,input373,input374,input375,input376,input377,input378,input379,input380,input381,input382,input383,input384,input385,input386,input387,input388,input389,input390,input391,input392,input393,input394,input395,input396,input397,input398,input399,input400,input401,input402,input403,input404,input405,input406,input407,input408,input409,input410,input411,input412,input413,input414,input415,input416,input417,input418,input419,input420,input421,input422,input423,input424,input425,input426,input427,input428,input429,input430,input431,input432,input433,input434,input435,input436,input437,input438,input439,input440,input441,input442,input443,input444,input445,input446,input447,input448,input449,input450,input451,input452,input453,input454,input455,input456,input457,input458,input459,input460,input461,input462,input463,input464,input465,input466,input467,input468,input469,input470,input471,input472,input473,input474,input475,input476,input477,input478,input479,input480,input481,input482,input483,input484,input485,input486,input487,input488,input489,input490,input491,input492,input493,input494,input495,input496,input497,input498,input499 printComplexMerges=false filteredAreUncalled=false minimalVCF=false setKey=set assumeIdenticalSamples=true minimumN=1 masterMerge=false mergeInfoWithMaxAC=false"
##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth (only filtered reads used for calling)">
##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification">
##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes, for each ALT allele, in the same order as listed">
##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency, for each ALT allele, in the same order as listed">
##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
##INFO=<ID=DB,Number=0,Type=Flag,Description="dbSNP Membership">
##INFO=<ID=DS,Number=0,Type=Flag,Description="Were any of the samples downsampled?">
##INFO=<ID=set,Number=1,Type=String,Description="Source VCF for the merged record in CombineVariants">
##UnifiedGenotyper="analysis_type=UnifiedGenotyper input_file=[/humgen/1kg/exomes/lists/phaseI_processing/EUR.bam.list] sample_metadata=[] read_buffer_size=null phone_home=STANDARD read_filter=[] intervals=[/humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/GGA/queueScatterGather/Q-32575@gsa2-2-sg/temp-482/scatter.intervals] excludeIntervals=null reference_sequence=/seq/references/Homo_sapiens_assembly19/v1/Homo_sapiens_assembly19.fasta rodBind=[/humgen/gsa-hpprojects/GATK/data/Comparisons/Validated/dbSNP/dbsnp_132_b37.leftAligned.vcf, /humgen/gsa-hpprojects/dev/rpoplin/exome_1kg/alleles.vcf] rodToIntervalTrackName=null BTI_merge_rule=UNION nonDeterministicRandomSeed=false DBSNP=null downsampling_type=null downsample_to_fraction=null downsample_to_coverage=70 baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false defaultBaseQualities=-1 validation_strictness=SILENT unsafe=null num_threads=1 interval_merging=ALL read_group_black_list=null processingTracker=null restartProcessingTracker=false processingTrackerStatusFile=null processingTrackerID=-1 allow_intervals_with_unindexed_bam=false disable_experimental_low_memory_sharding=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT heterozygosity=0.0010 pcr_error_rate=1.0E-4 genotyping_mode=GENOTYPE_GIVEN_ALLELES output_mode=EMIT_ALL_SITES standard_min_confidence_threshold_for_calling=0.0 standard_min_confidence_threshold_for_emitting=30.0 noSLOD=true assume_single_sample_reads=null abort_at_too_much_coverage=-1 min_base_quality_score=17 min_mapping_quality_score=20 max_deletion_fraction=0.05 min_indel_count_for_genotyping=5 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10.0 indelGapOpenPenalty=45.0 indelHaplotypeSize=80 doContextDependentGapPenalties=true getGapPenaltiesFromData=false indel_recal_file=indel.recal_data.csv indelDebug=false dovit=false GSA_PRODUCTION_ONLY=false exactCalculation=LINEAR_EXPERIMENTAL ignoreSNPAlleles=false output_all_callable_bases=false genotype=false out=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub NO_HEADER=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VCFWriterStub debug_file=null metrics_file=null annotation=[ChromosomeCounts]"
#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
22	17071756	.	T	C	2313.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17072035	.	C	T	1036.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17072258	.	C	A	923.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17072674	.	G	A	1227.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17072747	.	T	C	1729.18	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	17072781	.	C	T	1018.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17073043	.	C	T	1226.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17073066	.	A	G	184146.49	PASS	AC=1386;AF=0.84307;AN=1644;DS;set=Intersection
22	17073119	.	C	T	1458.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17073131	.	C	T	1084.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17073134	.	C	A	609.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17073145	.	T	G	805.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17073148	.	G	A	572.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17073150	.	C	T	3172.38	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	17073153	.	G	C	787.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17073178	.	C	T	806.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17073198	.	C	T	4893.04	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	17073275	.	G	A	4474.96	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	17073466	.	C	T	343.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17073475	.	C	T	21685.13	PASS	AC=104;AF=0.06326;AN=1644;DS;set=Intersection
22	17280774	.	T	C	1253.42	PASS	AC=1;AF=0.00091;AN=1104;DS;set=Intersection
22	17280778	.	T	C	6847.71	PASS	AC=5;AF=0.00455;AN=1098;DS;set=Intersection
22	17280822	.	G	A	75947.97	PASS	AC=138;AF=0.12684;AN=1088;DS;set=Intersection
22	17280882	.	C	A	8986.49	PASS	AC=9;AF=0.00826;AN=1090;DS;set=Intersection
22	17280889	.	G	A	6943.82	PASS	AC=6;AF=0.00554;AN=1084;DS;set=Intersection
22	17280941	.	T	C	2602.48	PASS	AC=3;AF=0.00276;AN=1086;DS;set=Intersection
22	17288581	.	C	T	1398.02	PASS	AC=1;AF=0.00092;AN=1090;DS;set=Intersection
22	17288641	.	C	A	1007.30	PASS	AC=1;AF=0.00089;AN=1118;DS;set=Intersection
22	17288849	.	A	G	6351.38	PASS	AC=6;AF=0.00519;AN=1156;DS;set=Intersection
22	17288988	.	T	C	18691.41	PASS	AC=53;AF=0.04220;AN=1256;DS;set=Intersection
22	17444582	.	G	A	113.46	PASS	AC=1;AF=0.00073;AN=1374;set=Intersection
22	17444640	.	G	A	1147.50	PASS	AC=1;AF=0.00074;AN=1358;DS;set=Intersection
22	17444714	.	C	T	251.82	PASS	AC=2;AF=0.00149;AN=1338;DS;set=Intersection
22	17444748	.	A	G	5674.75	PASS	AC=26;AF=0.01912;AN=1360;DS;set=Intersection
22	17445640	.	AC	A	9505.89	PASS	AC=25;AF=0.01523;AN=1642;DS;set=Intersection
22	17445710	.	C	T	27975.17	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	17445711	.	G	A	1120.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17445734	.	G	A	613.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17446153	.	G	C	335.80	PASS	AC=1;AF=0.00068;AN=1466;DS;set=Intersection
22	17446157	.	G	T	5545.28	PASS	AC=60;AF=0.04127;AN=1454;DS;set=Intersection
22	17446991	.	C	T	331472.98	PASS	AC=1236;AF=0.83176;AN=1486;DS;set=Intersection
22	17446995	.	T	C	854.79	PASS	AC=1;AF=0.00068;AN=1478;DS;set=Intersection
22	17447036	.	C	G	23373.94	PASS	AC=25;AF=0.01746;AN=1432;DS;set=Intersection
22	17447138	.	C	G	2653.56	PASS	AC=5;AF=0.00363;AN=1378;DS;set=Intersection
22	17447173	.	G	A	865.69	PASS	AC=1;AF=0.00073;AN=1372;DS;set=Intersection
22	17447184	.	C	G	752.85	PASS	AC=1;AF=0.00075;AN=1342;DS;set=Intersection
22	17447237	.	C	G	2671.57	PASS	AC=8;AF=0.00601;AN=1332;DS;set=Intersection
22	17447241	.	A	G	321	PASS	AC=1;AF=0.00076;AN=1320;DS;set=Intersection
22	17449238	.	T	C	560.94	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	17449263	.	G	A	615.49	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	17450920	.	T	C	665.07	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	17450929	.	C	T	23742.30	PASS	AC=52;AF=0.03182;AN=1634;DS;set=Intersection
22	17450952	.	A	G	7792.84	PASS	AC=23;AF=0.01418;AN=1622;DS;set=Intersection
22	17450969	.	G	A	882.35	PASS	AC=1;AF=0.00061;AN=1630;DS;set=Intersection
22	17450978	.	G	A	1131.15	PASS	AC=2;AF=0.00123;AN=1624;DS;set=Intersection
22	17451081	.	C	T	470.58	PASS	AC=1;AF=0.00061;AN=1632;DS;set=Intersection
22	17451120	.	A	T	936.86	PASS	AC=1;AF=0.00062;AN=1602;DS;set=Intersection
22	17451123	.	A	T	836.60	PASS	AC=2;AF=0.00124;AN=1610;DS;set=Intersection
22	17468815	.	G	A	6656.15	PASS	AC=38;AF=0.02650;AN=1434;set=Intersection
22	17468873	.	G	A	919.03	PASS	AC=4;AF=0.00258;AN=1550;set=Intersection
22	17468875	.	C	T	228.53	PASS	AC=1;AF=0.00065;AN=1544;set=Intersection
22	17468886	.	G	A	272.25	PASS	AC=4;AF=0.00258;AN=1550;set=Intersection
22	17468901	.	G	A	764.81	PASS	AC=2;AF=0.00128;AN=1564;DS;set=Intersection
22	17468918	.	C	A	1602.61	PASS	AC=20;AF=0.01285;AN=1556;DS;set=Intersection
22	17468948	.	G	A	41.93	PASS	AC=1;AF=0.00064;AN=1574;DS;set=Intersection
22	17469026	.	G	A	54948.01	PASS	AC=646;AF=0.40680;AN=1588;DS;set=Intersection
22	17469049	.	C	A	37810.19	PASS	AC=558;AF=0.35769;AN=1560;DS;set=Intersection
22	17469056	.	G	A	74.22	PASS	AC=1;AF=0.00063;AN=1582;DS;set=Intersection
22	17472785	.	G	A	6682.21	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	17472860	.	C	T	1226.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17472967	.	G	T	993.54	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	17472983	.	G	A	792.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17473071	.	G	C	2852	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	17488793	.	C	T	45.89	PASS	AC=1;AF=0.00070;AN=1426;set=Intersection
22	17488823	.	C	CG	62122.33	PASS	AC=1225;AF=0.84599;AN=1448;set=Intersection
22	17488938	.	A	G	375.26	PASS	AC=4;AF=0.00274;AN=1460;set=Intersection
22	17488995	.	G	A	232.57	PASS	AC=1;AF=0.00068;AN=1462;set=Intersection
22	17489005	.	G	A	68.44	PASS	AC=2;AF=0.00135;AN=1482;set=Intersection
22	17565932	.	T	C	2623.53	PASS	AC=374;AF=0.7792;AN=480;set=Intersection
22	17565974	.	G	C	3501.43	PASS	AC=415;AF=0.7743;AN=536;set=Intersection
22	17577965	.	C	T	1388.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17577994	.	GTTC	G	646.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17578008	.	T	C	6369.76	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	17578680	.	C	T	474.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17578788	.	G	A	834.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17578842	.	G	T	1088.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17579761	.	G	A	489.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17579825	.	T	C	411	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17581199	.	G	C	38879.27	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	17581208	.	G	A	947.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17581224	.	C	T	42769.36	PASS	AC=98;AF=0.05961;AN=1644;DS;set=Intersection
22	17581248	.	C	T	589.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17581286	.	G	C	1870.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17582877	.	G	T	25981.37	PASS	AC=59;AF=0.03589;AN=1644;DS;set=Intersection
22	17582958	.	T	C	1162.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17582971	.	ACACATG	A	5294.42	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	17582986	.	C	T	5263.44	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	17582987	.	G	A	4738.46	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	17583012	.	G	A	9799.88	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	17583085	.	G	T	1379.25	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	17583212	.	C	T	2096.17	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	17584369	.	C	T	384.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17584386	.	C	T	1052.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17584454	.	G	A	2843.49	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	17585624	.	C	G	745.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17585642	.	C	T	2874.66	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	17585658	.	C	T	250.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17585668	.	C	T	805.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17585703	.	AG	A	325	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17585739	.	A	G	1130.89	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	17586471	.	C	T	351526.85	PASS	AC=1348;AF=0.81995;AN=1644;DS;set=Intersection
22	17586491	.	G	A,C,T	2196.37	PASS	AC=3,1,0;AF=0.00182,0.00061,0.00000;AN=1644;DS;set=Intersection
22	17586513	.	G	A	4959.31	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	17586714	.	CATCA	C	89645.56	PASS	AC=808;AF=0.49148;AN=1644;DS;set=Intersection
22	17586715	.	ATCAC	A	206399.82	PASS	AC=924;AF=0.56204;AN=1644;DS;set=Intersection
22	17586720	.	TCACG	T	85740.27	PASS	AC=727;AF=0.44221;AN=1644;DS;set=Intersection
22	17586751	.	C	T	494.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17586757	.	T	C	797.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17586777	.	G	A	670.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17586887	.	A	G	661.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17588578	.	C	G	1461.16	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17588588	.	C	A	10059.62	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	17589152	.	T	G	13736.94	PASS	AC=153;AF=0.09318;AN=1642;set=Intersection
22	17589158	.	C	G	140.31	PASS	AC=2;AF=0.00122;AN=1642;set=Intersection
22	17589209	.	C	T	79517.32	PASS	AC=417;AF=0.25365;AN=1644;DS;set=Intersection
22	17589225	.	C	T	4790.48	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	17589231	.	G	A	404.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17589246	.	G	A	49221.07	PASS	AC=158;AF=0.09611;AN=1644;DS;set=Intersection
22	17589283	.	G	T	448.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17589297	.	G	A	50317.96	PASS	AC=180;AF=0.10949;AN=1644;DS;set=Intersection
22	17589341	.	C	T	636.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17589362	.	A	C	490.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17589412	.	G	A	292.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17589447	.	G	A	253.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17589490	.	C	T	203.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17589516	.	C	T	385.46	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	17589521	.	A	G	493.17	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	17589567	.	C	T	28539.78	PASS	AC=254;AF=0.15450;AN=1644;DS;set=Intersection
22	17589639	.	C	T	115.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17589753	.	C	T	45.53	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	17589794	.	C	A	22091.10	PASS	AC=182;AF=0.11071;AN=1644;set=Intersection
22	17589798	.	C	T	538.39	PASS	AC=2;AF=0.00122;AN=1644;set=Intersection
22	17589856	.	G	C	586.33	PASS	AC=4;AF=0.00243;AN=1644;set=Intersection
22	17589928	.	G	A	1182.42	PASS	AC=12;AF=0.00731;AN=1642;set=Intersection
22	17589948	.	G	C	410	PASS	AC=2;AF=0.00122;AN=1636;set=Intersection
22	17590006	.	C	G	188.11	PASS	AC=2;AF=0.00128;AN=1568;set=Intersection
22	17590180	.	G	A	4994.32	PASS	AC=138;AF=0.09115;AN=1514;set=Intersection
22	17590261	.	T	G	67.78	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	17590269	.	C	T	24791.40	PASS	AC=364;AF=0.22168;AN=1642;set=Intersection
22	17590313	.	C	T	84.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17590399	.	G	T	96.38	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	17590404	.	G	A	6008.73	PASS	AC=35;AF=0.02132;AN=1642;set=Intersection
22	17590439	.	A	G	128.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17590490	.	A	C	57.15	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	17590498	.	A	G	1750.88	PASS	AC=11;AF=0.00671;AN=1640;DS;set=Intersection
22	17590515	.	G	A	304.46	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	17590541	.	TGGAGGAAGA	T	322.90	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	17590599	.	C	T	5585.03	PASS	AC=54;AF=0.03309;AN=1632;set=Intersection
22	17590744	.	T	C	9065.57	PASS	AC=417;AF=0.27874;AN=1496;set=Intersection
22	17600282	.	C	T	88.08	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	17600293	.	G	A	44160.66	PASS	AC=274;AF=0.16707;AN=1640;DS;set=Intersection
22	17600313	.	C	T	475.26	PASS	AC=7;AF=0.00426;AN=1642;DS;set=Intersection
22	17600393	.	G	A	381.31	PASS	AC=3;AF=0.00184;AN=1632;DS;set=Intersection
22	17600448	.	G	A	66.71	PASS	AC=1;AF=0.00062;AN=1606;set=Intersection
22	17600497	.	G	A	21903.74	PASS	AC=268;AF=0.16729;AN=1602;set=Intersection
22	17600672	.	G	A	1917.53	PASS	AC=23;AF=0.01501;AN=1532;set=Intersection
22	17600689	.	G	A	2731.06	PASS	AC=51;AF=0.03236;AN=1576;set=Intersection
22	17600857	.	G	A	35.38	PASS	AC=1;AF=0.00062;AN=1618;set=Intersection
22	17600890	.	G	A	115.92	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	17600895	.	C	T	30.50	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	17600977	.	G	A	70011.52	PASS	AC=768;AF=0.46772;AN=1642;DS;set=Intersection
22	17601199	.	G	A	2825.93	PASS	AC=26;AF=0.02321;AN=1120;set=Intersection
22	17601271	.	G	A	4014.73	PASS	AC=23;AF=0.01650;AN=1394;DS;set=Intersection
22	17601299	.	CCCA	C	89.24	PASS	AC=8;AF=0.00551;AN=1452;DS;set=Intersection
22	17601438	.	G	T	110.30	PASS	AC=6;AF=0.00470;AN=1276;set=Intersection
22	17601466	.	T	C	1295.08	PASS	AC=223;AF=0.2483;AN=898;set=Intersection
22	17618882	.	C	T	878.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17618937	.	G	A	1989.15	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	17619076	.	C	G	20525.80	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	17619130	.	T	C	3103.77	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	17619281	.	G	A	1128.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17619282	.	G	A	737.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17619292	.	C	T	65363.25	PASS	AC=273;AF=0.16606;AN=1644;DS;set=Intersection
22	17619393	.	A	G	40394.91	PASS	AC=133;AF=0.08090;AN=1644;DS;set=Intersection
22	17619407	.	T	C	2379.38	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	17619428	.	A	G	1245.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17619661	.	T	G	1061.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17622001	.	C	T	3125.86	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	17622065	.	A	G	328.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17622089	.	C	A	638.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17622140	.	C	T	65.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17622171	.	C	T	114.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17623945	.	C	T	553.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17624013	.	C	T	604.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17624041	.	A	G	664.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17624063	.	T	G	841.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17625915	.	G	A	11993.11	PASS	AC=43;AF=0.02616;AN=1644;DS;set=Intersection
22	17625970	.	G	A	338.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17629300	.	C	A	842.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17629319	.	G	A	540.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17629357	.	C	G	1107.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17629383	.	C	T	996.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17630389	.	G	C	112812.44	PASS	AC=752;AF=0.45742;AN=1644;DS;set=Intersection
22	17630393	.	C	T	17704.63	PASS	AC=84;AF=0.05109;AN=1644;DS;set=Intersection
22	17630401	.	T	C	382.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17630486	.	C	A	205297.35	PASS	AC=980;AF=0.59611;AN=1644;DS;set=Intersection
22	17630540	.	C	T	1709.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17630647	.	G	A	60467.01	PASS	AC=167;AF=0.10158;AN=1644;DS;set=Intersection
22	17630667	.	T	C	1401.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17640045	.	G	A	2211.48	PASS	AC=180;AF=0.2211;AN=814;set=Intersection
22	17640189	.	G	C	124.60	PASS	AC=24;AF=0.1519;AN=158;set=Intersection
22	17646132	.	C	A	591.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17662444	.	C	G	812.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17662679	.	C	T	80657.61	PASS	AC=335;AF=0.20377;AN=1644;DS;set=Intersection
22	17662699	.	A	G	89297.93	PASS	AC=329;AF=0.20012;AN=1644;DS;set=Intersection
22	17662767	.	A	G	622.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17662793	.	A	G	92298.61	PASS	AC=335;AF=0.20377;AN=1644;DS;set=Intersection
22	17662917	.	G	C	81693.37	PASS	AC=331;AF=0.20134;AN=1644;DS;set=Intersection
22	17663445	.	T	C	873.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17663666	.	ATGGTCTTCCATGGGGGATGGATGGGTC	A	2354.35	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	17669199	.	G	A	49831.98	PASS	AC=271;AF=0.16484;AN=1644;DS;set=Intersection
22	17669211	.	C	T	646.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17669238	.	C	T	645.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17669242	.	G	A	246.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17669245	.	G	T	1804.75	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	17669265	.	C	T	175	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17669306	.	T	C	126092.92	PASS	AC=542;AF=0.32968;AN=1644;DS;set=Intersection
22	17669335	.	C	T	318.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17669375	.	C	T	899.25	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	17670786	.	G	A	16752.50	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	17670794	.	C	T	956.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17670807	.	C	T	21268.09	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	17670854	.	G	A	1140.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17670877	.	C	T	650.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17670945	.	A	G	2426.04	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	17672671	.	G	A	839.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17680392	.	C	T	1445.72	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	17684498	.	G	A	670.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17684517	.	C	T	912.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17684546	.	G	A	1264.38	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	17684619	.	A	G	282.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17684628	.	G	T	337.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17687954	.	T	C	1479.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17687992	.	G	A	8526.16	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	17687997	.	C	T	1287.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17688077	.	C	A	787.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17688141	.	A	G	848.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17688213	.	G	A	14209.58	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	17688215	.	G	A	1434.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	17690409	.	G	A	110977.50	PASS	AC=500;AF=0.30414;AN=1644;DS;set=Intersection
22	17690430	.	C	G	73335.62	PASS	AC=297;AF=0.18066;AN=1644;DS;set=Intersection
22	17690574	.	G	C	454.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17690609	.	C	A	365.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	17690610	.	G	A	635.28	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18062738	.	C	G	472.82	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	18062777	.	G	A	127.25	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	18063849	.	G	A	853.70	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	18064097	.	T	C	773.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18065279	.	C	G	2217.46	PASS	AC=2;AF=0.00123;AN=1624;DS;set=Intersection
22	18065309	.	A	G	1880.88	PASS	AC=2;AF=0.00122;AN=1636;DS;set=Intersection
22	18065342	.	C	T	306.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18065345	.	C	A	85.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18065385	.	A	C	836.10	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	18065388	.	G	A	110.60	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	18066150	.	C	A	2078.96	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18066269	.	C	T	603.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18066342	.	G	C	483.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18069895	.	C	T	11397.15	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	18069904	.	G	A	891.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18070015	.	C	T	1148.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18070022	.	A	G	913.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18070103	.	C	T	425.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18070743	.	C	T	953.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18070748	.	G	A	703.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18070763	.	C	T	1009.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18070872	.	C	T	21993.56	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	18072311	.	G	GAT	1298.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18072317	.	A	C	4414.02	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	18072333	.	A	ACTT	53900.43	PASS	AC=162;AF=0.09854;AN=1644;DS;set=Intersection
22	18072346	.	C	T	700.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18072464	.	G	T	1864.97	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	18072986	.	T	TA	962.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18073013	.	A	C	2898.24	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	18073027	.	C	A	547.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18073034	.	C	T	2026.88	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	18073035	.	G	A	17941.29	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	18073043	.	T	G	8714.91	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	18075417	.	G	A	55168.69	PASS	AC=56;AF=0.03406;AN=1644;DS;set=Intersection
22	18075532	.	A	G	8377.92	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	18077280	.	T	C	13465.67	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	18077334	.	G	A	14551.22	PASS	AC=54;AF=0.03289;AN=1642;DS;set=Intersection
22	18077386	.	CA	C	44687.75	PASS	AC=570;AF=0.34799;AN=1638;DS;set=Intersection
22	18080930	.	G	A	893.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18080962	.	G	A	4785.49	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	18081046	.	C	G	1060.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18081074	.	TGA	T	983.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18081090	.	G	GAAATATGAAGC	5136.20	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	18081093	.	C	A	13458.30	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	18081096	.	T	C	1579.07	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18081099	.	A	G	872.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18082784	.	G	A	650.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18082836	.	C	T	363.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18082872	.	TA	T	865.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18082898	.	A	C	670.26	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	18083979	.	A	G	2030.89	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18095609	.	T	C	6760.59	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	18095617	.	C	T	13042.39	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	18095957	.	T	G	765.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18095994	.	A	T	3228.29	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	18102311	.	T	G	869.17	PASS	AC=5;AF=0.00305;AN=1640;DS;set=Intersection
22	18111431	.	T	C	216325.27	PASS	AC=552;AF=0.33577;AN=1644;DS;set=Intersection
22	18111436	.	T	C	1334.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18111441	.	T	C	826.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18138441	.	A	G	313.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18165995	.	T	G	52758.72	PASS	AC=159;AF=0.09672;AN=1644;DS;set=Intersection
22	18166021	.	A	G	21739.83	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	18171776	.	G	A	5825.68	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	18171840	.	T	C	635.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18171842	.	T	G	883.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18178859	.	C	T	222745.53	PASS	AC=1441;AF=0.87652;AN=1644;DS;set=Intersection
22	18178908	.	C	G	1648.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18178981	.	C	T	172.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18185038	.	A	G	827.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18185118	.	A	G	1084.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18185123	.	G	T	2182.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18185166	.	T	A	385.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18209496	.	A	G	5991.90	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	18209524	.	C	T	373.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18209599	.	C	T	657.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18209613	.	A	G	224243.29	PASS	AC=1097;AF=0.66727;AN=1644;DS;set=Intersection
22	18209718	.	C	T	48654.11	PASS	AC=121;AF=0.07360;AN=1644;DS;set=Intersection
22	18209719	.	G	A	729.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18209769	.	C	T	338.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18209920	.	C	T	42013.31	PASS	AC=109;AF=0.06630;AN=1644;DS;set=Intersection
22	18209989	.	G	A	1262.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18210130	.	GAGA	G	1226.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18210177	.	C	T	12378.22	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	18210242	.	C	T	1258.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18218311	.	G	A	6059.72	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	18218344	.	G	A	1198.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18218353	.	A	G	1578.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18220746	.	G	A	755.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18220774	.	G	C	1049.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18220811	.	C	T	490.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18220831	.	A	G	51849.68	PASS	AC=134;AF=0.08151;AN=1644;DS;set=Intersection
22	18220857	.	G	A	1866.18	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18220916	.	A	G	586.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18222085	.	C	T	514.39	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	18222089	.	C	A	15581.95	PASS	AC=131;AF=0.07988;AN=1640;DS;set=Intersection
22	18222113	.	A	G	467.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18222169	.	C	T	689.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18222199	.	G	A	421.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18222263	.	A	G	169220.58	PASS	AC=1228;AF=0.74696;AN=1644;DS;set=Intersection
22	18226521	.	C	T	46650.69	PASS	AC=942;AF=0.57369;AN=1642;set=Intersection
22	18226528	.	G	A	10469.29	PASS	AC=105;AF=0.06387;AN=1644;set=Intersection
22	18226590	.	G	A	144.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18226612	.	A	G	8163.21	PASS	AC=100;AF=0.06083;AN=1644;DS;set=Intersection
22	18226666	.	G	A	814.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18226689	.	T	C	502.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18226708	.	A	G	1046.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18226764	.	T	C	25250.57	PASS	AC=94;AF=0.05718;AN=1644;DS;set=Intersection
22	18226771	.	G	A	6420.16	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	18226792	.	G	C	640.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18232837	.	C	T	175.21	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	18232954	.	C	T	120.51	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	18232966	.	G	C	391.07	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	18273463	.	G	A	8533.77	PASS	AC=160;AF=0.12739;AN=1256;set=Intersection
22	18273475	.	A	T	288.17	PASS	AC=4;AF=0.00315;AN=1270;set=Intersection
22	18273560	.	C	G	409.63	PASS	AC=3;AF=0.00228;AN=1318;set=Intersection
22	18273641	.	T	C	577.78	PASS	AC=1;AF=0.00070;AN=1428;DS;set=Intersection
22	18273696	.	A	G	585.33	PASS	AC=2;AF=0.00150;AN=1334;DS;set=Intersection
22	18273697	.	A	C	488	PASS	AC=2;AF=0.00150;AN=1330;DS;set=Intersection
22	18273976	.	C	A	2461.56	PASS	AC=8;AF=0.00552;AN=1448;DS;set=Intersection
22	18273978	.	G	A	356.14	PASS	AC=1;AF=0.00069;AN=1444;DS;set=Intersection
22	18274009	.	C	G	843.31	PASS	AC=1;AF=0.00074;AN=1356;DS;set=Intersection
22	18274071	.	C	T	84.69	PASS	AC=1;AF=0.00076;AN=1318;DS;set=Intersection
22	18274089	.	C	T	863.01	PASS	AC=3;AF=0.00228;AN=1318;set=Intersection
22	18274092	.	G	C	33002.15	PASS	AC=333;AF=0.25537;AN=1304;set=Intersection
22	18291566	.	G	A	53.32	PASS	AC=1;AF=0.00082;AN=1216;set=Intersection
22	18293422	.	C	T	745.22	PASS	AC=8;AF=0.00563;AN=1420;set=Intersection
22	18293502	.	C	T	2195.02	PASS	AC=12;AF=0.00802;AN=1496;DS;set=Intersection
22	18293533	.	C	T	591.49	PASS	AC=1;AF=0.00065;AN=1532;DS;set=Intersection
22	18293565	.	C	T	370.59	PASS	AC=1;AF=0.00066;AN=1516;DS;set=Intersection
22	18293574	.	T	C	773.33	PASS	AC=1;AF=0.00066;AN=1506;DS;set=Intersection
22	18293618	.	G	A	886.08	PASS	AC=3;AF=0.00211;AN=1420;DS;set=Intersection
22	18299495	.	G	A	42.79	PASS	AC=1;AF=0.00075;AN=1334;set=Intersection
22	18300031	.	G	T	590.69	PASS	AC=12;AF=0.00979;AN=1226;set=Intersection
22	18300040	.	C	A	33.42	PASS	AC=1;AF=0.00077;AN=1300;set=Intersection
22	18300070	.	G	A	67.29	PASS	AC=1;AF=0.00076;AN=1312;set=Intersection
22	18300089	.	C	T	76.17	PASS	AC=1;AF=0.00076;AN=1320;set=Intersection
22	18300171	.	C	A	231.82	PASS	AC=1;AF=0.00082;AN=1226;set=Intersection
22	18300200	.	C	A	267.50	PASS	AC=1;AF=0.00083;AN=1208;DS;set=Intersection
22	18300201	.	G	A	948.12	PASS	AC=3;AF=0.00248;AN=1208;DS;set=Intersection
22	18300240	.	T	C	85313.13	PASS	AC=496;AF=0.40391;AN=1228;DS;set=Intersection
22	18300264	.	C	T	5863.14	PASS	AC=21;AF=0.01713;AN=1226;DS;set=Intersection
22	18300277	.	T	A	73.18	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	18300311	.	G	A	568.47	PASS	AC=1;AF=0.00082;AN=1218;DS;set=Intersection
22	18300348	.	A	G	382.70	PASS	AC=2;AF=0.00164;AN=1220;DS;set=Intersection
22	18300420	.	G	A	910.77	PASS	AC=3;AF=0.00250;AN=1198;DS;set=Intersection
22	18300470	.	G	T	401.41	PASS	AC=5;AF=0.00411;AN=1216;DS;set=Intersection
22	18300491	.	G	A	240.71	PASS	AC=1;AF=0.00082;AN=1216;DS;set=Intersection
22	18300594	.	G	A	20184.08	PASS	AC=236;AF=0.18790;AN=1256;set=Intersection
22	18300610	.	C	A	242.44	PASS	AC=1;AF=0.00079;AN=1260;set=Intersection
22	18300637	.	A	T	283.85	PASS	AC=1;AF=0.00081;AN=1232;DS;set=Intersection
22	18300641	.	G	A	320.57	PASS	AC=1;AF=0.00081;AN=1238;DS;set=Intersection
22	18300705	.	C	T	327.05	PASS	AC=2;AF=0.00172;AN=1160;DS;set=Intersection
22	18300724	.	A	G	144.64	PASS	AC=1;AF=0.00085;AN=1176;DS;set=Intersection
22	18300775	.	G	A	4894.42	PASS	AC=68;AF=0.05676;AN=1198;DS;set=Intersection
22	18300793	.	G	A	409.02	PASS	AC=1;AF=0.00079;AN=1266;DS;set=Intersection
22	18300844	.	T	C	209.90	PASS	AC=1;AF=0.00078;AN=1282;DS;set=Intersection
22	18300879	.	G	A	13847.17	PASS	AC=230;AF=0.17941;AN=1282;DS;set=Intersection
22	18300940	.	C	T	72.33	PASS	AC=2;AF=0.00169;AN=1184;set=Intersection
22	18300954	.	G	A	275.24	PASS	AC=2;AF=0.00169;AN=1186;set=Intersection
22	18301084	.	G	A	180.80	PASS	AC=1;AF=0.00085;AN=1174;set=Intersection
22	18301137	.	C	T	2623.89	PASS	AC=3;AF=0.00253;AN=1186;DS;set=Intersection
22	18301172	.	G	A	1130.03	PASS	AC=1;AF=0.00087;AN=1154;DS;set=Intersection
22	18301186	.	C	T	974.76	PASS	AC=1;AF=0.00085;AN=1176;DS;set=Intersection
22	18301190	.	G	A	25031.55	PASS	AC=26;AF=0.02207;AN=1178;DS;set=Intersection
22	18301238	.	C	T	767.95	PASS	AC=1;AF=0.00084;AN=1184;DS;set=Intersection
22	18301272	.	G	A	867.19	PASS	AC=1;AF=0.00084;AN=1184;DS;set=Intersection
22	18301314	.	G	T	1025.74	PASS	AC=1;AF=0.00083;AN=1208;DS;set=Intersection
22	18301508	.	T	C	2025.72	PASS	AC=6;AF=0.00446;AN=1344;DS;set=Intersection
22	18301569	.	C	T	11098.75	PASS	AC=16;AF=0.01110;AN=1442;DS;set=Intersection
22	18301570	.	G	A	7271.42	PASS	AC=24;AF=0.01669;AN=1438;DS;set=Intersection
22	18301600	.	G	A	19017.27	PASS	AC=58;AF=0.04050;AN=1432;DS;set=Intersection
22	18301666	.	G	A	61.27	PASS	AC=1;AF=0.00071;AN=1404;DS;set=Intersection
22	18301674	.	G	T	191.85	PASS	AC=1;AF=0.00071;AN=1402;DS;set=Intersection
22	18301685	.	C	T	164.76	PASS	AC=1;AF=0.00071;AN=1416;DS;set=Intersection
22	18301693	.	T	C	29532.76	PASS	AC=349;AF=0.24612;AN=1418;DS;set=Intersection
22	18301942	.	C	CG	498.03	PASS	AC=4;AF=0.00311;AN=1286;set=Intersection
22	18301943	.	G	A	34.98	PASS	AC=1;AF=0.00078;AN=1282;set=Intersection
22	18304176	.	G	A	127.60	PASS	AC=5;AF=0.00427;AN=1170;set=Intersection
22	18304751	.	C	T	5251.73	PASS	AC=4;AF=0.00286;AN=1400;DS;set=Intersection
22	18304753	.	T	C	47862.03	PASS	AC=126;AF=0.08987;AN=1402;DS;set=Intersection
22	18304784	.	A	C	83780.20	PASS	AC=165;AF=0.11603;AN=1422;DS;set=Intersection
22	18304804	.	T	C	2894.95	PASS	AC=4;AF=0.00282;AN=1416;DS;set=Intersection
22	18304814	.	G	C	7732.22	PASS	AC=7;AF=0.00498;AN=1406;DS;set=Intersection
22	18304821	.	G	A	48725.91	PASS	AC=128;AF=0.09065;AN=1412;DS;set=Intersection
22	18304891	.	C	T	41115.69	PASS	AC=127;AF=0.08956;AN=1418;DS;set=Intersection
22	18304914	.	C	T	793.09	PASS	AC=1;AF=0.00071;AN=1408;DS;set=Intersection
22	18304945	.	G	A	29663.32	PASS	AC=41;AF=0.02958;AN=1386;DS;set=Intersection
22	18304978	.	G	A	24578.95	PASS	AC=127;AF=0.09380;AN=1354;DS;set=Intersection
22	18305684	.	C	A	5630.31	PASS	AC=12;AF=0.00917;AN=1308;DS;set=Intersection
22	18305777	.	G	A	601.97	PASS	AC=1;AF=0.00073;AN=1370;DS;set=Intersection
22	18305797	.	C	T	8287.73	PASS	AC=38;AF=0.02836;AN=1340;DS;set=Intersection
22	18310363	.	C	T	6043.62	PASS	AC=382;AF=0.30707;AN=1244;set=Intersection
22	18310367	.	T	C	7020.47	PASS	AC=406;AF=0.34175;AN=1188;set=Intersection
22	18310424	.	G	A	98.11	PASS	AC=1;AF=0.00080;AN=1244;set=Intersection
22	18310439	.	G	A	2577.12	PASS	AC=102;AF=0.08320;AN=1226;set=Intersection
22	18314678	.	TTCC	T,TTCCTCC	1803.38	PASS	AC=66,7;AF=0.04832,0.00512;AN=1366;set=Intersection
22	18314735	.	C	T	172.92	PASS	AC=1;AF=0.00071;AN=1408;set=Intersection
22	18314810	.	T	C	35.50	PASS	AC=1;AF=0.00069;AN=1458;set=Intersection
22	18314815	.	G	A	465.14	PASS	AC=2;AF=0.00139;AN=1444;set=Intersection
22	18324564	.	C	T	1145.06	PASS	AC=181;AF=0.1909;AN=948;set=Intersection
22	18324571	.	C	T	68.41	PASS	AC=1;AF=0.00095;AN=1048;set=Intersection
22	18324626	.	G	A	894.32	PASS	AC=16;AF=0.01345;AN=1190;set=Intersection
22	18347474	.	C	T	475.32	PASS	AC=2;AF=0.00158;AN=1262;set=Intersection
22	18347642	.	G	A	1196.90	PASS	AC=2;AF=0.00162;AN=1234;DS;set=Intersection
22	18347687	.	G	C	8200.81	PASS	AC=11;AF=0.00857;AN=1284;DS;set=Intersection
22	18347695	.	C	T	867.56	PASS	AC=1;AF=0.00077;AN=1292;DS;set=Intersection
22	18347707	.	C	T	950.77	PASS	AC=1;AF=0.00076;AN=1312;DS;set=Intersection
22	18347708	.	G	A	445.28	PASS	AC=1;AF=0.00076;AN=1310;DS;set=Intersection
22	18347784	.	C	T	109.21	PASS	AC=1;AF=0.00075;AN=1336;DS;set=Intersection
22	18348650	.	C	T	385.53	PASS	AC=1;AF=0.00081;AN=1238;DS;set=Intersection
22	18348823	.	G	A	19203.59	PASS	AC=169;AF=0.12500;AN=1352;DS;set=Intersection
22	18354582	.	C	T	204.21	PASS	AC=1;AF=0.00065;AN=1532;set=Intersection
22	18354637	.	C	T	146.77	PASS	AC=2;AF=0.00128;AN=1562;set=Intersection
22	18354766	.	C	T	18894.85	PASS	AC=280;AF=0.17654;AN=1586;set=Intersection
22	18354783	.	T	G	1360.56	PASS	AC=26;AF=0.01667;AN=1560;set=Intersection
22	18354804	.	G	A	129	PASS	AC=2;AF=0.00128;AN=1562;set=Intersection
22	18355492	.	G	A	674.45	PASS	AC=2;AF=0.00168;AN=1192;DS;set=Intersection
22	18355576	.	C	A	421.51	PASS	AC=1;AF=0.00080;AN=1252;DS;set=Intersection
22	18355626	.	G	A	172.81	PASS	AC=1;AF=0.00074;AN=1352;DS;set=Intersection
22	18358301	.	C	T	1470.27	PASS	AC=27;AF=0.01985;AN=1360;set=Intersection
22	18358348	.	A	G	53.76	PASS	AC=1;AF=0.00077;AN=1298;set=Intersection
22	18362064	.	G	A	797.79	PASS	AC=2;AF=0.00155;AN=1292;set=Intersection
22	18362093	.	C	T	268.98	PASS	AC=1;AF=0.00075;AN=1336;DS;set=Intersection
22	18362122	.	T	C	501.99	PASS	AC=2;AF=0.00152;AN=1320;DS;set=Intersection
22	18362128	.	C	T	299.48	PASS	AC=1;AF=0.00077;AN=1304;DS;set=Intersection
22	18362142	.	G	A	446.27	PASS	AC=1;AF=0.00075;AN=1338;DS;set=Intersection
22	18362200	.	A	C	5076.43	PASS	AC=9;AF=0.00681;AN=1322;DS;set=Intersection
22	18363935	.	C	CA	566.01	PASS	AC=1;AF=0.00073;AN=1376;DS;set=Intersection
22	18363980	.	G	A	651.33	PASS	AC=1;AF=0.00073;AN=1368;DS;set=Intersection
22	18368614	.	C	T	12733.35	PASS	AC=12;AF=0.00870;AN=1380;DS;set=Intersection
22	18368615	.	G	A	10301.22	PASS	AC=10;AF=0.00724;AN=1382;DS;set=Intersection
22	18368793	.	C	T	1109.73	PASS	AC=1;AF=0.00071;AN=1418;DS;set=Intersection
22	18368805	.	G	A	791.21	PASS	AC=1;AF=0.00070;AN=1422;DS;set=Intersection
22	18369892	.	C	T	2569.07	PASS	AC=10;AF=0.00817;AN=1224;set=Intersection
22	18369916	.	A	G	47655.72	PASS	AC=287;AF=0.23108;AN=1242;DS;set=Intersection
22	18369986	.	T	C	551.58	PASS	AC=1;AF=0.00078;AN=1276;DS;set=Intersection
22	18370066	.	C	A	204694.92	PASS	AC=1334;AF=1.00000;AN=1334;DS;set=Intersection
22	18370182	.	G	A	4904.54	PASS	AC=10;AF=0.00769;AN=1300;DS;set=Intersection
22	18371819	.	C	T	444.46	PASS	AC=1;AF=0.00076;AN=1316;DS;set=Intersection
22	18371961	.	T	C	831.09	PASS	AC=5;AF=0.00396;AN=1264;DS;set=Intersection
22	18372020	.	A	G	168945.54	PASS	AC=649;AF=0.50232;AN=1292;DS;set=Intersection
22	18374328	.	G	A	902.90	PASS	AC=3;AF=0.00233;AN=1288;DS;set=Intersection
22	18376646	.	C	T	1164.11	PASS	AC=11;AF=0.00929;AN=1184;set=Intersection
22	18378002	.	T	C	92551.79	PASS	AC=702;AF=0.51092;AN=1374;set=Intersection
22	18378113	.	C	T	2748.84	PASS	AC=8;AF=0.00554;AN=1444;DS;set=Intersection
22	18378204	.	A	G	317.45	PASS	AC=1;AF=0.00066;AN=1520;DS;set=Intersection
22	18379160	.	T	A	22666.03	PASS	AC=611;AF=0.51868;AN=1178;set=Intersection
22	18379453	.	G	C	12344.20	PASS	AC=80;AF=0.04938;AN=1620;DS;set=Intersection
22	18379535	.	G	A	1747.70	PASS	AC=3;AF=0.00183;AN=1640;DS;set=Intersection
22	18379640	.	C	T	2929.55	PASS	AC=18;AF=0.01096;AN=1642;DS;set=Intersection
22	18379655	.	G	A	642.95	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	18379670	.	C	T	2306	PASS	AC=5;AF=0.00306;AN=1636;DS;set=Intersection
22	18379796	.	A	G	511.49	PASS	AC=1;AF=0.00063;AN=1584;DS;set=Intersection
22	18382168	.	T	A	144.30	PASS	AC=1;AF=0.00084;AN=1194;set=Intersection
22	18382342	.	G	T	349.41	PASS	AC=2;AF=0.00158;AN=1262;set=Intersection
22	18384625	.	G	A	557.27	PASS	AC=1;AF=0.00075;AN=1338;DS;set=Intersection
22	18385387	.	T	C	386.47	PASS	AC=1;AF=0.00073;AN=1362;set=Intersection
22	18387609	.	A	C	87.96	PASS	AC=2;AF=0.00124;AN=1616;DS;set=Intersection
22	18387612	.	A	C	957.76	PASS	AC=1;AF=0.00062;AN=1620;DS;set=Intersection
22	18389268	.	A	G	916.37	PASS	AC=1;AF=0.00063;AN=1576;DS;set=Intersection
22	18389316	.	T	C	1107.53	PASS	AC=1;AF=0.00065;AN=1546;DS;set=Intersection
22	18389548	.	G	C	20305.47	PASS	AC=64;AF=0.04578;AN=1398;DS;set=Intersection
22	18389616	.	G	T	5110.13	PASS	AC=6;AF=0.00413;AN=1454;DS;set=Intersection
22	18561175	.	C	T	119.11	PASS	AC=1;AF=0.00062;AN=1608;set=Intersection
22	18561272	.	C	T	264.52	PASS	AC=4;AF=0.00255;AN=1570;set=Intersection
22	18562595	.	T	G	30462.97	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	18562734	.	T	C	1050.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18562801	.	C	G	975.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18562822	.	A	C	1222.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18566181	.	T	C	976.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18566240	.	G	C	275.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18566288	.	C	G	6526.40	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	18566332	.	G	A	905.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18567938	.	C	T	974.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18570725	.	C	T	9037.88	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	18570774	.	C	T	777.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18570834	.	G	A	954.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18570842	.	G	A	1431.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18570851	.	C	T	34322.88	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	18570877	.	G	A	876.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18593682	.	G	A	71.70	PASS	AC=4;AF=0.00310;AN=1292;set=Intersection
22	18604207	.	C	A	333.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18604238	.	C	T	1002.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18604298	.	C	T	949.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18604404	.	C	T	382.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18604513	.	T	C	480.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18606946	.	C	T	7780.59	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	18606947	.	G	A	1221.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18606978	.	A	G	717.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18607020	.	C	T	12992.84	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	18607090	.	GGGA	G	21143.52	PASS	AC=86;AF=0.05231;AN=1644;DS;set=Intersection
22	18607094	.	C	T	219.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18607120	.	G	T	246.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18609080	.	A	G	1496.28	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18609087	.	T	C	4545.67	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	18609128	.	C	T	2528.73	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	18609290	.	T	C	874.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18609411	.	T	A	774.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18609481	.	G	A	1289.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18609493	.	G	A	6828.93	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	18609549	.	G	A	675.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18609561	.	C	T	13330.31	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	18609564	.	G	A	853.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18609579	.	C	T	841.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18609642	.	C	T	105878.47	PASS	AC=273;AF=0.16606;AN=1644;DS;set=Intersection
22	18609647	.	A	G	3132.92	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	18609661	.	G	A	1312.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18609693	.	C	T	842.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18609703	.	C	T	971.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18609712	.	G	A	678.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18613603	.	C	T	42587.10	PASS	AC=75;AF=0.04562;AN=1644;DS;set=Intersection
22	18613682	.	A	G	687.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18613726	.	C	T	1821.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18613770	.	A	G	873.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18613846	.	T	G	974.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18613916	.	C	T	1433.16	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18613921	.	G	A	407.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18640397	.	C	G	15025.41	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	18640527	.	G	A	2164.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18640597	.	C	A	627.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18642898	.	C	T	2971.24	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	18642909	.	C	A	1118.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18642934	.	T	G	860.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18643059	.	G	A	566.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18893846	.	G	A	576.41	PASS	AC=7;AF=0.00502;AN=1394;set=Intersection
22	18893902	.	G	C	658.57	PASS	AC=42;AF=0.02682;AN=1566;set=Intersection
22	18893995	.	C	G	1854.36	PASS	AC=43;AF=0.02661;AN=1616;DS;set=Intersection
22	18894001	.	CGCGGGCGGG	C	7102.37	PASS	AC=122;AF=0.07540;AN=1618;DS;set=Intersection
22	18894009	.	G	GC	536.86	PASS	AC=64;AF=0.03980;AN=1608;DS;set=Intersection
22	18894042	.	T	C	87.01	PASS	AC=2;AF=0.00122;AN=1634;set=Intersection
22	18894058	.	C	G	13352.61	PASS	AC=144;AF=0.08759;AN=1644;DS;set=Intersection
22	18894209	.	A	AGCGCCT	5519.03	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	18897756	.	C	A,G	3016.11	PASS	AC=19,11;AF=0.01157,0.00670;AN=1642;DS;set=Intersection
22	18897763	.	C	T	3141.24	PASS	AC=23;AF=0.01401;AN=1642;DS;set=Intersection
22	18897796	.	C	T	2138.08	PASS	AC=13;AF=0.00795;AN=1636;DS;set=Intersection
22	18897812	.	G	A	5397.39	PASS	AC=47;AF=0.02880;AN=1632;DS;set=Intersection
22	18898351	.	ATG	A	2423.65	PASS	AC=8;AF=0.00488;AN=1640;DS;set=Intersection
22	18898378	.	C	T	602.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18898387	.	C	T	623.68	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18898395	.	C	T	1677.86	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	18898415	.	G	A	217.57	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	18898421	.	T	G	2502.58	PASS	AC=7;AF=0.00427;AN=1640;DS;set=Intersection
22	18898436	.	G	A	887.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18898443	.	CAGA	C	486.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18898555	.	C	T	1583.24	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	18898572	.	C	T	12719.24	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	18898582	.	T	G	8022.61	PASS	AC=45;AF=0.02741;AN=1642;DS;set=Intersection
22	18900645	.	C	T	1073.06	PASS	AC=4;AF=0.00258;AN=1552;DS;set=Intersection
22	18900669	.	A	G	138993.15	PASS	AC=1437;AF=0.92710;AN=1550;DS;set=Intersection
22	18900683	.	G	A	328.82	PASS	AC=1;AF=0.00064;AN=1566;DS;set=Intersection
22	18900730	.	C	T	75.01	PASS	AC=1;AF=0.00065;AN=1536;DS;set=Intersection
22	18900750	.	G	A	73228.83	PASS	AC=1193;AF=0.76573;AN=1558;DS;set=Intersection
22	18900868	.	G	A,C,T	5424.25	PASS	AC=34,10,0;AF=0.02099,0.00617,0.00000;AN=1620;DS;set=Intersection
22	18901004	.	C	T	164147.45	PASS	AC=1501;AF=0.91636;AN=1638;DS;set=Intersection
22	18901006	.	G	A	50.93	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	18904489	.	G	A	12053.70	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	18905882	.	G	T	10139.90	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	18905978	.	G	A	28317.28	PASS	AC=210;AF=0.12774;AN=1644;DS;set=Intersection
22	18907124	.	G	A	119947.28	PASS	AC=832;AF=0.50608;AN=1644;DS;set=Intersection
22	18907156	.	G	C	2855.03	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	18907160	.	G	A	2874.70	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	18907192	.	A	C	10220.74	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	18907207	.	G	A	375.40	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	18907349	.	G	A	5687.10	PASS	AC=15;AF=0.00914;AN=1642;DS;set=Intersection
22	18907359	.	C	T	76.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18908809	.	G	A	1324.81	PASS	AC=10;AF=0.00676;AN=1480;DS;set=Intersection
22	18908875	.	A	G	179212.26	PASS	AC=1058;AF=0.68170;AN=1552;DS;set=Intersection
22	18908951	.	G	A	123.13	PASS	AC=5;AF=0.00338;AN=1478;DS;set=Intersection
22	18908958	.	C	G	858.78	PASS	AC=2;AF=0.00135;AN=1478;DS;set=Intersection
22	18910283	.	CA	C	11117.85	PASS	AC=688;AF=0.41849;AN=1644;DS;set=Intersection
22	18910284	.	AC	A	137397.42	PASS	AC=1244;AF=0.75669;AN=1644;DS;set=Intersection
22	18910301	.	A	G	158044.49	PASS	AC=1242;AF=0.75547;AN=1644;DS;set=Intersection
22	18910355	.	G	T	30039.52	PASS	AC=150;AF=0.09124;AN=1644;DS;set=Intersection
22	18910357	.	G	A	630.35	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18910450	.	CA	C	143125.98	PASS	AC=483;AF=0.29380;AN=1644;DS;set=Intersection
22	18910479	.	C	T	21086.79	PASS	AC=57;AF=0.03467;AN=1644;DS;set=Intersection
22	18912518	.	A	C	1266.01	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18912531	.	G	A	863.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18912581	.	C	T	2281.64	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	18912606	.	C	T	340.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18912612	.	T	G	163.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18912620	.	T	C	368.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18912625	.	G	A	556.97	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18912653	.	C	T	237.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18912662	.	C	T	1719.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	18912677	.	C	T	35205.85	PASS	AC=93;AF=0.05657;AN=1644;DS;set=Intersection
22	18912678	.	A	G	237475.49	PASS	AC=1243;AF=0.75608;AN=1644;DS;set=Intersection
22	18912761	.	C	G	1307.73	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18913156	.	G	A	1176.37	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	18913208	.	A	T	547.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18913245	.	G	A	276.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18913273	.	G	A	191.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18913277	.	C	G	22027.14	PASS	AC=108;AF=0.06569;AN=1644;DS;set=Intersection
22	18918464	.	T	G	290.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18918593	.	C	T	996.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18918666	.	T	C	719.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18918732	.	G	A	67.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	18918760	.	T	C	60307.95	PASS	AC=269;AF=0.16363;AN=1644;DS;set=Intersection
22	18923524	.	G	A	684.81	PASS	AC=54;AF=0.1406;AN=384;set=Intersection
22	18923585	.	C	G	643.08	PASS	AC=45;AF=0.1278;AN=352;set=Intersection
22	18923629	.	C	T	134.78	PASS	AC=8;AF=0.0245;AN=326;set=Intersection
22	18923713	.	G	A	258.42	PASS	AC=24;AF=0.0923;AN=260;set=Intersection
22	18923745	.	G	T	980.95	PASS	AC=148;AF=0.5692;AN=260;set=Intersection
22	19026331	.	T	C	1172.69	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	19026332	.	A	G	3199.25	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	19026337	.	A	G	330.98	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19026356	.	G	A	822.83	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19026413	.	G	A	200.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19026480	.	C	G	4622.22	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	19026500	.	CAG	C	392.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19026531	.	C	T	278.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19026556	.	C	T	1024.97	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	19026559	.	C	G	498.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19026613	.	A	G	95152.32	PASS	AC=641;AF=0.38990;AN=1644;DS;set=Intersection
22	19026664	.	G	T	439.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19028521	.	C	T	989.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19028554	.	C	G	773.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19028567	.	G	A	247.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19028643	.	C	T	17866.14	PASS	AC=66;AF=0.04015;AN=1644;DS;set=Intersection
22	19028650	.	C	T	1049.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19028665	.	C	T	369.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19028694	.	G	C	773.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19028782	.	C	T	1193.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19028816	.	T	C	708.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19028818	.	A	G	429.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19029286	.	G	C	991.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19029311	.	G	A	738.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19029353	.	G	A	1130.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19029359	.	G	A	726.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19029365	.	G	A	602.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19029498	.	G	C	373.08	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	19036154	.	G	C	1244.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19036161	.	A	G	2173.87	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19036172	.	A	G	1915.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19044623	.	A	C	98.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19044632	.	C	T	779.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19044688	.	C	A	823.83	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	19050698	.	A	C	3058.31	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19050704	.	G	C	1956.93	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19050750	.	C	T	850.26	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19050799	.	GCACAGAGA	G	1516.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19050800	.	CACAGAG	C	613.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19050827	.	G	A	506.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19050831	.	G	A	3206.90	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19052348	.	A	G	2072.44	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19052424	.	C	A	1483.14	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19052486	.	G	A	16149.40	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	19052507	.	G	A	513.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19052583	.	A	G	459.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19052591	.	G	C	207.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19052622	.	G	C	105.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19055595	.	G	A	129.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19055622	.	G	A	307.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19055647	.	G	A	670.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19055656	.	C	T	495.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19055679	.	G	A	223.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19055688	.	G	A	364.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19076835	.	A	G	7639.44	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	19076866	.	A	G	877.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19076900	.	G	A	906.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19077030	.	T	C	691.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19077038	.	G	A	4884.15	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	19077049	.	C	T	193149.18	PASS	AC=1472;AF=0.89538;AN=1644;DS;set=Intersection
22	19109597	.	C	A	365.89	PASS	AC=28;AF=0.0297;AN=944;set=Intersection
22	19109609	.	A	C	7087.28	PASS	AC=378;AF=0.34871;AN=1084;set=Intersection
22	19109689	.	G	A	61.58	PASS	AC=2;AF=0.00150;AN=1334;set=Intersection
22	19109747	.	G	GGCTGCGTGACCCC	16003.18	PASS	AC=201;AF=0.15090;AN=1332;DS;set=Intersection
22	19109752	.	G	C	30.71	PASS	AC=3;AF=0.00232;AN=1292;DS;set=Intersection
22	19109753	.	A	G	8808.38	PASS	AC=485;AF=0.38009;AN=1276;DS;set=Intersection
22	19109764	.	A	G	9273.49	PASS	AC=516;AF=0.40062;AN=1288;DS;set=Intersection
22	19118901	.	G	A	2651.36	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	19118918	.	C	T	1112.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19118973	.	G	A	817.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19118992	.	A	G	36532.65	PASS	AC=58;AF=0.03528;AN=1644;DS;set=Intersection
22	19119136	.	CTT	C	280.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19119161	.	C	T	1704.76	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19119162	.	G	A	1000.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19119252	.	C	T	767.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19119265	.	G	A	592.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19119490	.	A	C	1898.27	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19119502	.	A	G	5839.36	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	19119522	.	G	A	475.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19119545	.	C	T	60595.91	PASS	AC=249;AF=0.15146;AN=1644;DS;set=Intersection
22	19119549	.	T	C	875.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19119580	.	A	G	448.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19119589	.	G	A	2104.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19119686	.	C	T	47950.69	PASS	AC=240;AF=0.14599;AN=1644;DS;set=Intersection
22	19119721	.	C	T	383.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19119751	.	C	T	93585.96	PASS	AC=413;AF=0.25122;AN=1644;DS;set=Intersection
22	19119825	.	T	C	340.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19119833	.	C	T	777.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19119938	.	G	A	59881.12	PASS	AC=323;AF=0.19647;AN=1644;DS;set=Intersection
22	19119960	.	G	A	234.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19120005	.	G	A	55.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19121681	.	C	T	105.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19121721	.	C	T	15100.85	PASS	AC=67;AF=0.04075;AN=1644;DS;set=Intersection
22	19121722	.	G	C	422.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19121872	.	G	A	27382.78	PASS	AC=146;AF=0.08881;AN=1644;DS;set=Intersection
22	19122016	.	C	T	595.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19122035	.	A	C	223.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19122562	.	C	T	387.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19122632	.	A	T	435.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19122665	.	C	T	55850.97	PASS	AC=252;AF=0.15328;AN=1644;DS;set=Intersection
22	19122691	.	AC	A	1370.61	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19122718	.	C	T	364.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19124820	.	C	T	924.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19124822	.	T	A	1159	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19124865	.	C	T	8095.35	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	19124866	.	G	A	26679.18	PASS	AC=68;AF=0.04136;AN=1644;DS;set=Intersection
22	19124902	.	G	A	579.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19124938	.	G	A	4856.63	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	19125772	.	C	T	392.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19126623	.	C	T	718.61	PASS	AC=4;AF=0.00245;AN=1630;DS;set=Intersection
22	19126631	.	T	C	21683.46	PASS	AC=402;AF=0.24572;AN=1636;DS;set=Intersection
22	19126794	.	C	T	7339.18	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	19126814	.	C	T	131.86	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	19127101	.	T	C	773.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19127119	.	A	G	768.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19127222	.	T	A	705.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19127318	.	C	T	1151.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19127342	.	T	A	2067.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19127404	.	G	A	1365.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19127488	.	G	A	723.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19130004	.	C	T	898.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19130064	.	T	C	1706.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19130247	.	G	A	6136.21	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19130345	.	C	T	1890.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19130445	.	C	T	5225.78	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	19132011	.	G	A	1105.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19132061	.	C	T	11438.92	PASS	AC=149;AF=0.09063;AN=1644;DS;set=Intersection
22	19132062	.	G	A	425.91	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	19132135	.	A	C	1514.20	PASS	AC=10;AF=0.00613;AN=1632;set=Intersection
22	19132155	.	G	C	2669.94	PASS	AC=29;AF=0.01784;AN=1626;set=Intersection
22	19132160	.	C	A	108.97	PASS	AC=1;AF=0.00061;AN=1628;set=Intersection
22	19132196	.	G	A	726.78	PASS	AC=20;AF=0.01236;AN=1618;set=Intersection
22	19136508	.	C	G	169.96	PASS	AC=3;AF=0.00183;AN=1638;set=Intersection
22	19136565	.	C	T	286.47	PASS	AC=1;AF=0.00061;AN=1628;set=Intersection
22	19136585	.	G	A	180.21	PASS	AC=2;AF=0.00123;AN=1626;set=Intersection
22	19136621	.	G	T	914.09	PASS	AC=16;AF=0.00993;AN=1612;set=Intersection
22	19136631	.	G	A	74.54	PASS	AC=1;AF=0.00064;AN=1566;set=Intersection
22	19137141	.	G	A	1531.30	PASS	AC=35;AF=0.03217;AN=1088;set=Intersection
22	19137290	.	G	A	54.16	PASS	AC=1;AF=0.00075;AN=1340;set=Intersection
22	19163606	.	C	T	831.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19163685	.	A	G	6843.61	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	19163776	.	G	A	607.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19163941	.	G	T	527	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19163968	.	C	T	746.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19164152	.	A	G	570.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19164312	.	G	A	651.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19164401	.	T	C	663.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19164504	.	G	A	370.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19164509	.	C	A	8849.55	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	19164688	.	T	G	839.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19165216	.	G	A	7915.81	PASS	AC=97;AF=0.06025;AN=1610;DS;set=Intersection
22	19165264	.	G	C	404.65	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	19165478	.	A	G	2268.66	PASS	AC=110;AF=0.07042;AN=1562;set=Intersection
22	19165629	.	G	T	340.81	PASS	AC=20;AF=0.01623;AN=1232;set=Intersection
22	19167741	.	C	T	351.09	PASS	AC=1;AF=0.00072;AN=1394;DS;set=Intersection
22	19167798	.	G	A	1285.42	PASS	AC=5;AF=0.00369;AN=1354;DS;set=Intersection
22	19167801	.	C	T	5482.03	PASS	AC=84;AF=0.06259;AN=1342;DS;set=Intersection
22	19168288	.	C	T	1241.85	PASS	AC=3;AF=0.00213;AN=1410;DS;set=Intersection
22	19168289	.	G	A	668.99	PASS	AC=1;AF=0.00071;AN=1402;DS;set=Intersection
22	19168347	.	C	A	951.39	PASS	AC=1;AF=0.00068;AN=1466;DS;set=Intersection
22	19168355	.	A	C	2386.40	PASS	AC=4;AF=0.00272;AN=1472;DS;set=Intersection
22	19170888	.	C	T	6599.28	PASS	AC=22;AF=0.01705;AN=1290;set=Intersection
22	19170889	.	G	A	1375.15	PASS	AC=5;AF=0.00389;AN=1284;set=Intersection
22	19170956	.	C	A,G,T	6073.56	PASS	AC=0,6,22;AF=0.00000,0.00448,0.01642;AN=1340;DS;set=Intersection
22	19170999	.	AAGCAGGTCAT	A	8472.49	PASS	AC=8;AF=0.00594;AN=1346;DS;set=Intersection
22	19171053	.	C	G	340.39	PASS	AC=1;AF=0.00072;AN=1392;DS;set=Intersection
22	19171074	.	C	CT	825	PASS	AC=4;AF=0.00277;AN=1442;DS;set=Intersection
22	19171083	.	C	T	723.40	PASS	AC=1;AF=0.00070;AN=1434;DS;set=Intersection
22	19175095	.	A	C	623.74	PASS	AC=1;AF=0.00075;AN=1334;DS;set=Intersection
22	19175133	.	C	A	656.42	PASS	AC=1;AF=0.00076;AN=1314;DS;set=Intersection
22	19175265	.	G	C	479.95	PASS	AC=2;AF=0.00163;AN=1230;DS;set=Intersection
22	19175623	.	G	A	8222.91	PASS	AC=8;AF=0.00655;AN=1222;DS;set=Intersection
22	19178854	.	G	A	822.10	PASS	AC=1;AF=0.00075;AN=1340;DS;set=Intersection
22	19183727	.	T	TAGGG	2492.32	PASS	AC=21;AF=0.01677;AN=1252;set=Intersection
22	19183787	.	A	G	11401.51	PASS	AC=74;AF=0.05997;AN=1234;DS;set=Intersection
22	19183884	.	C	T	371.25	PASS	AC=1;AF=0.00072;AN=1392;DS;set=Intersection
22	19183948	.	G	A	1631.14	PASS	AC=4;AF=0.00287;AN=1396;DS;set=Intersection
22	19183995	.	G	A	2741.96	PASS	AC=11;AF=0.00809;AN=1360;DS;set=Intersection
22	19184095	.	T	C	46266.66	PASS	AC=517;AF=0.38525;AN=1342;DS;set=Intersection
22	19184126	.	C	T	172.96	PASS	AC=1;AF=0.00072;AN=1382;DS;set=Intersection
22	19184146	.	G	C	170.11	PASS	AC=1;AF=0.00073;AN=1378;set=Intersection
22	19184171	.	G	C	107.45	PASS	AC=1;AF=0.00070;AN=1428;set=Intersection
22	19187375	.	G	A	31037.40	PASS	AC=926;AF=0.57803;AN=1602;set=Intersection
22	19188876	.	G	A	2940.59	PASS	AC=13;AF=0.01045;AN=1244;DS;set=Intersection
22	19188971	.	C	T	784.32	PASS	AC=1;AF=0.00079;AN=1264;DS;set=Intersection
22	19189001	.	C	CA	70461.55	PASS	AC=1252;AF=0.99682;AN=1256;DS;set=Intersection
22	19189003	.	A	AC	335650.17	PASS	AC=1260;AF=1.00000;AN=1260;DS;set=Intersection
22	19189027	.	C	T	15517.51	PASS	AC=77;AF=0.06063;AN=1270;DS;set=Intersection
22	19189034	.	ACT	A	19451.31	PASS	AC=119;AF=0.09355;AN=1272;DS;set=Intersection
22	19195680	.	T	C	16078.51	PASS	AC=74;AF=0.05920;AN=1250;DS;set=Intersection
22	19195771	.	G	A	13078.85	PASS	AC=12;AF=0.00963;AN=1246;DS;set=Intersection
22	19196449	.	T	C	272.99	PASS	AC=1;AF=0.00073;AN=1362;set=Intersection
22	19196491	.	T	C	314.35	PASS	AC=1;AF=0.00071;AN=1416;set=Intersection
22	19196502	.	G	A	28842.22	PASS	AC=256;AF=0.17952;AN=1426;set=Intersection
22	19196615	.	C	T	1481.81	PASS	AC=9;AF=0.00600;AN=1500;set=Intersection
22	19196673	.	C	CA	1111.19	PASS	AC=70;AF=0.04875;AN=1436;set=Intersection
22	19197819	.	T	TAC	1001.49	PASS	AC=1;AF=0.00068;AN=1462;DS;set=Intersection
22	19197896	.	T	C	268427	PASS	AC=1078;AF=0.80568;AN=1338;DS;set=Intersection
22	19197948	.	C	T	717.39	PASS	AC=1;AF=0.00077;AN=1294;DS;set=Intersection
22	19197949	.	G	A	17088.72	PASS	AC=73;AF=0.05650;AN=1292;DS;set=Intersection
22	19197988	.	T	A	1236.63	PASS	AC=2;AF=0.00156;AN=1284;DS;set=Intersection
22	19198017	.	T	A	4495.85	PASS	AC=13;AF=0.01042;AN=1248;DS;set=Intersection
22	19198044	.	G	A	5563.29	PASS	AC=14;AF=0.01133;AN=1236;DS;set=Intersection
22	19203577	.	T	A	775.54	PASS	AC=4;AF=0.00281;AN=1422;set=Intersection
22	19203603	.	C	T	1720.33	PASS	AC=5;AF=0.00359;AN=1394;DS;set=Intersection
22	19203606	.	CT	C	630.01	PASS	AC=1;AF=0.00071;AN=1408;DS;set=Intersection
22	19203625	.	G	A	138.87	PASS	AC=1;AF=0.00071;AN=1406;DS;set=Intersection
22	19203629	.	G	A	1005.93	PASS	AC=4;AF=0.00286;AN=1400;DS;set=Intersection
22	19203682	.	T	C	621.58	PASS	AC=2;AF=0.00143;AN=1396;DS;set=Intersection
22	19203725	.	C	T	562.83	PASS	AC=1;AF=0.00073;AN=1364;DS;set=Intersection
22	19207346	.	C	T	2229.88	PASS	AC=5;AF=0.00396;AN=1262;DS;set=Intersection
22	19207350	.	C	T	211.35	PASS	AC=1;AF=0.00080;AN=1256;DS;set=Intersection
22	19207377	.	C	A	8040.46	PASS	AC=17;AF=0.01360;AN=1250;DS;set=Intersection
22	19207411	.	T	C	979.27	PASS	AC=1;AF=0.00079;AN=1272;DS;set=Intersection
22	19207455	.	G	A	966.32	PASS	AC=2;AF=0.00159;AN=1254;DS;set=Intersection
22	19207479	.	C	T	14820.35	PASS	AC=19;AF=0.01542;AN=1232;DS;set=Intersection
22	19207491	.	T	C	1933.60	PASS	AC=3;AF=0.00245;AN=1226;DS;set=Intersection
22	19207533	.	CAT	C	1077.85	PASS	AC=1;AF=0.00081;AN=1230;DS;set=Intersection
22	19209073	.	T	C	330.16	PASS	AC=1;AF=0.00069;AN=1452;set=Intersection
22	19209167	.	A	G	2092.88	PASS	AC=78;AF=0.05830;AN=1338;set=Intersection
22	19209458	.	A	C	6959.68	PASS	AC=15;AF=0.01052;AN=1426;DS;set=Intersection
22	19209603	.	C	T	4606.27	PASS	AC=12;AF=0.00792;AN=1516;DS;set=Intersection
22	19210178	.	C	T	588.68	PASS	AC=8;AF=0.00618;AN=1294;set=Intersection
22	19211535	.	T	C	365.27	PASS	AC=1;AF=0.00066;AN=1522;DS;set=Intersection
22	19211616	.	C	A	178.19	PASS	AC=1;AF=0.00066;AN=1516;DS;set=Intersection
22	19212947	.	T	C	1654.60	PASS	AC=104;AF=0.08163;AN=1274;set=Intersection
22	19212959	.	G	C	31.38	PASS	AC=2;AF=0.00155;AN=1288;set=Intersection
22	19212968	.	T	C	544.04	PASS	AC=7;AF=0.00545;AN=1284;set=Intersection
22	19212999	.	A	T	40.34	PASS	AC=1;AF=0.00075;AN=1334;set=Intersection
22	19213033	.	C	T	10092.56	PASS	AC=56;AF=0.04076;AN=1374;set=Intersection
22	19213145	.	ATTGAC	A	341.85	PASS	AC=44;AF=0.03577;AN=1230;set=Intersection
22	19213744	.	C	T	939.43	PASS	AC=2;AF=0.00156;AN=1282;DS;set=Intersection
22	19213820	.	C	A	544.64	PASS	AC=1;AF=0.00077;AN=1300;DS;set=Intersection
22	19217422	.	C	T	60.50	PASS	AC=1;AF=0.00072;AN=1388;set=Intersection
22	19219980	.	C	T	17834.13	PASS	AC=75;AF=0.05943;AN=1262;DS;set=Intersection
22	19219991	.	A	G	4737.88	PASS	AC=5;AF=0.00396;AN=1262;DS;set=Intersection
22	19219992	.	C	T	4428.30	PASS	AC=4;AF=0.00316;AN=1264;DS;set=Intersection
22	19220065	.	C	T	2766.59	PASS	AC=5;AF=0.00414;AN=1208;DS;set=Intersection
22	19220648	.	G	T	154074.22	PASS	AC=413;AF=0.32115;AN=1286;DS;set=Intersection
22	19220667	.	C	T	1101.32	PASS	AC=1;AF=0.00078;AN=1280;DS;set=Intersection
22	19220768	.	C	T	13076.42	PASS	AC=10;AF=0.00735;AN=1360;DS;set=Intersection
22	19220775	.	A	C	1169.47	PASS	AC=1;AF=0.00074;AN=1358;DS;set=Intersection
22	19220908	.	C	G	1007.95	PASS	AC=2;AF=0.00136;AN=1466;DS;set=Intersection
22	19220914	.	G	A	1051.45	PASS	AC=1;AF=0.00068;AN=1462;DS;set=Intersection
22	19220971	.	G	T	7108.63	PASS	AC=10;AF=0.00724;AN=1382;DS;set=Intersection
22	19221123	.	G	A	546.86	PASS	AC=1;AF=0.00079;AN=1264;DS;set=Intersection
22	19221135	.	C	T	1044.56	PASS	AC=2;AF=0.00159;AN=1258;DS;set=Intersection
22	19221179	.	G	A	112.91	PASS	AC=1;AF=0.00083;AN=1208;DS;set=Intersection
22	19222138	.	C	T	959.15	PASS	AC=1;AF=0.00081;AN=1234;DS;set=Intersection
22	19222143	.	G	A	4423.50	PASS	AC=5;AF=0.00405;AN=1236;DS;set=Intersection
22	19222154	.	G	A	1041.86	PASS	AC=1;AF=0.00080;AN=1250;DS;set=Intersection
22	19222234	.	A	G	803.44	PASS	AC=2;AF=0.00156;AN=1286;DS;set=Intersection
22	19222239	.	CACA	C	406.30	PASS	AC=1;AF=0.00078;AN=1284;DS;set=Intersection
22	19222259	.	C	T	2691.17	PASS	AC=6;AF=0.00472;AN=1272;DS;set=Intersection
22	19222260	.	G	A	1010.67	PASS	AC=1;AF=0.00079;AN=1268;DS;set=Intersection
22	19223229	.	T	C	1825.73	PASS	AC=2;AF=0.00157;AN=1274;DS;set=Intersection
22	19223261	.	G	A	812.79	PASS	AC=1;AF=0.00078;AN=1286;DS;set=Intersection
22	19223332	.	C	G	2271.71	PASS	AC=2;AF=0.00155;AN=1292;DS;set=Intersection
22	19223352	.	T	C	26682.04	PASS	AC=82;AF=0.06406;AN=1280;DS;set=Intersection
22	19226767	.	T	C	21607.17	PASS	AC=71;AF=0.05346;AN=1328;DS;set=Intersection
22	19226874	.	T	C	1037.52	PASS	AC=1;AF=0.00079;AN=1262;DS;set=Intersection
22	19226958	.	G	T	1780	PASS	AC=2;AF=0.00164;AN=1222;DS;set=Intersection
22	19230365	.	T	C	8047.74	PASS	AC=23;AF=0.01588;AN=1448;DS;set=Intersection
22	19241488	.	C	T	574.50	PASS	AC=2;AF=0.00165;AN=1210;set=Intersection
22	19241585	.	A	C	647.17	PASS	AC=1;AF=0.00080;AN=1246;DS;set=Intersection
22	19241631	.	C	T	404.03	PASS	AC=1;AF=0.00081;AN=1236;DS;set=Intersection
22	19241688	.	C	T	1238.99	PASS	AC=2;AF=0.00166;AN=1206;DS;set=Intersection
22	19263157	.	A	G	328.33	PASS	AC=1;AF=0.00086;AN=1166;set=Intersection
22	19263172	.	G	C	367.84	PASS	AC=1;AF=0.00086;AN=1160;set=Intersection
22	19263214	.	G	A	2271.94	PASS	AC=16;AF=0.01413;AN=1132;set=Intersection
22	19263266	.	C	A	531.79	PASS	AC=3;AF=0.00255;AN=1176;set=Intersection
22	19263345	.	GT	G	164.74	PASS	AC=1;AF=0.00085;AN=1174;set=Intersection
22	19263351	.	G	T	108.66	PASS	AC=1;AF=0.00085;AN=1180;set=Intersection
22	19263352	.	A	G	216.61	PASS	AC=1;AF=0.00085;AN=1176;set=Intersection
22	19279194	.	G	T	275.96	PASS	AC=66;AF=0.1813;AN=364;set=Intersection
22	19340834	.	G	C	85.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19340907	.	G	A	254.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19340928	.	G	A	1723.44	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	19341006	.	A	G	185.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19341007	.	G	C	408.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19341085	.	TAC	T	78.36	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19341548	.	C	T	1040.28	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19343718	.	C	A	625.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19343769	.	T	C	4414.14	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	19344404	.	GC	G	2722.62	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	19344492	.	G	A	915.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19344524	.	G	A	888.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19346834	.	C	T	310.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19346835	.	G	A	103293.54	PASS	AC=198;AF=0.12044;AN=1644;DS;set=Intersection
22	19346897	.	C	T	968.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19347033	.	G	A	711.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19348891	.	C	A	276.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19348896	.	C	T	9696.35	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	19348905	.	T	G	809.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19348906	.	A	G	18795.05	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	19349202	.	G	A	843.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19349298	.	C	A	886.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19349416	.	C	T	1005.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19349470	.	A	G	778.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19363188	.	C	T	1771.81	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19363213	.	C	G	980.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19365428	.	C	A	523.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19365466	.	G	A	1900.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19365526	.	G	C	2873.54	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19365538	.	C	T	8086.31	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	19365597	.	CAAGT	C	1206.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19371166	.	G	A	9074.27	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	19373016	.	C	T	1800.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19373080	.	G	A	659.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19373100	.	A	T	822.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19373191	.	G	A	520.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19373296	.	A	C	2286.62	PASS	AC=15;AF=0.00914;AN=1642;DS;set=Intersection
22	19375217	.	A	G	459.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19375282	.	G	C	2142.49	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19375978	.	C	T	431	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19376062	.	G	A	885.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19376123	.	C	T	1183.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19376124	.	C	T	15293.78	PASS	AC=64;AF=0.03893;AN=1644;DS;set=Intersection
22	19379574	.	C	T	1314.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19379617	.	G	C	2717.27	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	19381922	.	C	T	256.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19384355	.	C	T	2095.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19384377	.	C	T	2532.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19384439	.	G	A	2801.72	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19385634	.	G	A	872.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19385645	.	T	C	597.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19385660	.	T	C	614.97	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19394675	.	A	G	286.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19394689	.	A	G	15410.38	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	19394805	.	G	GA	54.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19394830	.	C	G	992.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19398310	.	AAAG	A	7105.03	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	19398311	.	AAG	A	24195.44	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	19398312	.	AG	A	13505.37	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	19418979	.	G	A	601.90	PASS	AC=3;AF=0.00185;AN=1626;DS;set=Intersection
22	19418991	.	G	A	312.53	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	19419005	.	G	GGCC	1037.46	PASS	AC=62;AF=0.03924;AN=1580;DS;set=Intersection
22	19420029	.	G	T	135.23	PASS	AC=1;AF=0.00075;AN=1326;set=Intersection
22	19420030	.	C	T	127.76	PASS	AC=2;AF=0.00152;AN=1320;set=Intersection
22	19420035	.	C	T	79.66	PASS	AC=1;AF=0.00074;AN=1354;set=Intersection
22	19420098	.	A	C	315.93	PASS	AC=1;AF=0.00069;AN=1458;set=Intersection
22	19420109	.	T	C	2076.01	PASS	AC=106;AF=0.07240;AN=1464;set=Intersection
22	19420165	.	C	A	100.68	PASS	AC=2;AF=0.00143;AN=1396;set=Intersection
22	19420180	.	G	C	73.71	PASS	AC=1;AF=0.00076;AN=1308;set=Intersection
22	19420762	.	T	C	15690	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	19420778	.	T	A	17224.66	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	19423248	.	G	A	1123.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19423249	.	C	T	897.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19423250	.	G	A	175411.18	PASS	AC=323;AF=0.19647;AN=1644;DS;set=Intersection
22	19423356	.	G	T	12328.61	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	19438220	.	T	A	904.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19438227	.	CCTT	C	1143.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19438305	.	C	G	818.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19442261	.	A	G	402.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19443158	.	C	T	933.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19443171	.	C	T	20805.77	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	19443268	.	T	C	893.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19443311	.	G	C	142058.79	PASS	AC=117;AF=0.07117;AN=1644;DS;set=Intersection
22	19444181	.	G	A	25097.13	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	19444195	.	G	A	1009.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19445561	.	C	T	896.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19445576	.	C	G	2270.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19452712	.	G	C	985.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19455376	.	C	T	203997.89	PASS	AC=774;AF=0.47080;AN=1644;DS;set=Intersection
22	19455430	.	G	C	13436.46	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	19455497	.	G	A	6265.49	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	19459176	.	G	C	432.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19462668	.	A	C	1681.95	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	19463060	.	G	A	1914.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19463108	.	G	A	1880.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19467462	.	G	T	13419.13	PASS	AC=91;AF=0.05535;AN=1644;DS;set=Intersection
22	19467482	.	C	A	1312.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19467489	.	G	A	1610.85	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19467510	.	C	G	200.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19467652	.	T	C	127282.61	PASS	AC=743;AF=0.45195;AN=1644;DS;set=Intersection
22	19467717	.	C	T	28574.96	PASS	AC=126;AF=0.07664;AN=1644;DS;set=Intersection
22	19468514	.	T	C	9430.99	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	19470201	.	C	T	5497.01	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	19470249	.	G	A	5233.15	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	19470305	.	C	T	57289.53	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	19471407	.	A	G	1203.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19471506	.	A	G	2715.35	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19481883	.	C	T	301.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19483472	.	C	T	923.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19483565	.	A	T	944.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19483593	.	C	T	671.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19486597	.	C	T	895.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19486598	.	G	A	4646.94	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	19486600	.	C	T	198204.18	PASS	AC=608;AF=0.36983;AN=1644;DS;set=Intersection
22	19486707	.	G	T	5327.42	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19492858	.	C	T	12256.88	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	19492894	.	C	T	643.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19492948	.	C	T	1184.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19492987	.	G	A	2567.12	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19494978	.	C	T	646.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19496080	.	C	G	897.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19496119	.	C	T	800.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19496123	.	G	A	775.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19496238	.	C	T	68.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19502238	.	G	A	202.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19502300	.	C	G	612.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19502445	.	C	T	12914.44	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	19502488	.	G	A	1395.81	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19502547	.	C	T	894.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19502588	.	G	C	169.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19504134	.	A	G	1691.16	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19504186	.	G	A	1646.57	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19504192	.	G	C	15860.03	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	19504204	.	CG	C	852.33	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19504298	.	T	C	455.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19504318	.	G	A	109769.67	PASS	AC=536;AF=0.32603;AN=1644;DS;set=Intersection
22	19504319	.	A	T	300.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19504328	.	G	T	289.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19504355	.	G	T	832.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19504398	.	A	G	368.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19506344	.	C	G	389.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19506456	.	G	T	104742.71	PASS	AC=497;AF=0.30231;AN=1644;DS;set=Intersection
22	19506476	.	C	T	66468.71	PASS	AC=247;AF=0.15024;AN=1644;DS;set=Intersection
22	19511103	.	C	T	272.15	PASS	AC=2;AF=0.00135;AN=1480;DS;set=Intersection
22	19511229	.	C	T	49.59	PASS	AC=1;AF=0.00064;AN=1572;DS;set=Intersection
22	19511476	.	G	A	5404.61	PASS	AC=43;AF=0.02661;AN=1616;set=Intersection
22	19511479	.	C	T	122.72	PASS	AC=1;AF=0.00062;AN=1614;set=Intersection
22	19511515	.	C	T	55.58	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	19511520	.	C	T	126.48	PASS	AC=3;AF=0.00184;AN=1634;set=Intersection
22	19511539	.	C	T	89.37	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	19511780	.	G	C	189.10	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	19702274	.	C	T	1651.18	PASS	AC=76;AF=0.05315;AN=1430;set=Intersection
22	19707076	.	G	A	436.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19707096	.	G	A	506.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19707112	.	A	G	1848.12	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	19707280	.	C	T	647.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19707435	.	C	T	246.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19707596	.	C	CT	3708.18	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	19707622	.	G	A	12554.99	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	19707757	.	G	A	910.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19707797	.	C	T	136.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19707803	.	C	CA	1266.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19707810	.	C	T	717.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19708074	.	T	C	679.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19708247	.	G	A	959.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19708374	.	G	A	676.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19708414	.	G	T	5348.70	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	19709460	.	C	G	222.58	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	19709741	.	T	TC	161.24	PASS	AC=4;AF=0.00251;AN=1594;set=Intersection
22	19709748	.	C	T	39.01	PASS	AC=1;AF=0.00063;AN=1588;set=Intersection
22	19709868	.	TGGGGCGGCG	T	559.51	PASS	AC=1;AF=0.00062;AN=1616;set=Intersection
22	19709909	.	CT	C	223.53	PASS	AC=3;AF=0.00186;AN=1616;set=Intersection
22	19711493	.	G	T	60.80	PASS	AC=1;AF=0.0016;AN=612;set=Intersection
22	19747128	.	C	T	64.64	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	19747164	.	G	A	564.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19748690	.	G	A	1143.33	PASS	AC=15;AF=0.00938;AN=1600;set=Intersection
22	19748695	.	TGAA	T	293.96	PASS	AC=2;AF=0.00124;AN=1612;set=Intersection
22	19748714	.	G	A	52.05	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	19750773	.	T	C	120939.33	PASS	AC=422;AF=0.25669;AN=1644;DS;set=Intersection
22	19750797	.	C	T	1825.90	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19750845	.	G	A	367.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19750906	.	C	A	766.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19751654	.	C	T	1773.59	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19751665	.	C	T	437.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19751670	.	C	T	215.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19751696	.	C	T	906.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19751829	.	C	T	154965.19	PASS	AC=442;AF=0.26886;AN=1644;DS;set=Intersection
22	19751892	.	C	T	296.35	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	19752522	.	C	T	1141.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19752609	.	C	T	851.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19752610	.	G	T	904.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19753233	.	C	T	74.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19753374	.	A	C	703.16	PASS	AC=5;AF=0.00307;AN=1630;DS;set=Intersection
22	19753379	.	C	T	11208.32	PASS	AC=122;AF=0.07503;AN=1626;DS;set=Intersection
22	19753401	.	C	A	70.30	PASS	AC=1;AF=0.00063;AN=1600;DS;set=Intersection
22	19753443	.	C	T	159.47	PASS	AC=2;AF=0.00154;AN=1296;set=Intersection
22	19753444	.	G	A	1133.44	PASS	AC=20;AF=0.01553;AN=1288;set=Intersection
22	19754091	.	A	C	5176.41	PASS	AC=274;AF=0.25323;AN=1082;set=Intersection
22	19754117	.	C	T	59.92	PASS	AC=2;AF=0.00162;AN=1234;set=Intersection
22	19754211	.	C	T	276.63	PASS	AC=1;AF=0.00082;AN=1218;set=Intersection
22	19766701	.	A	G	329.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19766730	.	G	A	420.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19766782	.	C	T	67996.38	PASS	AC=264;AF=0.16058;AN=1644;DS;set=Intersection
22	19766797	.	C	G	2842.06	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19766809	.	T	C	583.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19766828	.	A	G	674.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19766954	.	C	G	11737.16	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	19770436	.	G	A	884.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19770566	.	C	T	4783.10	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19770584	.	T	C	403.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19776245	.	TAG	T	835.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19776348	.	C	A	190.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19776365	.	G	A	747.37	PASS	AC=16;AF=0.00974;AN=1642;DS;set=Intersection
22	19776382	.	G	A	4206.15	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	19776389	.	C	T	177.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19776406	.	G	A	869.22	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19776444	.	C	T	357.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19776500	.	A	AG	112.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19789541	.	A	C	40496.10	PASS	AC=373;AF=0.22689;AN=1644;DS;set=Intersection
22	19789627	.	G	A	218.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19789649	.	G	A	93.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19789723	.	C	T	539.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19794176	.	C	T	32.54	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	19799859	.	G	C	6481.48	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	19799875	.	C	T	549.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19799963	.	G	A	564.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19808167	.	A	G	1103.01	PASS	AC=7;AF=0.00426;AN=1642;DS;set=Intersection
22	19808177	.	G	A	238.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19808205	.	C	T	1798.23	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19808769	.	C	T	42191.78	PASS	AC=217;AF=0.13200;AN=1644;DS;set=Intersection
22	19808791	.	C	T	20970.60	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	19808792	.	G	A	1021.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19808805	.	G	A	1765.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19808813	.	C	T	2136.75	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19808822	.	G	A	895.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19808859	.	G	C	325.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19808874	.	G	A	8982.87	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	19838729	.	C	T	832.60	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	19838873	.	C	T	16711.61	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	19838891	.	T	A	16887.53	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	19838915	.	G	T	766.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839019	.	C	T	7260.94	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	19839113	.	T	C	651.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839241	.	G	C	445.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839274	.	A	G	1559.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19839281	.	G	A	590.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19839286	.	C	T	310.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839293	.	C	G	876.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839351	.	C	T	712	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839352	.	G	A	599.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839355	.	T	C	391.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839365	.	G	A	951.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839378	.	ATGT	A	1118.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19839418	.	C	A	16999.48	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	19839438	.	C	T	12730.78	PASS	AC=57;AF=0.03467;AN=1644;DS;set=Intersection
22	19839453	.	G	A	1122.92	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19839467	.	G	A	625.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839516	.	C	T	14010.01	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	19839517	.	G	A	1648.98	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19839523	.	T	C	483.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839566	.	G	A	465.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839606	.	G	A	1152.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19839727	.	T	A	5778.31	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	19839757	.	CCTG	C	1033.82	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19839761	.	C	A	464.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19864649	.	C	T	301.40	PASS	AC=1;AF=0.00084;AN=1196;DS;set=Intersection
22	19864669	.	G	A	307.01	PASS	AC=1;AF=0.00082;AN=1224;DS;set=Intersection
22	19864680	.	C	T	364.27	PASS	AC=1;AF=0.00081;AN=1236;DS;set=Intersection
22	19864729	.	G	A	726.69	PASS	AC=2;AF=0.00159;AN=1260;DS;set=Intersection
22	19865595	.	G	A	2456.63	PASS	AC=10;AF=0.00699;AN=1430;set=Intersection
22	19865606	.	GACTT	G	297.76	PASS	AC=1;AF=0.00070;AN=1434;set=Intersection
22	19865651	.	G	C	516.76	PASS	AC=1;AF=0.00069;AN=1442;DS;set=Intersection
22	19865759	.	G	A	541.56	PASS	AC=1;AF=0.00071;AN=1412;DS;set=Intersection
22	19865869	.	T	C	112612.10	PASS	AC=106;AF=0.07423;AN=1428;DS;set=Intersection
22	19867658	.	G	A	109.42	PASS	AC=2;AF=0.00125;AN=1604;DS;set=Intersection
22	19867744	.	G	A	4848.29	PASS	AC=11;AF=0.00681;AN=1616;DS;set=Intersection
22	19867771	.	C	T	82550.06	PASS	AC=353;AF=0.21763;AN=1622;DS;set=Intersection
22	19867810	.	G	A	369.72	PASS	AC=1;AF=0.00061;AN=1632;DS;set=Intersection
22	19867818	.	G	C	152.67	PASS	AC=1;AF=0.00061;AN=1630;DS;set=Intersection
22	19868096	.	G	A	1747	PASS	AC=8;AF=0.00493;AN=1624;DS;set=Intersection
22	19868177	.	C	T	1361.41	PASS	AC=7;AF=0.00476;AN=1470;DS;set=Intersection
22	19868190	.	C	G	30.59	PASS	AC=2;AF=0.00138;AN=1446;DS;set=Intersection
22	19868215	.	G	A	825.99	PASS	AC=1;AF=0.00071;AN=1410;DS;set=Intersection
22	19868218	.	A	G	119900.89	PASS	AC=1011;AF=0.71702;AN=1410;DS;set=Intersection
22	19868228	.	G	A	6285.66	PASS	AC=23;AF=0.01657;AN=1388;DS;set=Intersection
22	19868236	.	C	T	229.51	PASS	AC=1;AF=0.00071;AN=1414;DS;set=Intersection
22	19868255	.	AG	A	21705.08	PASS	AC=201;AF=0.14135;AN=1422;DS;set=Intersection
22	19868262	.	C	G	1449.55	PASS	AC=5;AF=0.00360;AN=1390;DS;set=Intersection
22	19870831	.	C	T	52455.92	PASS	AC=330;AF=0.24408;AN=1352;DS;set=Intersection
22	19870857	.	G	A	844.84	PASS	AC=1;AF=0.00074;AN=1358;DS;set=Intersection
22	19870897	.	C	T	609.87	PASS	AC=1;AF=0.00071;AN=1406;DS;set=Intersection
22	19870918	.	T	A	963.61	PASS	AC=1;AF=0.00074;AN=1356;DS;set=Intersection
22	19871018	.	C	T	833.73	PASS	AC=1;AF=0.00077;AN=1294;DS;set=Intersection
22	19882888	.	G	A	118272.29	PASS	AC=122;AF=0.09457;AN=1290;DS;set=Intersection
22	19882946	.	G	A	954.35	PASS	AC=2;AF=0.00156;AN=1278;DS;set=Intersection
22	19882976	.	G	T	6155.81	PASS	AC=6;AF=0.00461;AN=1302;DS;set=Intersection
22	19882984	.	T	G	152266.06	PASS	AC=282;AF=0.21860;AN=1290;DS;set=Intersection
22	19883032	.	G	A	1160.41	PASS	AC=1;AF=0.00076;AN=1308;DS;set=Intersection
22	19883042	.	A	G	674.77	PASS	AC=1;AF=0.00076;AN=1320;DS;set=Intersection
22	19883063	.	G	A	1545.21	PASS	AC=2;AF=0.00152;AN=1314;DS;set=Intersection
22	19883123	.	C	T	773.39	PASS	AC=1;AF=0.00077;AN=1304;DS;set=Intersection
22	19885548	.	G	T	7590.33	PASS	AC=253;AF=0.21332;AN=1186;set=Intersection
22	19885573	.	C	G	50.44	PASS	AC=3;AF=0.00248;AN=1208;set=Intersection
22	19885574	.	G	A	42.89	PASS	AC=1;AF=0.00083;AN=1202;set=Intersection
22	19886557	.	G	A	289.20	PASS	AC=1;AF=0.00081;AN=1230;DS;set=Intersection
22	19898877	.	C	A	736.23	PASS	AC=1;AF=0.00080;AN=1250;DS;set=Intersection
22	19898886	.	C	T	27383.16	PASS	AC=196;AF=0.15680;AN=1250;DS;set=Intersection
22	19898887	.	G	A	12795.94	PASS	AC=39;AF=0.03115;AN=1252;DS;set=Intersection
22	19898912	.	G	T	322.49	PASS	AC=1;AF=0.00081;AN=1238;DS;set=Intersection
22	19898997	.	A	G	8096.42	PASS	AC=17;AF=0.01387;AN=1226;DS;set=Intersection
22	19902718	.	AT	A	2733.30	PASS	AC=11;AF=0.00825;AN=1334;set=Intersection
22	19902805	.	G	A	1732.66	PASS	AC=9;AF=0.00644;AN=1398;DS;set=Intersection
22	19902833	.	A	C	1148.53	PASS	AC=9;AF=0.00653;AN=1378;DS;set=Intersection
22	19902840	.	T	C	115.97	PASS	AC=3;AF=0.00218;AN=1378;DS;set=Intersection
22	19903267	.	G	A	883.13	PASS	AC=1;AF=0.00076;AN=1318;DS;set=Intersection
22	19903290	.	C	G	23673.85	PASS	AC=33;AF=0.02519;AN=1310;DS;set=Intersection
22	19903311	.	C	T	1462.94	PASS	AC=2;AF=0.00152;AN=1312;DS;set=Intersection
22	19903354	.	G	A	278.16	PASS	AC=2;AF=0.00157;AN=1276;DS;set=Intersection
22	19905710	.	G	C	649.83	PASS	AC=1;AF=0.00081;AN=1228;DS;set=Intersection
22	19905748	.	G	A	849.68	PASS	AC=1;AF=0.00079;AN=1266;DS;set=Intersection
22	19905759	.	A	C	6252.79	PASS	AC=8;AF=0.00632;AN=1266;DS;set=Intersection
22	19905781	.	G	C	863.10	PASS	AC=2;AF=0.00156;AN=1278;DS;set=Intersection
22	19906366	.	C	T	536.08	PASS	AC=1;AF=0.00065;AN=1536;DS;set=Intersection
22	19906367	.	G	T	931.36	PASS	AC=1;AF=0.00065;AN=1528;DS;set=Intersection
22	19906370	.	G	A	10421.86	PASS	AC=28;AF=0.01869;AN=1498;DS;set=Intersection
22	19906391	.	C	T	330.34	PASS	AC=1;AF=0.00071;AN=1418;DS;set=Intersection
22	19906454	.	T	C	188.40	PASS	AC=1;AF=0.00071;AN=1408;DS;set=Intersection
22	19906498	.	C	T	322.74	PASS	AC=1;AF=0.00074;AN=1360;DS;set=Intersection
22	19906511	.	G	A	51401.15	PASS	AC=207;AF=0.15517;AN=1334;DS;set=Intersection
22	19907042	.	C	T	73.75	PASS	AC=2;AF=0.00153;AN=1304;set=Intersection
22	19907085	.	G	A	181.06	PASS	AC=4;AF=0.00297;AN=1346;set=Intersection
22	19907099	.	C	A	11483.17	PASS	AC=673;AF=0.49558;AN=1358;set=Intersection
22	19907118	.	G	A	14895.52	PASS	AC=852;AF=0.61561;AN=1384;set=Intersection
22	19918615	.	T	A	774.18	PASS	AC=2;AF=0.00146;AN=1370;DS;set=Intersection
22	19918633	.	G	C	1859.84	PASS	AC=3;AF=0.00225;AN=1332;DS;set=Intersection
22	19918647	.	C	T	315.42	PASS	AC=1;AF=0.00077;AN=1306;DS;set=Intersection
22	19950040	.	C	T	48.04	PASS	AC=1;AF=0.00062;AN=1606;DS;set=Intersection
22	19950137	.	G	A	188.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19950166	.	C	T	667.50	PASS	AC=4;AF=0.00244;AN=1636;DS;set=Intersection
22	19950235	.	C	T	121553.95	PASS	AC=639;AF=0.38869;AN=1644;DS;set=Intersection
22	19950257	.	G	A	403.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19950263	.	G	T	9933.80	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	19950268	.	G	A	39030.67	PASS	AC=70;AF=0.04258;AN=1644;DS;set=Intersection
22	19950299	.	G	A	567.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19950310	.	G	A	1269.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19950329	.	G	A	956.02	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19951103	.	G	A	2459.72	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19951116	.	A	G	827.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19951207	.	C	G	40520.50	PASS	AC=529;AF=0.32178;AN=1644;DS;set=Intersection
22	19951220	.	A	G	283.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19951237	.	C	T	12779.89	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	19951247	.	C	A	308.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19951270	.	C	T	216.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19951271	.	G	A	64327.96	PASS	AC=640;AF=0.38929;AN=1644;DS;set=Intersection
22	19951710	.	C	T	712.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19951717	.	G	A	919.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19951804	.	G	A	31733.71	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	19951816	.	C	T	6387.52	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	19951869	.	CCATT	C	1094.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19956014	.	G	C	7231.12	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	19956208	.	C	T	337.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19956214	.	G	A	935.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19956221	.	G	A	932.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19956262	.	G	C	49.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19956269	.	C	CG	5880.57	PASS	AC=490;AF=0.29805;AN=1644;DS;set=Intersection
22	19958710	.	T	A	4702.50	PASS	AC=16;AF=0.01036;AN=1544;DS;set=Intersection
22	19958719	.	A	G	768.29	PASS	AC=1;AF=0.00064;AN=1564;DS;set=Intersection
22	19958789	.	C	T	1161.10	PASS	AC=3;AF=0.00188;AN=1594;DS;set=Intersection
22	19958793	.	G	C	497.47	PASS	AC=1;AF=0.00063;AN=1578;DS;set=Intersection
22	19958811	.	C	T	6531.63	PASS	AC=18;AF=0.01134;AN=1588;DS;set=Intersection
22	19958814	.	G	A	923.33	PASS	AC=1;AF=0.00063;AN=1578;DS;set=Intersection
22	19958829	.	G	A	8858.12	PASS	AC=113;AF=0.07125;AN=1586;DS;set=Intersection
22	19958870	.	G	A	734.94	PASS	AC=1;AF=0.00063;AN=1580;DS;set=Intersection
22	19958885	.	G	A	563.35	PASS	AC=2;AF=0.00125;AN=1600;DS;set=Intersection
22	19958898	.	GGTTA	G	2941.35	PASS	AC=18;AF=0.01125;AN=1600;DS;set=Intersection
22	19959366	.	G	A	192069.96	PASS	AC=1284;AF=0.78102;AN=1644;DS;set=Intersection
22	19959376	.	C	T	133.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19959388	.	C	T	743.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19959455	.	C	T	997.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19959456	.	G	A	6079.04	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	19959457	.	T	C	843.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19959464	.	C	T	5940.98	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	19959473	.	C	T	211960.09	PASS	AC=1073;AF=0.65268;AN=1644;DS;set=Intersection
22	19959503	.	G	A	597.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19959539	.	G	A	707.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19959843	.	C	T	849.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19959918	.	G	A	959.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19959919	.	C	A	953.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19959955	.	A	G	163614.25	PASS	AC=1256;AF=0.76399;AN=1644;DS;set=Intersection
22	19960220	.	G	A	372.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19960238	.	C	A,G,T	8332.52	PASS	AC=0,1,15;AF=0.00000,0.00061,0.00912;AN=1644;DS;set=Intersection
22	19960326	.	G	A	2958.69	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19960370	.	C	T	530.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19960374	.	G	C	2672.88	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19960375	.	G	A	505.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19960394	.	G	A	123844.54	PASS	AC=198;AF=0.12044;AN=1644;DS;set=Intersection
22	19960412	.	G	T	1155.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19960421	.	A	G	9211.75	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	19960429	.	A	C	588.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19960434	.	C	A	550.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19960485	.	G	C	777.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19960499	.	C	T	7751.79	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	19960512	.	A	G	901	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19960533	.	G	A	571.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19960536	.	G	A	656.60	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19960542	.	G	C	333.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19960548	.	C	G	390.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19960583	.	G	T	197.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19960606	.	G	C	48352.64	PASS	AC=763;AF=0.46411;AN=1644;DS;set=Intersection
22	19960666	.	G	A	1874.77	PASS	AC=21;AF=0.01279;AN=1642;set=Intersection
22	19960722	.	G	A	1052.76	PASS	AC=10;AF=0.00609;AN=1642;set=Intersection
22	19961127	.	A	G	257.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19961335	.	G	A	488.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19961668	.	G	A	388.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19961730	.	G	A	790.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19961740	.	G	A	1064.59	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	19963258	.	G	C	439.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19963271	.	T	G	5091.10	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	19964193	.	C	T	943.87	PASS	AC=1;AF=0.00063;AN=1592;DS;set=Intersection
22	19964291	.	C	T	1365.46	PASS	AC=12;AF=0.00754;AN=1592;DS;set=Intersection
22	19964895	.	G	C	808.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19964920	.	C	A	536.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19964925	.	C	T	1834.67	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19964927	.	G	A	669.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19965047	.	G	A	1292.02	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19965059	.	G	A	685.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19965069	.	T	C	359.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19965084	.	A	G	632.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19965107	.	C	T	135.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19965125	.	A	G	188.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19965437	.	G	A	208.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19965469	.	G	A	363.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19965501	.	G	A	354.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19965563	.	C	T	529.44	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	19966549	.	T	C	881.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19966562	.	C	T	5560.31	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	19966579	.	T	G	1734.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19966610	.	G	A	3219.26	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	19966614	.	C	T	766.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19966646	.	G	A	894.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19966647	.	C	T	1898.95	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19967226	.	C	T	2773.26	PASS	AC=69;AF=0.04212;AN=1638;set=Intersection
22	19967239	.	A	T	387.43	PASS	AC=5;AF=0.00304;AN=1644;set=Intersection
22	19967248	.	T	C	3106.90	PASS	AC=70;AF=0.04258;AN=1644;set=Intersection
22	19967312	.	G	T	143.92	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	19967330	.	A	G	339.23	PASS	AC=3;AF=0.00183;AN=1640;DS;set=Intersection
22	19967480	.	C	G	1823.90	PASS	AC=40;AF=0.02475;AN=1616;set=Intersection
22	19967543	.	G	A	7985.89	PASS	AC=70;AF=0.04375;AN=1600;set=Intersection
22	19967567	.	G	A	1969.27	PASS	AC=26;AF=0.01635;AN=1590;set=Intersection
22	19967614	.	G	A	105.09	PASS	AC=1;AF=0.00067;AN=1488;set=Intersection
22	19967648	.	C	G	384.48	PASS	AC=3;AF=0.00192;AN=1566;set=Intersection
22	19967808	.	G	T	1500.47	PASS	AC=60;AF=0.04249;AN=1412;DS;set=Intersection
22	19968714	.	G	A	349.51	PASS	AC=1;AF=0.00064;AN=1574;set=Intersection
22	19968719	.	C	T	91.86	PASS	AC=3;AF=0.00191;AN=1572;set=Intersection
22	19968933	.	G	A	212.73	PASS	AC=3;AF=0.00185;AN=1622;set=Intersection
22	19968971	.	G	A	17659.27	PASS	AC=548;AF=0.33661;AN=1628;set=Intersection
22	19969043	.	C	T	1391.73	PASS	AC=45;AF=0.02768;AN=1626;set=Intersection
22	19969075	.	A	G	64325.76	PASS	AC=1152;AF=0.70762;AN=1628;DS;set=Intersection
22	19969106	.	A	G	61004.96	PASS	AC=616;AF=0.37653;AN=1636;DS;set=Intersection
22	19969182	.	C	T	1371.95	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	19969208	.	A	G	217.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19969285	.	T	G	320.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	19969295	.	C	T	329.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19969420	.	C	T	7868.75	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	19969469	.	C	T	419.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19969488	.	C	T	281.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	19969495	.	G	T	13592.69	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	19978074	.	A	T	7018.15	PASS	AC=99;AF=0.06044;AN=1638;set=Intersection
22	19978218	.	G	A	791.57	PASS	AC=9;AF=0.00547;AN=1644;set=Intersection
22	19978253	.	C	T	34.93	PASS	AC=1;AF=0.00061;AN=1630;set=Intersection
22	19978278	.	C	T	65.77	PASS	AC=1;AF=0.00062;AN=1626;set=Intersection
22	19978335	.	G	A	818.62	PASS	AC=19;AF=0.01209;AN=1572;set=Intersection
22	20024308	.	C	T	702.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20024318	.	C	T	736.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20024404	.	C	T	4922.93	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	20024417	.	C	T	321.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20030980	.	C	T	22772.92	PASS	AC=94;AF=0.05718;AN=1644;DS;set=Intersection
22	20031016	.	G	C	14959.09	PASS	AC=58;AF=0.03528;AN=1644;DS;set=Intersection
22	20041022	.	T	A	660.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20041023	.	C	T	813.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20041098	.	C	T	805.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20041119	.	C	CG	115.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20043423	.	G	A	256.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20043426	.	C	T	799.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20043504	.	G	A	1061.73	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	20043570	.	G	A	403.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20043582	.	G	A	671.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20049028	.	A	G	223.89	PASS	AC=2;AF=0.00122;AN=1644;set=Intersection
22	20049118	.	C	T	474.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20049131	.	C	T	231.09	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	20049244	.	C	T	5127.43	PASS	AC=100;AF=0.06757;AN=1480;DS;set=Intersection
22	20050815	.	C	T	350.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20050883	.	G	A	8384.33	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	20050886	.	G	C	342.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20050957	.	C	T	19822.63	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	20050979	.	G	A	22457.97	PASS	AC=68;AF=0.04136;AN=1644;DS;set=Intersection
22	20052038	.	T	C	234.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20052043	.	G	A	126.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20052050	.	C	T	13173.45	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	20052054	.	C	G	863.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20052089	.	T	G	17224.49	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	20052092	.	G	A	958.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20052143	.	C	T	3160.89	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	20052166	.	A	G	349.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20073773	.	C	T	759.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20073919	.	C	T	1620.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20073923	.	C	T	505.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20073924	.	G	A	1362.68	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20073930	.	C	T	4361.88	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20073937	.	C	T	990.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20074006	.	A	G	20518.80	PASS	AC=74;AF=0.04501;AN=1644;DS;set=Intersection
22	20074699	.	C	T	13569.46	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	20074819	.	G	C	1004.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20074870	.	G	C	2637.86	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	20077155	.	T	A	668.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20077451	.	A	G	682.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20077456	.	C	T	2599.44	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	20077523	.	A	G	676.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20077566	.	G	A	1166.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20077681	.	G	A	1324.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20077694	.	G	A	986.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20077720	.	A	C	4563.17	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	20077756	.	C	T	2928.41	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	20078948	.	T	C	598.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20079354	.	C	T	1024.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20079508	.	C	T	287.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20080296	.	C	T	933.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20080435	.	C	T	778.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20080447	.	G	A	22738.96	PASS	AC=104;AF=0.06326;AN=1644;DS;set=Intersection
22	20080475	.	GT	G	5788.74	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	20082228	.	T	C	968.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20082293	.	A	G	6012.68	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	20082352	.	T	C	1555.27	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20093655	.	C	T	270.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20093837	.	C	T	152.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20094211	.	G	A	396.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20094244	.	C	T	1127.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20094263	.	C	T	79722.57	PASS	AC=404;AF=0.24574;AN=1644;DS;set=Intersection
22	20094762	.	C	A	404.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20094825	.	C	T	1029.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20096364	.	C	T	2650.05	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	20096395	.	A	G	20312.98	PASS	AC=74;AF=0.04501;AN=1644;DS;set=Intersection
22	20097518	.	T	C	929.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20097523	.	C	G	208.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20097530	.	C	A	211.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20097585	.	C	T	429.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20097602	.	G	A	913.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20097643	.	C	T	2261.27	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	20097650	.	G	C	1003.38	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	20097653	.	C	T	122.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20097656	.	G	A	163.02	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20100133	.	G	A	471.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100158	.	G	C	19009.35	PASS	AC=47;AF=0.02859;AN=1644;DS;set=Intersection
22	20100166	.	G	GC	1807.19	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	20100200	.	C	T	1035.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20100209	.	C	T	960.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100273	.	C	T	809.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100387	.	G	A	31985.53	PASS	AC=43;AF=0.02616;AN=1644;DS;set=Intersection
22	20100400	.	C	T	575.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100409	.	C	T	34825.15	PASS	AC=138;AF=0.08394;AN=1644;DS;set=Intersection
22	20100419	.	C	T	573.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100526	.	G	C	706.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100567	.	G	A	659.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100596	.	T	C	76326.69	PASS	AC=381;AF=0.23175;AN=1644;DS;set=Intersection
22	20100615	.	C	T	583.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100674	.	C	T	404.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100687	.	G	A	153.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100697	.	C	T	1100.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20100705	.	G	A	114.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100779	.	C	G	444.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100791	.	C	G	627.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20100911	.	C	T	2746.07	PASS	AC=102;AF=0.06391;AN=1596;DS;set=Intersection
22	20100940	.	G	A	381.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20101025	.	T	C	538.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20101045	.	C	T	780.34	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	20101233	.	G	A	730.10	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	20101343	.	C	T	6523.87	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	20102047	.	G	A	527.48	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20102062	.	A	G	1976.63	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	20102064	.	A	G	886.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20102090	.	T	C	153139.47	PASS	AC=825;AF=0.50182;AN=1644;DS;set=Intersection
22	20102103	.	G	A	420.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20102256	.	C	A	4722.16	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	20102298	.	C	A	393.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20102308	.	A	G	259.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20102330	.	T	C	987.70	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	20102360	.	G	A	532.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20102364	.	G	A	544.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20102750	.	C	T	61314.86	PASS	AC=406;AF=0.24696;AN=1644;DS;set=Intersection
22	20102789	.	C	T	592.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20102842	.	C	T	626.53	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20102855	.	G	A	473.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20102871	.	A	C	202.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20103012	.	G	A	12347.85	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	20103158	.	A	G	1180.25	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	20103189	.	T	C	9203.84	PASS	AC=74;AF=0.04501;AN=1644;DS;set=Intersection
22	20103253	.	C	T	246.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20103263	.	G	T	5902.97	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	20103264	.	C	T	5437.96	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	20103344	.	C	T	477.93	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20103539	.	G	A	282.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20103604	.	G	A	687.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20103736	.	G	A	567.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20103750	.	C	T	744.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20103803	.	A	C	601.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20103915	.	C	T	1786.40	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	20103925	.	T	C	754.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20103953	.	G	A	2185.79	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	20104101	.	C	T	1593.98	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	20104146	.	A	C	254.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20104430	.	C	T	70.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20106681	.	G	A	5337.99	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	20109760	.	C	G	316.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20109764	.	TAACCTCA	T	951.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20109977	.	C	T	844.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20112812	.	C	T	288.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20112840	.	T	C	763.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20113005	.	C	T	353.61	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	20113777	.	T	C	97489.67	PASS	AC=400;AF=0.24331;AN=1644;DS;set=Intersection
22	20113809	.	C	T	9689.09	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	20113896	.	C	T	7347.35	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	20114479	.	A	G	1425.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20114500	.	C	T	430.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20114512	.	G	A	2711.95	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	20114518	.	G	A	1287.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20126702	.	C	T	20880.81	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	20126741	.	G	T	21627.96	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	20126829	.	T	C	1110.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20127026	.	C	T	2313.89	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	20127032	.	C	T	894.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20127226	.	G	T	581.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20127267	.	G	A	687.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20127374	.	G	A	333.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20127408	.	A	G	1184.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20128402	.	T	C	300.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20128426	.	C	T	62.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20128733	.	C	T	124.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20128851	.	G	A	262.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20128880	.	G	A	9339.56	PASS	AC=89;AF=0.05414;AN=1644;DS;set=Intersection
22	20128881	.	A	C	9605.59	PASS	AC=88;AF=0.05353;AN=1644;DS;set=Intersection
22	20128956	.	C	T	587.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20128978	.	G	A	606.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20128986	.	C	T	655.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20129072	.	C	T	159.43	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	20130321	.	C	T	144.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20130341	.	C	T	841.36	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20130416	.	C	T	328.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20130455	.	C	T	226.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20130558	.	G	A	169.41	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	20130626	.	C	T	5937.64	PASS	AC=18;AF=0.01104;AN=1630;DS;set=Intersection
22	20130654	.	G	A	2302.57	PASS	AC=5;AF=0.00305;AN=1638;DS;set=Intersection
22	20130697	.	G	A	1458.38	PASS	AC=5;AF=0.00305;AN=1642;DS;set=Intersection
22	20130885	.	G	A	92.86	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	20130908	.	C	T	179.32	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	20130920	.	G	A	629.74	PASS	AC=6;AF=0.00367;AN=1636;DS;set=Intersection
22	20130955	.	C	T	318.07	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	20131018	.	C	T	145.27	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	20131055	.	C	T	1879.62	PASS	AC=13;AF=0.00791;AN=1644;set=Intersection
22	20131115	.	C	T	9650.02	PASS	AC=125;AF=0.07631;AN=1638;set=Intersection
22	20131116	.	G	A	4635.23	PASS	AC=74;AF=0.04518;AN=1638;set=Intersection
22	20131121	.	G	C	957.32	PASS	AC=9;AF=0.00549;AN=1638;set=Intersection
22	20131213	.	G	A	155.04	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	20132749	.	C	T	799.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20132841	.	G	A	967.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20132858	.	A	G	1377.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20132861	.	C	T	386.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20132890	.	C	T	610.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20132932	.	T	C	218.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20132972	.	A	G	42145.94	PASS	AC=807;AF=0.49088;AN=1644;DS;set=Intersection
22	20229461	.	G	A	384.61	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	20229474	.	C	T	126.14	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	20229501	.	C	A	851.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20229561	.	G	A	424.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20229564	.	C	T	392.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20229569	.	C	T	100.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20229635	.	C	A	40.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20229716	.	C	T	219.23	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	20230007	.	C	G	395.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20230080	.	G	A	10612.09	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	20230163	.	C	T	141.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20230264	.	C	T	216.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20230301	.	G	A	815.68	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	20230317	.	G	A	218.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20230386	.	C	T	87.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20230390	.	T	G	217.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20230464	.	C	A	212.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20230572	.	T	C	227.40	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	20302276	.	A	T	24060.83	PASS	AC=92;AF=0.05596;AN=1644;DS;set=Intersection
22	20302837	.	C	G	162.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20302968	.	C	T	174	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20302997	.	G	A	434.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20303017	.	C	T	773.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20303019	.	C	T	364.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20303024	.	G	C	153.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20303664	.	G	A	16080.26	PASS	AC=94;AF=0.05718;AN=1644;DS;set=Intersection
22	20307346	.	G	GC	13156.85	PASS	AC=100;AF=0.06098;AN=1640;DS;set=Intersection
22	20307520	.	C	T	333.27	PASS	AC=15;AF=0.01040;AN=1442;set=Intersection
22	20457872	.	C	CA	723.75	PASS	AC=10;AF=0.00703;AN=1422;DS;set=Intersection
22	20458100	.	A	ACACCTG	98.42	PASS	AC=2;AF=0.00148;AN=1352;DS;set=Intersection
22	20748934	.	C	T	682.20	PASS	AC=1;AF=0.00081;AN=1230;DS;set=Intersection
22	20748994	.	A	G	2176.62	PASS	AC=3;AF=0.00244;AN=1232;DS;set=Intersection
22	20749694	.	G	A	846.32	PASS	AC=1;AF=0.00077;AN=1304;DS;set=Intersection
22	20754872	.	A	G	525.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20755067	.	C	G	665.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20755076	.	C	T	566.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20755097	.	T	C	1216.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20755098	.	A	G	244253.01	PASS	AC=1006;AF=0.61192;AN=1644;DS;set=Intersection
22	20755519	.	G	A	58.45	PASS	AC=2;AF=0.00149;AN=1338;set=Intersection
22	20755527	.	G	A	11411.36	PASS	AC=162;AF=0.12090;AN=1340;set=Intersection
22	20755631	.	G	A	427.95	PASS	AC=3;AF=0.00222;AN=1350;set=Intersection
22	20759620	.	G	A	2172.63	PASS	AC=2;AF=0.00133;AN=1500;DS;set=Intersection
22	20759672	.	G	A	47319.15	PASS	AC=158;AF=0.11934;AN=1324;DS;set=Intersection
22	20759804	.	G	A	377.78	PASS	AC=1;AF=0.00087;AN=1156;DS;set=Intersection
22	20759825	.	C	A	388.33	PASS	AC=1;AF=0.00084;AN=1186;DS;set=Intersection
22	20759967	.	C	T	44.72	PASS	AC=2;AF=0.00143;AN=1402;DS;set=Intersection
22	20760074	.	G	T	181.67	PASS	AC=1;AF=0.00062;AN=1610;set=Intersection
22	20760106	.	C	T	7001.52	PASS	AC=19;AF=0.01166;AN=1630;DS;set=Intersection
22	20760178	.	C	T	186.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20760516	.	C	A	412.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20760795	.	G	A	697.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20760977	.	G	A	1647.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20761018	.	C	T	5289.77	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	20761028	.	T	C	1028.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20761033	.	C	A	2184.36	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20761052	.	C	G	417.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20761063	.	G	A	50823.06	PASS	AC=185;AF=0.11253;AN=1644;DS;set=Intersection
22	20761079	.	A	G	1160.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20761099	.	G	C	684.16	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	20761111	.	C	T	385.77	PASS	AC=2;AF=0.00123;AN=1628;DS;set=Intersection
22	20761112	.	T	A	417.72	PASS	AC=2;AF=0.00123;AN=1630;DS;set=Intersection
22	20761192	.	G	T	28938.53	PASS	AC=100;AF=0.06203;AN=1612;DS;set=Intersection
22	20761193	.	C	T	30074.74	PASS	AC=98;AF=0.06064;AN=1616;DS;set=Intersection
22	20779768	.	G	C	10751.37	PASS	AC=533;AF=0.52051;AN=1024;set=Intersection
22	20779822	.	G	C	3032.22	PASS	AC=260;AF=0.2714;AN=958;set=Intersection
22	20779892	.	C	T	91.19	PASS	AC=1;AF=0.0013;AN=780;set=Intersection
22	20779947	.	G	C	2647.90	PASS	AC=450;AF=1.0000;AN=450;set=Intersection
22	20779973	.	C	CG	1301.76	PASS	AC=330;AF=1.0000;AN=330;set=Intersection
22	20780026	.	GC	G	36.05	PASS	AC=48;AF=0.4138;AN=116;set=Intersection
22	20780029	.	G	C	697.60	PASS	AC=92;AF=0.7797;AN=118;set=Intersection
22	20780031	.	G	C	1189.64	PASS	AC=182;AF=1.0000;AN=182;set=Intersection
22	20780091	.	C	G	23524.35	PASS	AC=1297;AF=0.95368;AN=1360;set=Intersection
22	20780097	.	G	C	26144.29	PASS	AC=1313;AF=0.95839;AN=1370;set=Intersection
22	20780296	.	G	A	1668.58	PASS	AC=25;AF=0.01584;AN=1578;DS;set=Intersection
22	20780316	.	G	A	30.51	PASS	AC=1;AF=0.00064;AN=1568;DS;set=Intersection
22	20780474	.	C	T	47.91	PASS	AC=2;AF=0.00189;AN=1060;set=Intersection
22	20781670	.	T	C	133762.48	PASS	AC=334;AF=0.20316;AN=1644;DS;set=Intersection
22	20781725	.	G	A	2010.50	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20781732	.	G	A	316.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20781827	.	G	A	1072.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20781869	.	T	C	465.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20781872	.	A	T	517.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20781886	.	G	A	226.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20783485	.	C	A	37163.93	PASS	AC=338;AF=0.20560;AN=1644;DS;set=Intersection
22	20783575	.	T	C	222.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20783692	.	G	C	241.06	PASS	AC=3;AF=0.00189;AN=1590;set=Intersection
22	20783783	.	G	C	707.39	PASS	AC=5;AF=0.00307;AN=1628;set=Intersection
22	20783815	.	G	C	752.38	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	20783834	.	G	A	204.95	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	20783960	.	C	T	248.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20783986	.	T	C	190.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20784050	.	T	A	61549.09	PASS	AC=384;AF=0.23358;AN=1644;DS;set=Intersection
22	20784152	.	G	A	239.79	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	20784168	.	GC	G	459.13	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	20784797	.	A	G	155.57	PASS	AC=1;AF=0.00062;AN=1626;set=Intersection
22	20784865	.	C	T	1032.60	PASS	AC=4;AF=0.00244;AN=1638;set=Intersection
22	20784892	.	C	T	96.26	PASS	AC=4;AF=0.00245;AN=1632;set=Intersection
22	20785078	.	G	T	458.99	PASS	AC=5;AF=0.00324;AN=1542;set=Intersection
22	20785257	.	G	C	82.83	PASS	AC=1;AF=0.00073;AN=1366;set=Intersection
22	20785533	.	C	T	167.72	PASS	AC=2;AF=0.00181;AN=1104;set=Intersection
22	20785639	.	G	A	1245.35	PASS	AC=120;AF=0.1405;AN=854;set=Intersection
22	20786033	.	G	A	54.27	PASS	AC=1;AF=0.00062;AN=1610;set=Intersection
22	20786125	.	C	T	201.20	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	20786126	.	G	A	68.82	PASS	AC=2;AF=0.00122;AN=1634;DS;set=Intersection
22	20786271	.	G	C	185.59	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	20791821	.	G	A	5379.08	PASS	AC=367;AF=0.28583;AN=1284;set=Intersection
22	20791966	.	G	A	57.26	PASS	AC=1;AF=0.00097;AN=1034;set=Intersection
22	20796444	.	G	A	611.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20796458	.	G	A	626.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20796567	.	G	A	311.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20796597	.	G	A	626.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20796615	.	A	T	571.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20796662	.	C	T	308.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20796729	.	C	T	159.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20796769	.	G	A	187.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20800701	.	G	A	695.29	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	20800738	.	C	T	1107.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20800781	.	A	G	2389.10	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	20800835	.	A	G	107831.22	PASS	AC=332;AF=0.20195;AN=1644;DS;set=Intersection
22	20800848	.	T	C	2899.99	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20800913	.	G	A	878.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20800941	.	G	A	985.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20800983	.	G	A	77604.11	PASS	AC=230;AF=0.13990;AN=1644;DS;set=Intersection
22	20812116	.	G	A	87.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20819327	.	C	T	11894.19	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	20819372	.	C	T	849.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20819567	.	G	A	737.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20819577	.	A	G	684.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20825697	.	G	A	1244.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20843232	.	C	T	858.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20843315	.	C	G	1272.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20843378	.	G	A	21334.45	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	20843508	.	C	T	673.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20861934	.	G	A	703.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20862056	.	G	A	226.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20891365	.	C	T	494.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20891366	.	T	C	15781.72	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	20891380	.	G	A	976.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20891498	.	C	CCCTA	158508.94	PASS	AC=251;AF=0.15268;AN=1644;DS;set=Intersection
22	20891501	.	T	TACCG	108036.23	PASS	AC=246;AF=0.14964;AN=1644;DS;set=Intersection
22	20891502	.	A	ACCTG	101971.97	PASS	AC=246;AF=0.14964;AN=1644;DS;set=Intersection
22	20891539	.	G	A	377.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20909206	.	C	T	48671.07	PASS	AC=94;AF=0.05718;AN=1644;DS;set=Intersection
22	20909255	.	G	A	457.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20909272	.	C	T	512.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20909294	.	C	T	492.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20909330	.	C	G	574.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20909371	.	G	A	336.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20909389	.	G	A	181.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20909448	.	C	T	9305.16	PASS	AC=30;AF=0.01832;AN=1638;DS;set=Intersection
22	20909465	.	C	T	437.43	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	20918716	.	G	A	434.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20918779	.	A	G	462.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20918794	.	A	T	56.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20918987	.	C	T	704.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20920813	.	ACAG	A,ACAGCAG,ACAGCAGCAG	10326.14	PASS	AC=260,107,336;AF=0.15815,0.06509,0.20438;AN=1644;DS;set=Intersection
22	20920906	.	G	T	965.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20921025	.	A	G	820.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20922898	.	A	C	10073.15	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	20922926	.	C	T	207.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20929453	.	G	T	832.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20929528	.	G	A	963.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20936852	.	C	T	124.82	PASS	AC=6;AF=0.00439;AN=1366;set=Intersection
22	20936873	.	G	A	841.13	PASS	AC=29;AF=0.02006;AN=1446;set=Intersection
22	20936980	.	C	G	116.32	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	20936993	.	G	A	187.83	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	20937074	.	G	A	486.66	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	20937175	.	G	A	1053.99	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	20937201	.	C	T	967.08	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20937202	.	G	A	214.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20937204	.	G	A	412.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20937350	.	T	TC	463.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20937358	.	C	T	246.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20937386	.	C	T	650.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20937513	.	A	G	602.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20937564	.	C	T	1785.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20937601	.	C	T	65064.26	PASS	AC=269;AF=0.16363;AN=1644;DS;set=Intersection
22	20937606	.	T	TG	1488.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20937648	.	C	T	1004.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20939110	.	C	T	287.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20939123	.	G	A	48248.62	PASS	AC=283;AF=0.17214;AN=1644;DS;set=Intersection
22	20939161	.	C	T	914.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20939296	.	C	T	432.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20939298	.	A	G	1026.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20939400	.	G	A	42107.46	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	20940002	.	T	G	342.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20940046	.	G	A	1174.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20940085	.	G	A	75610.95	PASS	AC=235;AF=0.14294;AN=1644;DS;set=Intersection
22	20940807	.	G	A	803.88	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20940822	.	C	T	5815.88	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	20940856	.	C	T	937.74	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	20940857	.	G	A	570.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20940877	.	G	A	1079.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20940934	.	C	T	1112.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	20941012	.	C	T	1635.79	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	20941038	.	A	C	226.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	20941039	.	C	T	1110.61	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21062316	.	G	A	11111.09	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	21067690	.	G	A	130.48	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	21072992	.	C	T	1819.23	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21073090	.	C	G	929.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21073122	.	G	A	136563.19	PASS	AC=849;AF=0.51642;AN=1644;DS;set=Intersection
22	21075537	.	A	C	150240.90	PASS	AC=731;AF=0.44465;AN=1644;DS;set=Intersection
22	21075586	.	G	C	1941.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21080753	.	C	T	1091.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21080864	.	G	C	278.81	PASS	AC=2;AF=0.00122;AN=1638;DS;set=Intersection
22	21080877	.	C	T	372.70	PASS	AC=6;AF=0.00366;AN=1638;DS;set=Intersection
22	21081480	.	T	C	400.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21081634	.	C	T	450.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21082013	.	G	A	599.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21082033	.	C	T	58125.40	PASS	AC=62;AF=0.03771;AN=1644;DS;set=Intersection
22	21082168	.	G	A	1679.37	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21083591	.	G	A	1497.42	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21083611	.	G	A	1619.23	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21083886	.	G	A	44.70	PASS	AC=1;AF=0.00062;AN=1606;DS;set=Intersection
22	21083938	.	C	T	129.79	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	21083959	.	T	C	1036.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21084155	.	C	G	6480.34	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	21084208	.	G	A	10388.64	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	21084220	.	G	A	2231.33	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21088881	.	CA	C	406.08	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21096605	.	G	A	496.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21096619	.	T	C	758.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21096679	.	C	T	1620.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21096865	.	C	T	856.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21096885	.	CAGTG	C	584.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21096904	.	C	T	691.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21097036	.	C	T	860.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21097037	.	G	A	858.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21098897	.	GCAAGGA	G	440.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21098898	.	C	T	443.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21101940	.	C	T	2235.50	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21104150	.	T	C	1568.33	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21104315	.	C	T	163.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21105608	.	C	T	492.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21105614	.	C	G	19586.70	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	21105998	.	C	T	16299.31	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	21106055	.	G	A	18195.48	PASS	AC=112;AF=0.06813;AN=1644;DS;set=Intersection
22	21106077	.	C	T	357.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21107153	.	T	C	248247.76	PASS	AC=891;AF=0.54197;AN=1644;DS;set=Intersection
22	21107179	.	A	G	1439.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21107183	.	G	A	16563.07	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	21107345	.	G	C	905.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21107374	.	C	T	1049.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21107413	.	G	A	1040.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21107463	.	T	C	1487.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21107486	.	C	A	789.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21115543	.	C	A	15813.80	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	21115576	.	A	G	922.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21115714	.	G	A	632.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21119099	.	G	A	768.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21119148	.	T	C	875.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21119278	.	C	T	1066.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21119433	.	G	A	871.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21119564	.	C	A	1858.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21119838	.	C	T	837.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21119867	.	C	T	917.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21119995	.	A	T	24893.10	PASS	AC=112;AF=0.06813;AN=1644;DS;set=Intersection
22	21133609	.	C	T	794.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21133618	.	C	T	9101.07	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	21133619	.	G	A	18169.98	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	21133685	.	G	A	356.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21133692	.	G	A	343.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21133793	.	G	A	846.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21133831	.	C	A,T	34582.66	PASS	AC=4,76;AF=0.00243,0.04623;AN=1644;DS;set=Intersection
22	21133860	.	G	A	12431.52	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	21133885	.	C	T	20151.94	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	21133886	.	G	A	763.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21134007	.	A	T	666.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21134023	.	G	A	9094.05	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	21134037	.	A	T	588.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21134067	.	T	C	14106.20	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	21134083	.	G	A	902.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21134136	.	C	T	385.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21134223	.	G	A	2855.95	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21134284	.	G	A	790.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21134430	.	C	T	7941.12	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	21134442	.	T	C	2310.31	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21134513	.	C	T	693.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21138483	.	G	T	920.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21138487	.	C	T	1028.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21138544	.	C	T	14800.56	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	21140287	.	T	C	6285.70	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21141116	.	C	A,T	846.72	PASS	AC=1,1;AF=0.00061,0.00061;AN=1644;DS;set=Intersection
22	21141179	.	C	T	1798.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21141225	.	G	A	802.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21141265	.	G	A	791.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21141300	.	T	C	192681.30	PASS	AC=890;AF=0.54136;AN=1644;DS;set=Intersection
22	21141392	.	C	T	11520.80	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	21147564	.	G	C	678.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21150389	.	G	A	158.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21150408	.	G	A	302.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21150479	.	C	G	736.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21150521	.	G	A	2022.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21150649	.	G	A	558.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21152916	.	G	A	1924.57	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21152979	.	G	A	1059.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21153335	.	G	A	609.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21153433	.	G	C	841.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21153492	.	C	T	899.28	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21153590	.	C	T	126089.54	PASS	AC=727;AF=0.44221;AN=1644;DS;set=Intersection
22	21153606	.	C	T	457.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21153964	.	G	A	1043.75	PASS	AC=3;AF=0.00190;AN=1582;DS;set=Intersection
22	21156239	.	C	T	5274.66	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21156277	.	T	C	1126.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21156281	.	G	T	1077.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21156293	.	C	A	617.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21156388	.	C	T	787.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21156416	.	T	C	939.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21157642	.	T	C	390.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21158703	.	A	G	886.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21159311	.	C	T	783.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21159355	.	G	A	677.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21159437	.	A	G	881.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21159480	.	C	T	812.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21161796	.	C	T	839.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21165248	.	G	A	804.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21165308	.	C	T	767.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21165311	.	T	C	10692.59	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	21167605	.	G	GACA	307352.39	PASS	AC=839;AF=0.51034;AN=1644;DS;set=Intersection
22	21167606	.	A	ACAC	143896.23	PASS	AC=838;AF=0.50973;AN=1644;DS;set=Intersection
22	21167607	.	C	CAAT	137806.21	PASS	AC=824;AF=0.50122;AN=1644;DS;set=Intersection
22	21167667	.	C	T	1301.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21167697	.	T	C	798.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21167775	.	C	T	1123.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21167781	.	G	A	1302.69	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21167787	.	G	A	161920.94	PASS	AC=839;AF=0.51034;AN=1644;DS;set=Intersection
22	21172754	.	G	A	3116.43	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	21172778	.	G	A	468.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21173902	.	G	C	1223.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21174120	.	T	C	793.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21174798	.	T	C	14002.28	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	21174855	.	C	A	875.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21174902	.	G	A	973.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21174913	.	G	A	8262.02	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	21174920	.	A	AG	4426.76	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	21174922	.	A	G	19157.49	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	21174931	.	AC	A	2853.48	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21178578	.	T	C	683.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21178633	.	T	C	844.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21178723	.	A	C	13248.05	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	21188819	.	T	C	810.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21188823	.	T	C	16436.83	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	21188928	.	C	T	608.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21188955	.	T	G	2701.06	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21188961	.	G	T	2821.29	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21188964	.	T	C	22994.12	PASS	AC=112;AF=0.06813;AN=1644;DS;set=Intersection
22	21213367	.	C	G	380.27	PASS	AC=6;AF=0.00389;AN=1542;set=Intersection
22	21213380	.	C	T	15415.07	PASS	AC=667;AF=0.42215;AN=1580;set=Intersection
22	21213391	.	C	G	2285.72	PASS	AC=16;AF=0.01008;AN=1588;set=Intersection
22	21213394	.	G	A	2036.04	PASS	AC=14;AF=0.00879;AN=1592;set=Intersection
22	21213416	.	A	G	26075.88	PASS	AC=623;AF=0.38792;AN=1606;set=Intersection
22	21213463	.	C	T	99.94	PASS	AC=1;AF=0.00062;AN=1614;set=Intersection
22	21213470	.	T	A	304.75	PASS	AC=4;AF=0.00248;AN=1612;set=Intersection
22	21213479	.	C	G	41.22	PASS	AC=1;AF=0.00062;AN=1612;set=Intersection
22	21213511	.	C	T	157.75	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	21213516	.	G	A	86.52	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	21213528	.	T	C	987.21	PASS	AC=11;AF=0.00673;AN=1634;set=Intersection
22	21224575	.	G	A	352.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21224581	.	G	A	15717.53	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	21224646	.	G	A	1112.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21224652	.	G	A	2096.06	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21224705	.	G	C	887.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21224845	.	G	A	1227.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21235306	.	C	T	857.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21235389	.	A	G	16084.53	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	21235417	.	A	C	595.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21237751	.	A	T	987.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21237816	.	C	G	797.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21237874	.	C	T	1212.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21241923	.	G	A	789.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21241945	.	G	A	1063.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21241954	.	C	T	847.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21241960	.	C	G	1139.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21241970	.	A	T	836.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21241976	.	C	T	1146.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21242095	.	A	C	789.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21242113	.	C	T	1154.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21242150	.	T	C	756.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21272182	.	A	G	193.47	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	21272258	.	C	T	2089.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21272300	.	C	G	318.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21288324	.	A	G	794.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21288416	.	G	A	6833.92	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21303949	.	C	CTT	854.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21303955	.	CTTG	C	970.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21304158	.	CT	C	777.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21322238	.	C	T	5358.65	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	21322243	.	G	C	493.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21327589	.	C	T	24668.44	PASS	AC=392;AF=0.23932;AN=1638;set=Intersection
22	21327642	.	G	A	427.28	PASS	AC=3;AF=0.00183;AN=1640;DS;set=Intersection
22	21327798	.	C	A	359.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21327834	.	C	G	123046.87	PASS	AC=1573;AF=0.95681;AN=1644;DS;set=Intersection
22	21327836	.	G	A	87.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21328017	.	G	T	43.13	PASS	AC=1;AF=0.00061;AN=1628;DS;set=Intersection
22	21328036	.	C	T	1775.76	PASS	AC=16;AF=0.00983;AN=1628;DS;set=Intersection
22	21328131	.	G	A	89.04	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	21328178	.	G	A	85.08	PASS	AC=2;AF=0.00124;AN=1610;DS;set=Intersection
22	21328327	.	G	C	15154.65	PASS	AC=87;AF=0.05292;AN=1644;DS;set=Intersection
22	21328435	.	G	A	230.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21328477	.	C	T	317.52	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21328555	.	G	A	211.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21328567	.	C	T	207.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21328568	.	G	A	5917.03	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	21328572	.	G	A	139.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21328876	.	C	T	770.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21328899	.	T	C	7189.64	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	21328976	.	C	T	171.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21329052	.	G	A	1113.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21329084	.	C	T	637.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21329120	.	G	A	76.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21329123	.	A	G	111296.52	PASS	AC=1018;AF=0.61922;AN=1644;DS;set=Intersection
22	21330097	.	G	A	406.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21330116	.	C	G	5272.29	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	21330507	.	G	A	731.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21330608	.	C	T	36277	PASS	AC=155;AF=0.09428;AN=1644;DS;set=Intersection
22	21330622	.	G	A	604.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21330750	.	G	A	552.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21330787	.	C	T	42209.57	PASS	AC=347;AF=0.21107;AN=1644;DS;set=Intersection
22	21330789	.	G	A	790.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21330800	.	G	A	213.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21330855	.	T	A	877.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21330939	.	G	A	245.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21331007	.	G	A	450.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21331032	.	C	T	934.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21331043	.	A	T	167853.68	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	21331056	.	G	A	650.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21331129	.	C	T	576.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21331171	.	C	T	1094.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21331194	.	G	A	1129.35	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21331233	.	CCCTTCT	C	2807.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21331427	.	G	A	1448.76	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21331948	.	G	A	329.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21331950	.	C	G	241050.28	PASS	AC=1614;AF=0.98175;AN=1644;DS;set=Intersection
22	21331959	.	G	A	1103.74	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21332030	.	G	A	1002.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21332152	.	G	A	994.21	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21332187	.	C	G	2582.58	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	21332263	.	C	T	17485.63	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	21333542	.	C	T	326.55	PASS	AC=1;AF=0.00066;AN=1504;DS;set=Intersection
22	21333552	.	T	A	420.47	PASS	AC=1;AF=0.00066;AN=1518;DS;set=Intersection
22	21333605	.	G	C	5315.26	PASS	AC=43;AF=0.02840;AN=1514;DS;set=Intersection
22	21333676	.	GA	G	4013.52	PASS	AC=65;AF=0.04440;AN=1464;DS;set=Intersection
22	21333903	.	G	A	1015.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21333920	.	C	T	433.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21334006	.	G	A	1464.57	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21334007	.	T	G	502.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21334389	.	G	A	1018.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21334461	.	T	G	36865.66	PASS	AC=167;AF=0.10158;AN=1644;DS;set=Intersection
22	21335010	.	C	T	748.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21335074	.	G	A	957.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21335259	.	C	A	120669.93	PASS	AC=648;AF=0.39416;AN=1644;DS;set=Intersection
22	21335284	.	T	A	114.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21335329	.	G	A	639.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21335344	.	A	G	168.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21336655	.	C	T	288.83	PASS	AC=8;AF=0.00535;AN=1496;set=Intersection
22	21337266	.	G	A	130403.58	PASS	AC=676;AF=0.41119;AN=1644;DS;set=Intersection
22	21337276	.	A	G	5468.07	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21337303	.	C	T	796.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21337306	.	T	C	1127.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21337308	.	C	T	1144.09	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21337325	.	G	A	100825.07	PASS	AC=417;AF=0.25365;AN=1644;DS;set=Intersection
22	21337378	.	GGTGA	G	1198.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21337385	.	G	A	1452.81	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21337415	.	C	G	275697.77	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	21337421	.	A	G	639.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21340088	.	T	C	98473.15	PASS	AC=700;AF=0.42579;AN=1644;DS;set=Intersection
22	21340116	.	C	T	1039.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21340198	.	C	T	4413.71	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	21340199	.	G	A	878.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21341771	.	A	G	1001.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21341896	.	G	A	394.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21341910	.	C	T	295.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21342253	.	C	T	328.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21342273	.	G	A	20395.65	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	21342451	.	G	T	762.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21343172	.	G	A	388.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21343195	.	C	T	867.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21343981	.	GTGGGGAGCCAGGGCGCAGGTAGAGGAGGTGAGGGGCA	G	80868.84	PASS	AC=724;AF=0.44039;AN=1644;DS;set=Intersection
22	21343982	.	TGGGGAGCCAGGGCGCAGGTAGAGGAGGTGAGGGGCAC	T	183255.46	PASS	AC=1460;AF=0.88808;AN=1644;DS;set=Intersection
22	21344002	.	AGAGGAGGTGAGGGGCACGGGGAGCCAGGGCGCAGGTG	A	77602.51	PASS	AC=1365;AF=0.83232;AN=1640;DS;set=Intersection
22	21344651	.	C	T	1139.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21344689	.	C	T	825.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21344701	.	A	T	925.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21344746	.	T	C	807.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21344764	.	C	T	3135.95	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21344848	.	C	T	10186.83	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	21345980	.	C	T	125.82	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	21346031	.	G	A	46.61	PASS	AC=1;AF=0.00062;AN=1622;DS;set=Intersection
22	21346095	.	G	A	74.24	PASS	AC=1;AF=0.00063;AN=1600;DS;set=Intersection
22	21346458	.	G	A	2115.07	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	21346485	.	T	C	150518.15	PASS	AC=1092;AF=0.66423;AN=1644;DS;set=Intersection
22	21346557	.	C	T	963.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21346674	.	C	A	272.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21347142	.	C	T	1773.93	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	21347194	.	G	T	447.82	PASS	AC=2;AF=0.00122;AN=1638;DS;set=Intersection
22	21347220	.	C	T	109.46	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	21347925	.	C	G	591.76	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21348051	.	C	G	6790.70	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	21348084	.	T	C	101253.77	PASS	AC=1266;AF=0.77007;AN=1644;DS;set=Intersection
22	21348266	.	G	A	40.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21348284	.	G	A	209.49	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21348348	.	G	T	2060.90	PASS	AC=20;AF=0.01225;AN=1632;set=Intersection
22	21348473	.	C	T	428.59	PASS	AC=5;AF=0.00307;AN=1628;set=Intersection
22	21348588	.	G	A	94.73	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	21348806	.	C	T	267.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21348914	.	C	T	28118.64	PASS	AC=267;AF=0.16241;AN=1644;DS;set=Intersection
22	21348954	.	G	A	744.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21349037	.	A	G	161563.67	PASS	AC=1276;AF=0.77616;AN=1644;DS;set=Intersection
22	21349151	.	T	C	512.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21349277	.	C	T	786.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21349280	.	C	T	156.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21349312	.	A	G	601.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21349987	.	A	G	1100.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21350008	.	C	T	9807.74	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	21350054	.	C	T	27310.02	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	21350099	.	C	T	2017.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21350114	.	C	T	540.19	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21350162	.	G	C	489.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21350285	.	C	A,G,T	2249.38	PASS	AC=0,2,3;AF=0.00000,0.00122,0.00182;AN=1644;DS;set=Intersection
22	21350342	.	C	T	18679.46	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	21350369	.	C	T	714.48	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21350370	.	G	A	850.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21350414	.	C	T	4333.41	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	21350936	.	G	A	36671.10	PASS	AC=396;AF=0.24088;AN=1644;DS;set=Intersection
22	21350947	.	A	G	16630.90	PASS	AC=160;AF=0.09732;AN=1644;DS;set=Intersection
22	21350974	.	C	G	421.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21351137	.	G	A	574.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21351169	.	T	C	795.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21351222	.	C	T	2155.42	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21351502	.	C	T	1767.42	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21351625	.	C	T	339.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21351657	.	A	G	280.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21351679	.	G	A	328.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21354151	.	G	A	1187.76	PASS	AC=5;AF=0.00308;AN=1626;DS;set=Intersection
22	21354152	.	G	A	603.44	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	21354158	.	C	G	12763.07	PASS	AC=40;AF=0.02442;AN=1638;DS;set=Intersection
22	21354164	.	G	GC	214.52	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21354310	.	C	A	181.11	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	21354411	.	G	C	43.76	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21354436	.	G	C	65.79	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21354460	.	C	T	254.18	PASS	AC=2;AF=0.00122;AN=1634;set=Intersection
22	21354487	.	G	C	450.02	PASS	AC=13;AF=0.00819;AN=1588;set=Intersection
22	21354503	.	C	T	34.01	PASS	AC=2;AF=0.00124;AN=1616;set=Intersection
22	21354595	.	C	A	120.45	PASS	AC=1;AF=0.00062;AN=1620;set=Intersection
22	21354621	.	G	A	185.17	PASS	AC=1;AF=0.00062;AN=1622;set=Intersection
22	21354676	.	T	A	59.46	PASS	AC=2;AF=0.00123;AN=1626;set=Intersection
22	21354680	.	G	C	45.38	PASS	AC=1;AF=0.00062;AN=1624;set=Intersection
22	21354748	.	T	G	87.93	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	21354915	.	TC	T	592.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21354956	.	C	G	2054.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21354970	.	C	G	354272.20	PASS	AC=1425;AF=0.86679;AN=1644;DS;set=Intersection
22	21355046	.	G	A	789.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21355101	.	A	G	1000.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21355501	.	G	A	5799.79	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	21355503	.	G	GC	1006.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21355530	.	G	A	890.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21355571	.	C	T	724.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21355576	.	C	G	956.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21355607	.	G	A	483.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21355612	.	C	A	646.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21356159	.	G	A	44.64	PASS	AC=1;AF=0.00071;AN=1416;set=Intersection
22	21356175	.	C	T	42.57	PASS	AC=1;AF=0.00068;AN=1476;set=Intersection
22	21369521	.	T	C	611.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21369611	.	G	A	4926.66	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21370197	.	G	A	1010.15	PASS	AC=9;AF=0.00590;AN=1526;DS;set=Intersection
22	21370237	.	T	G	18371.44	PASS	AC=119;AF=0.07589;AN=1568;DS;set=Intersection
22	21370243	.	C	G	48.93	PASS	AC=3;AF=0.00190;AN=1578;DS;set=Intersection
22	21372374	.	G	A	50424.98	PASS	AC=373;AF=0.22689;AN=1644;DS;set=Intersection
22	21377036	.	C	T	909.10	PASS	AC=3;AF=0.00183;AN=1638;DS;set=Intersection
22	21377051	.	G	A	178.24	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	21377071	.	C	T	36148.01	PASS	AC=259;AF=0.15793;AN=1640;DS;set=Intersection
22	21377076	.	G	A	571.57	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21377191	.	C	T	7439.42	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	21377220	.	T	C	550.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21377301	.	C	A	252592.33	PASS	AC=1012;AF=0.61557;AN=1644;DS;set=Intersection
22	21377325	.	G	A	883.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21377334	.	C	T	69285.87	PASS	AC=256;AF=0.15572;AN=1644;DS;set=Intersection
22	21377358	.	C	T	1571.88	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	21377542	.	T	C	769.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21377636	.	C	T	654.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21377643	.	G	A	533.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21377650	.	G	A	63906.86	PASS	AC=166;AF=0.10097;AN=1644;DS;set=Intersection
22	21377712	.	C	T	909.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21377842	.	C	T	210.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21377943	.	G	A	395.85	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	21377949	.	C	T	484.93	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	21377953	.	C	T	53442.40	PASS	AC=224;AF=0.13659;AN=1640;DS;set=Intersection
22	21380048	.	G	A	895.25	PASS	AC=5;AF=0.00325;AN=1540;DS;set=Intersection
22	21380064	.	G	A	68015.05	PASS	AC=477;AF=0.30460;AN=1566;DS;set=Intersection
22	21380118	.	A	G	641.44	PASS	AC=2;AF=0.00123;AN=1624;DS;set=Intersection
22	21380181	.	C	T	278.06	PASS	AC=3;AF=0.00183;AN=1640;DS;set=Intersection
22	21380207	.	A	T	638.83	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21380227	.	C	T	933.92	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	21380236	.	A	G	773.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21380311	.	C	T	1014.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21380344	.	C	T	1039.12	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21380379	.	C	CT	562.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21380629	.	G	T	575.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21380732	.	C	T	247.72	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	21380745	.	A	C	394.44	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21380795	.	G	A	76.47	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	21380810	.	A	G	43.66	PASS	AC=1;AF=0.00061;AN=1632;DS;set=Intersection
22	21380895	.	G	A	70.20	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	21380900	.	C	T	483.73	PASS	AC=3;AF=0.00185;AN=1622;DS;set=Intersection
22	21380908	.	C	G	902.48	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	21383312	.	G	A	36518.15	PASS	AC=496;AF=0.30170;AN=1644;set=Intersection
22	21383322	.	G	A	113.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21383341	.	C	T	860.07	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21383420	.	C	T	729.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21383429	.	A	T	288.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21383541	.	G	A	986.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21383604	.	C	T	1020.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21383661	.	G	A	1989.84	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21384017	.	G	T	1009.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21384071	.	T	TG	929.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21384206	.	T	C	883.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21384275	.	C	T	191.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21384295	.	T	C	260.01	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21384318	.	C	A	198.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21384336	.	G	A	2124.08	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21384374	.	A	T	1282.40	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	21384411	.	G	A	76.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21384470	.	G	A	834.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21384475	.	A	C	978.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21384490	.	G	A	1320.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21384516	.	C	T	22421.63	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	21384532	.	G	T	325.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21384578	.	C	T	120082.03	PASS	AC=479;AF=0.29136;AN=1644;DS;set=Intersection
22	21384598	.	C	T	1533.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21385191	.	G	T	1460.05	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21385196	.	G	A	309.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21385201	.	G	T	870.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21385277	.	C	T	51603.61	PASS	AC=230;AF=0.13990;AN=1644;DS;set=Intersection
22	21385349	.	G	A	581.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21385393	.	C	T	2882.21	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	21385420	.	C	T	1546.59	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21385427	.	G	C	28537.35	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	21385533	.	A	C	608.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21385730	.	G	C	601.71	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21385769	.	G	A	465.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21385770	.	C	T	600.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21385843	.	G	A	60281.72	PASS	AC=440;AF=0.26764;AN=1644;DS;set=Intersection
22	21385876	.	C	T	652.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21385907	.	C	T	618.97	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21385918	.	C	T	455.32	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21385919	.	G	A	204.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21385954	.	T	C	522.79	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21385961	.	C	T	19042.11	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	21385964	.	G	A	94.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21385985	.	C	T	41386.81	PASS	AC=255;AF=0.15511;AN=1644;DS;set=Intersection
22	21386019	.	G	A	56040.74	PASS	AC=478;AF=0.29075;AN=1644;DS;set=Intersection
22	21386029	.	CCAG	C	283.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21386079	.	A	G	5894.48	PASS	AC=11;AF=0.00670;AN=1642;DS;set=Intersection
22	21386095	.	G	A	66.47	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	21386112	.	C	T	11771.75	PASS	AC=168;AF=0.10244;AN=1640;DS;set=Intersection
22	21797101	.	CG	C	15197.86	PASS	AC=1414;AF=0.97652;AN=1448;set=Intersection
22	21799232	.	C	T	459.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21799251	.	A	G	274.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21799325	.	C	T	5210.93	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	21799610	.	C	T	732.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21799658	.	G	C	259.03	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	21799758	.	C	T	895.52	PASS	AC=4;AF=0.00244;AN=1638;set=Intersection
22	21799870	.	G	T	221.15	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	21799871	.	C	T	210.70	PASS	AC=1;AF=0.00061;AN=1632;DS;set=Intersection
22	21799889	.	C	T	470.53	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	21799890	.	G	A	142.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21799907	.	C	G	1014.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21800042	.	T	C	170178.05	PASS	AC=1615;AF=0.98236;AN=1644;DS;set=Intersection
22	21800043	.	C	T	612.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21800049	.	G	A	1137.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21800129	.	C	T	2760.16	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	21800180	.	C	T	755.39	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21800269	.	C	T	2141.78	PASS	AC=39;AF=0.02378;AN=1640;set=Intersection
22	21800277	.	G	A	361.33	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	21800420	.	C	T	3121.43	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	21800438	.	C	T	576.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21800444	.	T	C	232244.72	PASS	AC=1613;AF=0.98114;AN=1644;DS;set=Intersection
22	21800456	.	C	T	493.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21800610	.	G	C	825.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21800813	.	G	A	1491.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21800967	.	G	A	688.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21801047	.	C	T	7137.46	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	21922094	.	G	T	130.66	PASS	AC=1;AF=0.00067;AN=1502;DS;set=Intersection
22	21947126	.	C	G	530.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21965359	.	G	A	814.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21965378	.	G	T	11522.55	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	21982809	.	G	T	1888.25	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	21982892	.	C	T	25714.06	PASS	AC=400;AF=0.24390;AN=1640;DS;set=Intersection
22	21982911	.	G	C	136.12	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	21982924	.	G	C	39.18	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	21982978	.	G	A	170.42	PASS	AC=1;AF=0.00063;AN=1592;set=Intersection
22	21983105	.	A	C	408.19	PASS	AC=21;AF=0.01675;AN=1254;set=Intersection
22	21983260	.	A	G	2817.09	PASS	AC=391;AF=0.3966;AN=986;set=Intersection
22	21983314	.	G	A	171.40	PASS	AC=9;AF=0.0102;AN=882;set=Intersection
22	21983457	.	G	C	61.50	PASS	AC=1;AF=0.00091;AN=1096;set=Intersection
22	21983693	.	G	C	167.35	PASS	AC=3;AF=0.00193;AN=1558;set=Intersection
22	21983853	.	G	A	7255.50	PASS	AC=108;AF=0.06950;AN=1554;set=Intersection
22	21984205	.	A	G	15893.95	PASS	AC=654;AF=0.41184;AN=1588;set=Intersection
22	21984211	.	G	A	220.02	PASS	AC=6;AF=0.00377;AN=1592;set=Intersection
22	21984246	.	G	C	113.31	PASS	AC=1;AF=0.00062;AN=1610;DS;set=Intersection
22	21984313	.	G	C	314.67	PASS	AC=7;AF=0.00452;AN=1548;DS;set=Intersection
22	21987562	.	C	T	130.30	PASS	AC=4;AF=0.00276;AN=1448;set=Intersection
22	21988280	.	C	T	465.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988295	.	A	G	892.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21988303	.	C	T	10076.84	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	21988422	.	C	T	1051.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988423	.	G	A	1132.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988524	.	C	T	44912.76	PASS	AC=185;AF=0.11253;AN=1644;DS;set=Intersection
22	21988563	.	G	T	596.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988578	.	C	A	373.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988599	.	G	A	44528.23	PASS	AC=201;AF=0.12226;AN=1644;DS;set=Intersection
22	21988602	.	C	T	60279.66	PASS	AC=227;AF=0.13808;AN=1644;DS;set=Intersection
22	21988641	.	C	T	2711.52	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	21988648	.	G	A	741.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988654	.	G	A	364.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988738	.	G	A	660.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988758	.	C	T	601.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988760	.	G	A	7992.23	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	21988774	.	G	A	798.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21988833	.	C	T	62465.38	PASS	AC=101;AF=0.06144;AN=1644;DS;set=Intersection
22	21988834	.	G	A	51.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988854	.	G	A	868.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988858	.	G	T	437	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21988865	.	A	G	8533.51	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	21989008	.	C	G	6295.19	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	21989092	.	G	T	5021.77	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21989106	.	G	A	7095.50	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	21989142	.	G	A	22602.21	PASS	AC=47;AF=0.02859;AN=1644;DS;set=Intersection
22	21989154	.	C	T	42145.32	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	21989179	.	T	A	13607.36	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	21989194	.	G	C	669.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21989230	.	C	T	25949.50	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	21989236	.	G	A	1271.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21989241	.	C	T	435.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21989248	.	G	A	8502.48	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	21989258	.	C	T	8273.21	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	21989289	.	C	T	215.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21989325	.	C	T	40948.03	PASS	AC=88;AF=0.05353;AN=1644;DS;set=Intersection
22	21989346	.	G	A	970.21	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21989397	.	C	G	445.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21989451	.	C	T	704.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21989467	.	G	C	511.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21989490	.	C	T	401.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21989491	.	G	A	70.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21989501	.	A	G	101.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21990671	.	G	C	206.84	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	21990707	.	C	T	274.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21990752	.	A	G	6256.40	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	21990777	.	G	A	882.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21990822	.	C	T	14753.48	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	21990823	.	G	A	25116.64	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	21990849	.	C	T	925.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21990877	.	G	T	273.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21990914	.	T	G	999.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21991072	.	T	C	161134.88	PASS	AC=432;AF=0.26277;AN=1644;DS;set=Intersection
22	21991120	.	G	A	33238.60	PASS	AC=81;AF=0.04927;AN=1644;DS;set=Intersection
22	21991147	.	C	T	1139.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21991218	.	C	T	540.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21991224	.	C	T	26292.45	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	21991307	.	A	G	616.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21991350	.	T	C	7152.05	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	21996599	.	C	T	69.28	PASS	AC=5;AF=0.0064;AN=786;set=Intersection
22	21996653	.	G	C	101.69	PASS	AC=4;AF=0.00329;AN=1214;set=Intersection
22	21996722	.	G	A	783.97	PASS	AC=12;AF=0.00898;AN=1336;set=Intersection
22	21996847	.	A	G	35.63	PASS	AC=6;AF=0.00432;AN=1388;set=Intersection
22	21997104	.	T	G	342.65	PASS	AC=8;AF=0.00521;AN=1536;set=Intersection
22	21997128	.	G	A	213.34	PASS	AC=5;AF=0.00317;AN=1576;set=Intersection
22	21997156	.	G	A	46.95	PASS	AC=1;AF=0.00063;AN=1576;set=Intersection
22	21997251	.	C	G	89.89	PASS	AC=2;AF=0.00134;AN=1498;set=Intersection
22	21997326	.	G	A	52.95	PASS	AC=1;AF=0.00065;AN=1546;set=Intersection
22	21997385	.	C	T	112.88	PASS	AC=4;AF=0.00270;AN=1480;set=Intersection
22	21998169	.	C	G	142.81	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	21998215	.	C	T	242.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21998218	.	C	T	90.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21998219	.	G	A	3147.62	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	21998222	.	C	G	183.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21998280	.	G	A	2667.83	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	21998310	.	T	C	1659.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	21998346	.	G	A	725.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21998448	.	G	A	916.20	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	21998465	.	GTGTGTGGATGGA	G	1155.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21998469	.	G	A	830.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21998472	.	G	T	439.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	21998509	.	T	C	48435.79	PASS	AC=114;AF=0.06934;AN=1644;DS;set=Intersection
22	22020347	.	C	T	118.13	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	22024156	.	C	T	1451.37	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22024279	.	G	A	435.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22024281	.	T	C	880.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22024820	.	G	A	982.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22024868	.	A	G	1598.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22024887	.	T	C	10293.74	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	22024920	.	A	ACCTTTC	1376.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22025334	.	C	T	947.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22026654	.	A	G	525.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22026704	.	G	A	946.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22029451	.	A	G	351.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22035555	.	T	C	4262.61	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	22035664	.	C	T	17489.12	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	22035685	.	T	C	660.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22035694	.	C	T	126.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22036763	.	G	A	706.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22036768	.	C	T	678.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22036780	.	G	A	713.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22036792	.	C	A	23459.29	PASS	AC=64;AF=0.03893;AN=1644;DS;set=Intersection
22	22036812	.	C	T	150.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22036832	.	T	C	61973.71	PASS	AC=847;AF=0.51583;AN=1642;DS;set=Intersection
22	22037427	.	C	T	655.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22037524	.	T	C	811.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22037575	.	G	A	424.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22037580	.	G	A	854.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22039199	.	C	T	38727.68	PASS	AC=141;AF=0.08577;AN=1644;DS;set=Intersection
22	22039211	.	C	T	711.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22039212	.	G	A	557.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22039219	.	A	T	603.32	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22039222	.	C	T	635.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22040750	.	G	A	718.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22040792	.	G	A	4406.84	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22040828	.	G	A	381.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22040836	.	C	T	542.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22040884	.	A	T	515.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22041179	.	A	C	686.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22041275	.	G	A	322.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22041882	.	C	T	5470.95	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	22041889	.	T	TG	4546.41	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	22041982	.	C	T	768.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22042031	.	G	A	1976.52	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22042070	.	G	A	906.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22042318	.	C	T	55415.50	PASS	AC=141;AF=0.08577;AN=1644;DS;set=Intersection
22	22042319	.	G	A	982.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22042377	.	C	A	2493.50	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	22042430	.	T	G	1002.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22042440	.	C	T	47402.98	PASS	AC=190;AF=0.11557;AN=1644;DS;set=Intersection
22	22042975	.	G	A	1038.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22042999	.	C	T	5133.08	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	22048114	.	G	A	8936.63	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	22048856	.	G	A	947.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22048857	.	A	G	1503.70	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22048862	.	C	T	108164.28	PASS	AC=639;AF=0.38869;AN=1644;DS;set=Intersection
22	22048870	.	TC	T	1166.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22048900	.	C	T	776.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22048970	.	G	T	520.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22049017	.	C	T	780.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22049076	.	C	T	712.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22049099	.	A	G	1536.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22049119	.	G	A	4592.65	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22049127	.	C	T	1544.82	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	22049186	.	C	T	183.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22049230	.	C	T	337.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22049263	.	C	T	1677.57	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22049359	.	C	T	278.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22049369	.	G	T	18271.88	PASS	AC=144;AF=0.08759;AN=1644;DS;set=Intersection
22	22049397	.	T	A	805.08	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22049409	.	C	T	214.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22049783	.	C	T	81433.79	PASS	AC=619;AF=0.37652;AN=1644;DS;set=Intersection
22	22051133	.	G	A	296.82	PASS	AC=2;AF=0.00135;AN=1482;set=Intersection
22	22051197	.	A	ATGTC	285.62	PASS	AC=1;AF=0.00066;AN=1524;set=Intersection
22	22051204	.	C	T	2516.63	PASS	AC=21;AF=0.01387;AN=1514;set=Intersection
22	22051210	.	G	A	73.37	PASS	AC=1;AF=0.00066;AN=1524;set=Intersection
22	22055394	.	A	G	182670.47	PASS	AC=1103;AF=0.67092;AN=1644;DS;set=Intersection
22	22055412	.	C	T	14391.24	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	22055413	.	G	A	745.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22055539	.	A	G	846.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22057689	.	C	T	431.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22057804	.	G	GCCCGC	1604.73	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	22058098	.	G	A	4884.37	PASS	AC=39;AF=0.02375;AN=1642;DS;set=Intersection
22	22123573	.	A	G	645.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22123601	.	G	A	2573.79	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22123650	.	T	C	7715.14	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	22127165	.	G	A	8080.55	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	22127311	.	A	C	753.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22127317	.	A	G	5990.58	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	22142501	.	C	T	5871.90	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	22142664	.	G	C	605.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22142954	.	C	T	5680.74	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	22143123	.	G	A	1194.51	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22153439	.	A	G	4406.38	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	22153447	.	T	C	741.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22160095	.	G	A	1586.63	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22160151	.	G	A	2112.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22160214	.	A	G	963.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22160301	.	T	C	1035.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22161974	.	G	A	1346.86	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22162126	.	A	G	17050.24	PASS	AC=54;AF=0.03285;AN=1644;DS;set=Intersection
22	22221623	.	G	A	127.16	PASS	AC=1;AF=0.0012;AN=822;set=Intersection
22	22221680	.	C	T	166.50	PASS	AC=8;AF=0.0101;AN=790;set=Intersection
22	22277485	.	G	C	8681.32	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	22277521	.	G	A	1063.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22277571	.	A	C	35920.87	PASS	AC=142;AF=0.08637;AN=1644;DS;set=Intersection
22	22277631	.	C	T	119.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22277667	.	C	T	1299.36	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22277675	.	G	A	10249.95	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	22277784	.	G	A	573.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22277793	.	C	T	408.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22277794	.	G	A	1034.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22277813	.	C	G	276.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22277855	.	G	A	684.19	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22279929	.	C	T	2080.11	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22279958	.	G	T	18967.80	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	22279964	.	G	C	509.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22280051	.	C	T	445.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22285480	.	G	A	840.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22285616	.	C	T	2399.61	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22285632	.	G	A	3001.90	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	22287862	.	G	A	67423.90	PASS	AC=417;AF=0.25365;AN=1644;DS;set=Intersection
22	22287964	.	T	C	53823.14	PASS	AC=535;AF=0.32543;AN=1644;DS;set=Intersection
22	22287988	.	A	T	305.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22288383	.	C	T	129.80	PASS	AC=1;AF=0.00062;AN=1624;DS;set=Intersection
22	22288399	.	C	T	2971.91	PASS	AC=9;AF=0.00556;AN=1620;DS;set=Intersection
22	22288560	.	G	A	8021.87	PASS	AC=139;AF=0.08570;AN=1622;DS;set=Intersection
22	22293920	.	TTCC	T	1471.79	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	22293938	.	C	G	82.89	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22293944	.	C	T	2705.62	PASS	AC=12;AF=0.00731;AN=1642;DS;set=Intersection
22	22293959	.	C	T	347.21	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22300211	.	C	A	3085.02	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	22300253	.	G	A	1406.50	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22300280	.	C	T	625.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22300281	.	G	A	519.54	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22300364	.	G	T	322.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22300380	.	C	G	703.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22300436	.	G	T	787.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22313053	.	G	A	469	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22313069	.	C	T	698.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22313488	.	T	C	1119.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22313591	.	C	T	1638.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22313598	.	T	C	456.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22314027	.	C	T	798.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22314114	.	A	G	2803.36	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	22314659	.	C	T	368.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22314754	.	G	A	728.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22314817	.	C	T	868.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22314828	.	T	C	547.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22314844	.	G	C	661.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22314853	.	CTGCCTTGGACA	C	807.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22314868	.	C	T	201.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22316765	.	C	T	515.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22316792	.	C	T	1343.11	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	22316862	.	C	T	130.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22316863	.	G	A	296.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22316989	.	G	A	486.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22317008	.	A	G	147.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22317132	.	G	A	5060.12	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	22317154	.	A	G	1005.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22317165	.	A	C	629.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22317189	.	C	A	325.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22317256	.	G	A	359.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22318278	.	T	C	932.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22318346	.	C	T	1012.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22318354	.	T	C	5881.09	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	22318364	.	G	A	1306.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22318520	.	C	T	38517.80	PASS	AC=65;AF=0.03954;AN=1644;DS;set=Intersection
22	22318538	.	C	T	29841.37	PASS	AC=160;AF=0.09732;AN=1644;DS;set=Intersection
22	22318568	.	G	A	513.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22318617	.	C	T	724.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22318660	.	G	A	787.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22318671	.	G	A	28423.94	PASS	AC=140;AF=0.08516;AN=1644;DS;set=Intersection
22	22319665	.	G	A	446.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22319757	.	AG	A	12196.16	PASS	AC=77;AF=0.04684;AN=1644;DS;set=Intersection
22	22322138	.	G	A	31912.60	PASS	AC=162;AF=0.09854;AN=1644;DS;set=Intersection
22	22322985	.	A	G	1618.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22323003	.	C	A	1334.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22323019	.	G	A	856.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22323075	.	C	T	1916.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22323117	.	G	A	772.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22324542	.	A	AGTGAGG	21141.59	PASS	AC=155;AF=0.09428;AN=1644;DS;set=Intersection
22	22324544	.	T	TGAGGGG	18437.10	PASS	AC=151;AF=0.09185;AN=1644;DS;set=Intersection
22	22324549	.	G	A	201.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22324550	.	T	TGAGGGG	15223.41	PASS	AC=149;AF=0.09063;AN=1644;DS;set=Intersection
22	22324605	.	C	T	48.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22324698	.	G	A	998.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22324717	.	C	T	615.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22324761	.	C	T	92.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22324825	.	C	T	12639.32	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	22326241	.	A	G	8241.54	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	22326279	.	G	A	724.76	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22326300	.	G	A	1377.43	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	22326303	.	G	A	1642.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22326326	.	GC	G	19024.57	PASS	AC=102;AF=0.06204;AN=1644;DS;set=Intersection
22	22327135	.	C	T	2661.01	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22328829	.	C	T	486.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22329983	.	C	T	4622.09	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	22330000	.	G	A	827.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22330082	.	T	C	194828.74	PASS	AC=968;AF=0.58881;AN=1644;DS;set=Intersection
22	22330107	.	T	G	26906.70	PASS	AC=140;AF=0.08516;AN=1644;DS;set=Intersection
22	22599189	.	C	T	754.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22599215	.	A	G	54165.40	PASS	AC=177;AF=0.10766;AN=1644;DS;set=Intersection
22	22599216	.	T	C	57567.39	PASS	AC=177;AF=0.10766;AN=1644;DS;set=Intersection
22	22599294	.	A	C	16582.20	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	22599380	.	G	A	25886.48	PASS	AC=111;AF=0.06752;AN=1644;DS;set=Intersection
22	22599404	.	G	A	970.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22599424	.	G	A	2063.19	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22599537	.	G	A	17603.65	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	22599549	.	G	A	1635.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	22599666	.	G	T	183.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22599669	.	C	T	88.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22599670	.	G	A	200.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	22599674	.	C	T	51631.84	PASS	AC=238;AF=0.14477;AN=1644;DS;set=Intersection
22	22599676	.	C	T	1489.49	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	22599705	.	G	A	35592.52	PASS	AC=242;AF=0.14720;AN=1644;DS;set=Intersection
22	22599714	.	A	G	391.77	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22842170	.	T	C	404.81	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22842206	.	T	C	320805.15	PASS	AC=1380;AF=0.83942;AN=1644;DS;set=Intersection
22	22842308	.	G	C	427.72	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22842336	.	G	A	1214.93	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22842452	.	C	T	1315.25	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22842484	.	C	T	20300.87	PASS	AC=27;AF=0.01644;AN=1642;DS;set=Intersection
22	22842637	.	C	T	893.75	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22842660	.	G	A	1042.68	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22842787	.	C	T	888.01	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22842788	.	G	A	13852.91	PASS	AC=13;AF=0.00792;AN=1642;DS;set=Intersection
22	22842828	.	G	A	1178.79	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22842957	.	T	G	325700.81	PASS	AC=1395;AF=0.85061;AN=1640;DS;set=Intersection
22	22843002	.	TTTGGAAAAGCTG	T	1712.80	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22843118	.	C	T	308842.03	PASS	AC=1290;AF=0.78659;AN=1640;DS;set=Intersection
22	22843151	.	C	T	783.49	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22843190	.	G	A	1374.27	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22843191	.	A	G	931.91	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22843224	.	T	C	1205.50	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22843284	.	G	A	1082.29	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22843423	.	C	T	1259.32	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	22843469	.	T	C	1770.72	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	22843749	.	GT	G	944.86	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	22868306	.	G	A	3082.13	PASS	AC=6;AF=0.00366;AN=1638;DS;set=Intersection
22	22868316	.	G	A	12533.65	PASS	AC=46;AF=0.02805;AN=1640;DS;set=Intersection
22	22868413	.	G	A	1393.16	PASS	AC=3;AF=0.00183;AN=1640;DS;set=Intersection
22	22868493	.	G	T	222329.16	PASS	AC=896;AF=0.54568;AN=1642;DS;set=Intersection
22	22868497	.	G	C	231478.22	PASS	AC=895;AF=0.54507;AN=1642;DS;set=Intersection
22	22868570	.	G	A	717.99	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22868572	.	CA	C	1612.96	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	22868574	.	A	G	1453.08	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	22868592	.	TG	T	621.61	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22868692	.	C	A	810.85	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22869085	.	C	T	15797.85	PASS	AC=34;AF=0.02071;AN=1642;DS;set=Intersection
22	22869123	.	T	C	233164.01	PASS	AC=898;AF=0.54756;AN=1640;DS;set=Intersection
22	22869129	.	G	A	6754.72	PASS	AC=9;AF=0.00549;AN=1640;DS;set=Intersection
22	22869136	.	G	A	1250.71	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	22869170	.	T	G	928.99	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22869209	.	C	G	255313.45	PASS	AC=896;AF=0.54568;AN=1642;DS;set=Intersection
22	22869218	.	T	C	256933.83	PASS	AC=896;AF=0.54568;AN=1642;DS;set=Intersection
22	22869316	.	G	A	1691.06	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22869349	.	A	G	1938.07	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	22869439	.	A	G	25473.13	PASS	AC=44;AF=0.02683;AN=1640;DS;set=Intersection
22	22869470	.	G	C	1976.08	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22869477	.	C	T	1425.84	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	22869520	.	A	G	5242.68	PASS	AC=8;AF=0.00487;AN=1642;DS;set=Intersection
22	22869528	.	G	T	6520.07	PASS	AC=14;AF=0.00853;AN=1642;DS;set=Intersection
22	22869545	.	T	G	220990.08	PASS	AC=895;AF=0.54507;AN=1642;DS;set=Intersection
22	22869649	.	G	C	279352.96	PASS	AC=1081;AF=0.65834;AN=1642;DS;set=Intersection
22	22869684	.	T	G	830.39	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22869694	.	C	T	2022.82	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	22869742	.	C	A	252234.08	PASS	AC=897;AF=0.54629;AN=1642;DS;set=Intersection
22	22869877	.	A	G	2044.84	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	22869888	.	T	C	2009.51	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	22890461	.	G	T	2283.36	PASS	AC=4;AF=0.00244;AN=1638;DS;set=Intersection
22	22890486	.	C	T	1748.82	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	22890492	.	G	A	48681.34	PASS	AC=121;AF=0.07369;AN=1642;DS;set=Intersection
22	22890505	.	CAG	C	1275.20	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22890532	.	TAGA	T	606.84	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22890552	.	G	A	6728.82	PASS	AC=11;AF=0.00670;AN=1642;DS;set=Intersection
22	22890562	.	G	C	1680.46	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	22890593	.	G	A	448.99	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22890642	.	C	A	1414.95	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22890722	.	G	A	1051.99	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	22890752	.	A	G	47818.99	PASS	AC=153;AF=0.09318;AN=1642;DS;set=Intersection
22	22890756	.	A	G	18119.64	PASS	AC=18;AF=0.01096;AN=1642;DS;set=Intersection
22	22890792	.	T	C	44476.15	PASS	AC=154;AF=0.09379;AN=1642;DS;set=Intersection
22	22890869	.	C	T	2645.10	PASS	AC=7;AF=0.00427;AN=1640;DS;set=Intersection
22	22890903	.	C	G	1212.94	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22890933	.	G	A	8282.46	PASS	AC=4;AF=0.00244;AN=1638;DS;set=Intersection
22	22890941	.	T	G	1337.98	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22891014	.	C	T	990.29	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22891062	.	G	A	2060.06	PASS	AC=2;AF=0.00122;AN=1638;DS;set=Intersection
22	22891081	.	G	T	132107.35	PASS	AC=750;AF=0.45844;AN=1636;DS;set=Intersection
22	22892195	.	A	G	1689.26	PASS	AC=3;AF=0.00183;AN=1640;DS;set=Intersection
22	22892196	.	T	C	1226.45	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22892255	.	C	T	2768.44	PASS	AC=7;AF=0.00427;AN=1640;DS;set=Intersection
22	22892268	.	G	A	434.63	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22892303	.	G	A	468.79	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22892308	.	G	C	665.82	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22892314	.	G	A	757.58	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22892335	.	G	A	17523.79	PASS	AC=16;AF=0.00976;AN=1640;DS;set=Intersection
22	22892342	.	A	G	5773.12	PASS	AC=12;AF=0.00732;AN=1640;DS;set=Intersection
22	22892362	.	G	A	3042.94	PASS	AC=4;AF=0.00244;AN=1638;DS;set=Intersection
22	22892449	.	T	C	13875.39	PASS	AC=34;AF=0.02071;AN=1642;DS;set=Intersection
22	22892481	.	C	T	1853.90	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22892490	.	T	C	16896.64	PASS	AC=14;AF=0.00854;AN=1640;DS;set=Intersection
22	22892514	.	A	G	951.84	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22892556	.	A	G	1012.84	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22892615	.	A	G	813.82	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22892775	.	A	G	2398.59	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	22892800	.	T	G	1086.29	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	22893166	.	C	T	408.59	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22893196	.	G	A	928.54	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22893297	.	G	A	490.36	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22893335	.	G	A	844.33	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22893347	.	G	A	1169.11	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	22893392	.	C	G	8389.46	PASS	AC=11;AF=0.00671;AN=1640;DS;set=Intersection
22	22893394	.	A	T	6050.47	PASS	AC=17;AF=0.01037;AN=1640;DS;set=Intersection
22	22893403	.	C	T	461.32	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	22893404	.	G	A	1050.80	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22893410	.	G	T	237.07	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22893463	.	G	A,C,T	1714.81	PASS	AC=2,2,0;AF=0.00122,0.00122,0.00000;AN=1640;DS;set=Intersection
22	22893523	.	T	C	2498.61	PASS	AC=3;AF=0.00183;AN=1638;DS;set=Intersection
22	22899189	.	G	C	852.84	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	22899234	.	A	G	243022.20	PASS	AC=1103;AF=0.67174;AN=1642;DS;set=Intersection
22	23401684	.	G	T	3117.96	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	23401696	.	C	T	4402.41	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23401750	.	C	T	1735.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23401770	.	C	T	6747.44	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	23401775	.	C	T	886.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23401822	.	G	A	883.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23401865	.	G	T	6118.54	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	23401917	.	G	A	1164.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23401918	.	C	T	5292.90	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	23403947	.	G	A	1297.76	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23403967	.	G	A	35709.61	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	23403976	.	C	T	2220.76	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	23404038	.	C	T	1945.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23406059	.	C	G	733.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23406099	.	G	A	2332.66	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	23406103	.	G	A	1337.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23406130	.	G	A	1551.64	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23406180	.	C	G	259.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23406182	.	G	A	2618.95	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	23406302	.	T	C	891.44	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23406339	.	C	A	318.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23406340	.	G	A	741.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23437944	.	G	A	969.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23438116	.	C	T	7232.64	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	23438191	.	C	T	111784.14	PASS	AC=458;AF=0.27859;AN=1644;DS;set=Intersection
22	23438192	.	G	T	779.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23438193	.	C	T	512.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23438340	.	C	T	411.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23438431	.	G	T	2244.78	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23438488	.	G	C	1648.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23438506	.	G	A	7055.21	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23438536	.	C	T	11204.90	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	23438569	.	C	T	5519.29	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	23438648	.	G	T	1036.33	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	23465238	.	C	T	666.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23465507	.	G	A	875.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23465631	.	G	A	1331.79	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	23476202	.	C	T	1631	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23476261	.	G	A	652.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23476266	.	A	G	723.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23476358	.	A	G	1795.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23481065	.	G	A	61.25	PASS	AC=1;AF=0.00064;AN=1562;DS;set=Intersection
22	23481102	.	A	G	45.60	PASS	AC=1;AF=0.00065;AN=1550;DS;set=Intersection
22	23481133	.	GAA	G,GA	23007.84	PASS	AC=487,244;AF=0.31623,0.15844;AN=1540;DS;set=Intersection
22	23481144	.	A	AC	617.28	PASS	AC=3;AF=0.00194;AN=1546;DS;set=Intersection
22	23481146	.	A	C	1095.08	PASS	AC=2;AF=0.00130;AN=1540;DS;set=Intersection
22	23482445	.	G	A	579.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23482460	.	A	G	174354.35	PASS	AC=855;AF=0.52007;AN=1644;DS;set=Intersection
22	23482482	.	C	T	4120.73	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	23482483	.	G	A	37289.89	PASS	AC=128;AF=0.07786;AN=1644;DS;set=Intersection
22	23482626	.	G	T	834.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23482646	.	G	A	125.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23487533	.	C	T	33052.89	PASS	AC=157;AF=0.09585;AN=1638;DS;set=Intersection
22	23487656	.	T	A	565.53	PASS	AC=4;AF=0.00245;AN=1634;DS;set=Intersection
22	23487701	.	C	T	2009.01	PASS	AC=7;AF=0.00427;AN=1638;DS;set=Intersection
22	23487711	.	G	T	374.44	PASS	AC=2;AF=0.00123;AN=1630;DS;set=Intersection
22	23488775	.	C	A	4498.81	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	23488859	.	C	T	2294.55	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	23488888	.	G	A	771.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23492212	.	T	G	1239.62	PASS	AC=4;AF=0.00244;AN=1636;DS;set=Intersection
22	23492216	.	A	G	676.40	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	23492236	.	C	T	100255.51	PASS	AC=720;AF=0.43902;AN=1640;DS;set=Intersection
22	23492257	.	C	T	818.03	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	23492286	.	C	G	1014.14	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	23492298	.	C	T	254.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23492320	.	G	A	1215.15	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	23494619	.	C	T	4542.23	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	23494620	.	G	A	668.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23494622	.	C	T	5441.81	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23494651	.	C	T	1585.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23495216	.	A	G	947.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23495247	.	C	G	2265.22	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23495285	.	G	A	915.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23498189	.	A	G	96.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23498262	.	G	A	995.41	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	23500227	.	CCA	C	1478.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23501056	.	ATCTC	A	769.33	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23501211	.	G	A	701.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23501315	.	C	T	534.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23501320	.	C	T	2734.79	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23501321	.	G	A	175.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23501346	.	C	T	331.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23501373	.	C	T	53.62	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	23503045	.	G	A	623.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23503082	.	A	T	2092.68	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	23503121	.	G	A	93066.38	PASS	AC=433;AF=0.26338;AN=1644;DS;set=Intersection
22	23503155	.	C	T	16126.32	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	23503170	.	A	G	135316.70	PASS	AC=874;AF=0.53163;AN=1644;DS;set=Intersection
22	23503205	.	G	C	115877.53	PASS	AC=874;AF=0.53163;AN=1644;DS;set=Intersection
22	23503651	.	C	T	62074.95	PASS	AC=873;AF=0.53167;AN=1642;DS;set=Intersection
22	23503706	.	C	T	199.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23503707	.	G	A	190.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23503756	.	G	A	61705.69	PASS	AC=871;AF=0.53045;AN=1642;DS;set=Intersection
22	23523139	.	G	A	543.05	PASS	AC=17;AF=0.01218;AN=1396;set=Intersection
22	23523218	.	A	G	68.83	PASS	AC=1;AF=0.00065;AN=1544;set=Intersection
22	23523219	.	G	A	102.94	PASS	AC=2;AF=0.00129;AN=1550;set=Intersection
22	23523309	.	C	T	1010.39	PASS	AC=15;AF=0.00953;AN=1574;set=Intersection
22	23523540	.	C	A	73.09	PASS	AC=1;AF=0.00077;AN=1294;set=Intersection
22	23523550	.	G	A	154.13	PASS	AC=1;AF=0.00073;AN=1366;DS;set=Intersection
22	23523602	.	C	T	944.06	PASS	AC=8;AF=0.00506;AN=1582;DS;set=Intersection
22	23523617	.	A	T	340.33	PASS	AC=1;AF=0.00062;AN=1622;DS;set=Intersection
22	23523630	.	C	A	40254.73	PASS	AC=491;AF=0.30384;AN=1616;DS;set=Intersection
22	23523644	.	G	A	506.60	PASS	AC=3;AF=0.00185;AN=1618;DS;set=Intersection
22	23523702	.	G	C	653.43	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	23523753	.	C	T	5040.11	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	23523969	.	G	A	10562.25	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	23523972	.	G	A	188.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23524052	.	C	G	178.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23524069	.	C	T	296.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23524083	.	C	A	403.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23524111	.	G	C	98.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23524265	.	A	G	238.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23524289	.	G	A	171.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23524386	.	C	G	62.54	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	23524402	.	G	A	283.94	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	23524414	.	C	T	60.01	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	23524466	.	G	T	761.67	PASS	AC=9;AF=0.00549;AN=1638;set=Intersection
22	23524470	.	AG	A	112.71	PASS	AC=1;AF=0.00061;AN=1638;set=Intersection
22	23595996	.	C	T	1749.72	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23596073	.	T	C	251.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23596134	.	G	A	1485.80	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23596167	.	G	A	446.71	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23603272	.	G	A	3208.35	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23603559	.	A	G	688.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23603684	.	A	G	578.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23603727	.	G	A	1073.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23603744	.	C	T	1429.91	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23603746	.	G	A	2252.09	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	23603775	.	G	A	2726.52	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	23610564	.	G	GTCCCACTCTCTCTTCCTTCC	3959.91	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	23610624	.	C	T	993.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23610645	.	C	A	787.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23615254	.	C	A	663.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23615346	.	G	A	17762.61	PASS	AC=72;AF=0.04380;AN=1644;DS;set=Intersection
22	23615801	.	A	G	17275.17	PASS	AC=102;AF=0.06204;AN=1644;DS;set=Intersection
22	23615940	.	C	T	818.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23615946	.	G	A	9559.75	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	23615971	.	G	C	812.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23615982	.	C	T	172.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23626134	.	C	T	1182.46	PASS	AC=21;AF=0.01284;AN=1636;set=Intersection
22	23626157	.	C	A	397.37	PASS	AC=4;AF=0.00244;AN=1638;set=Intersection
22	23626202	.	G	T	125.80	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	23626230	.	G	A	305.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23627171	.	C	T	785.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23627173	.	T	C	623.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23627225	.	C	T	224.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23627238	.	C	A	12408.71	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	23627249	.	A	G	946.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23627256	.	G	A	9590.50	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	23627369	.	A	G	201143.37	PASS	AC=1293;AF=0.78650;AN=1644;DS;set=Intersection
22	23629306	.	C	T	2802.39	PASS	AC=5;AF=0.00310;AN=1612;DS;set=Intersection
22	23629372	.	G	A	186.05	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	23629472	.	G	T	4281.89	PASS	AC=7;AF=0.00440;AN=1590;DS;set=Intersection
22	23629476	.	G	C	13909.84	PASS	AC=116;AF=0.07277;AN=1594;DS;set=Intersection
22	23630236	.	C	G	14518.04	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	23630243	.	A	G	1336.30	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23630313	.	T	C	4570.80	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23630399	.	C	T	7274.31	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	23631657	.	C	G	1755.85	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23631801	.	T	C	105804.85	PASS	AC=464;AF=0.28224;AN=1644;DS;set=Intersection
22	23631813	.	G	GC	59190.26	PASS	AC=466;AF=0.28345;AN=1644;DS;set=Intersection
22	23631823	.	T	C	83400.36	PASS	AC=464;AF=0.28224;AN=1644;DS;set=Intersection
22	23631855	.	G	A	7215.69	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	23632513	.	A	G	213119.75	PASS	AC=456;AF=0.27737;AN=1644;DS;set=Intersection
22	23632547	.	A	G	21978.12	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	23632621	.	G	C	87493.56	PASS	AC=269;AF=0.16363;AN=1644;DS;set=Intersection
22	23632636	.	C	A	104792.38	PASS	AC=371;AF=0.22567;AN=1644;DS;set=Intersection
22	23634713	.	C	T	4480.71	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23634753	.	T	C	705.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23634790	.	G	A	1704.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	23634822	.	C	T	996.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23634851	.	C	T	445.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23637186	.	C	T	907.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23637190	.	C	T	1302.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23637200	.	T	C	120967.71	PASS	AC=512;AF=0.31144;AN=1644;DS;set=Intersection
22	23637379	.	A	C	99.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23655217	.	T	TGAA	737.48	PASS	AC=26;AF=0.01587;AN=1638;DS;set=Intersection
22	23656148	.	T	G	89761.91	PASS	AC=213;AF=0.12956;AN=1644;DS;set=Intersection
22	23656199	.	C	T	640.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23656287	.	A	G	739.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23656308	.	G	A	724.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23656703	.	C	T	9025.81	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	23656704	.	G	A	657.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23656718	.	C	T	1546.40	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	23656915	.	G	A	1625.73	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23657571	.	G	A	186.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23657595	.	T	C	1395.28	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	23657604	.	T	C	1609.26	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	23657613	.	C	T	14412.58	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	23657664	.	C	T	2295.45	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	23657667	.	G	A	794.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23657700	.	C	T	687.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23657722	.	A	G	788.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23657735	.	G	A	95365.52	PASS	AC=749;AF=0.45560;AN=1644;DS;set=Intersection
22	23915429	.	T	G	1162.74	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	23915440	.	C	G	1760.36	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	23915529	.	C	T	39095.66	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	23915546	.	G	A	22921.41	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	23915588	.	G	A	23253.82	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	23915652	.	G	A	58218.98	PASS	AC=222;AF=0.13504;AN=1644;DS;set=Intersection
22	23915672	.	A	G	1024.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23917123	.	T	A	438.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23917167	.	C	T	4410.58	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	23917176	.	G	A	20952.37	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	23917217	.	AC	A	643.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	23917253	.	C	T	767.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23917281	.	G	T	681.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	23922138	.	A	AC	115.93	PASS	AC=1;AF=0.00062;AN=1604;set=Intersection
22	23922276	.	T	C	44.43	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	23922281	.	C	T	1461.74	PASS	AC=31;AF=0.01902;AN=1630;set=Intersection
22	23922311	.	G	A	38.68	PASS	AC=3;AF=0.00187;AN=1606;set=Intersection
22	23955464	.	G	A	13538.54	PASS	AC=23;AF=0.01758;AN=1308;DS;set=Intersection
22	23955509	.	G	C	18932.98	PASS	AC=27;AF=0.02103;AN=1284;DS;set=Intersection
22	23955561	.	C	T	797.50	PASS	AC=5;AF=0.00411;AN=1216;DS;set=Intersection
22	23955797	.	C	T	682.50	PASS	AC=1;AF=0.00082;AN=1226;DS;set=Intersection
22	23955895	.	C	T	429.39	PASS	AC=2;AF=0.00169;AN=1186;DS;set=Intersection
22	23956322	.	G	A	1963.03	PASS	AC=7;AF=0.00504;AN=1390;DS;set=Intersection
22	23956340	.	T	A	770.69	PASS	AC=1;AF=0.00070;AN=1420;DS;set=Intersection
22	23956437	.	G	C	5200.74	PASS	AC=7;AF=0.00479;AN=1460;DS;set=Intersection
22	23956448	.	C	G	507.23	PASS	AC=1;AF=0.00069;AN=1444;DS;set=Intersection
22	23959054	.	G	A	2852.83	PASS	AC=4;AF=0.00341;AN=1174;DS;set=Intersection
22	23959878	.	GT	G	416.38	PASS	AC=5;AF=0.00336;AN=1488;DS;set=Intersection
22	23961519	.	C	T	292.27	PASS	AC=1;AF=0.00082;AN=1226;DS;set=Intersection
22	23961521	.	C	A	795.41	PASS	AC=1;AF=0.00081;AN=1228;DS;set=Intersection
22	23961522	.	AATACT	A	1193.22	PASS	AC=1;AF=0.00081;AN=1232;DS;set=Intersection
22	23961597	.	A	G	942.14	PASS	AC=1;AF=0.00080;AN=1246;DS;set=Intersection
22	23962744	.	T	TTTC	244263.32	PASS	AC=387;AF=0.30911;AN=1252;DS;set=Intersection
22	23962789	.	C	T	11980.74	PASS	AC=12;AF=0.00982;AN=1222;DS;set=Intersection
22	23962809	.	C	T	971.76	PASS	AC=1;AF=0.00081;AN=1242;DS;set=Intersection
22	23964272	.	T	C	2153.17	PASS	AC=2;AF=0.00145;AN=1376;DS;set=Intersection
22	23964335	.	T	C	898.39	PASS	AC=1;AF=0.00071;AN=1400;DS;set=Intersection
22	23967056	.	T	C	727.89	PASS	AC=1;AF=0.00083;AN=1212;DS;set=Intersection
22	23967068	.	A	G	1065.37	PASS	AC=1;AF=0.00083;AN=1212;DS;set=Intersection
22	23967074	.	G	A	1949.03	PASS	AC=3;AF=0.00248;AN=1212;DS;set=Intersection
22	23967105	.	AAAG	A	965.26	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	23968141	.	T	C	640.46	PASS	AC=1;AF=0.00077;AN=1298;DS;set=Intersection
22	23973974	.	AG	A	782.33	PASS	AC=1;AF=0.00074;AN=1356;DS;set=Intersection
22	23973994	.	C	CT	11965.18	PASS	AC=21;AF=0.01586;AN=1324;DS;set=Intersection
22	23974182	.	T	C	7025.32	PASS	AC=10;AF=0.00711;AN=1406;DS;set=Intersection
22	23974200	.	A	G	38055.55	PASS	AC=241;AF=0.17239;AN=1398;DS;set=Intersection
22	23974244	.	G	A	143.59	PASS	AC=1;AF=0.00074;AN=1356;DS;set=Intersection
22	24034244	.	T	C	26359.93	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	24034288	.	A	G	199928.56	PASS	AC=930;AF=0.56569;AN=1644;DS;set=Intersection
22	24034292	.	C	T	5987.94	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24034299	.	G	A	752.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034304	.	G	C	1053.51	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24034322	.	A	G	1029.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034326	.	C	T	118899.33	PASS	AC=110;AF=0.06691;AN=1644;DS;set=Intersection
22	24034330	.	C	T	896.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034331	.	G	A	943.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24034353	.	T	C	1010.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034545	.	A	G	713.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034573	.	C	T	1026.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034574	.	T	C	1127.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034602	.	G	A	979.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24034628	.	T	A	598.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034671	.	T	C	1741.48	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24034706	.	A	G	1785.76	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24034747	.	G	A	1179.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24034868	.	G	A	798.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034881	.	C	A	650.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034896	.	G	A	791.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034912	.	C	T	288.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034939	.	G	C	578.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034948	.	C	A	967.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034949	.	C	A	966.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24034989	.	T	C	940.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24035001	.	G	GCCAGCACCAGCA	911	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24035085	.	T	C	868.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24035129	.	C	T	6458.20	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	24035130	.	G	C	778.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24035177	.	C	T	211.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24035215	.	C	A	2657.80	PASS	AC=20;AF=0.01218;AN=1642;DS;set=Intersection
22	24035907	.	A	G	7657	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	24035970	.	C	T	293016.03	PASS	AC=1245;AF=0.75730;AN=1644;DS;set=Intersection
22	24036000	.	G	C	1005.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24036013	.	G	A	325	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24036040	.	G	A	911.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24036111	.	A	C	419.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24036138	.	G	A	7976.48	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	24036155	.	G	A	170.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24036186	.	T	C	961.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24036204	.	G	A	721.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24036563	.	G	A	77013.39	PASS	AC=233;AF=0.14173;AN=1644;DS;set=Intersection
22	24036575	.	C	T	1590.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24036657	.	T	C	64614.42	PASS	AC=279;AF=0.16971;AN=1644;DS;set=Intersection
22	24037094	.	CCT	C	1666.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24037096	.	T	C	963.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24037130	.	C	T	677.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24037150	.	G	C	834.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24037178	.	C	T	637.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24037193	.	A	T	6358.46	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24037199	.	T	G	652.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24038779	.	C	A	99.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24038780	.	C	T	172.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24038781	.	C	T	165.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24038786	.	G	A	186.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24038809	.	C	T	159.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24038835	.	A	ACC	171.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24038847	.	T	C	159177.32	PASS	AC=1235;AF=0.75122;AN=1644;DS;set=Intersection
22	24038894	.	T	G	163.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24039351	.	G	A	1945.82	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24039353	.	C	T	916.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24039380	.	A	T	698.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24039410	.	C	T	5916.20	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	24040008	.	C	T	1081.48	PASS	AC=3;AF=0.00183;AN=1640;DS;set=Intersection
22	24040070	.	G	A	252.55	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24040405	.	C	G	258.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24040475	.	T	C	467.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24040507	.	A	G	629.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24040545	.	G	A	404.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24041012	.	C	A	262.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24041036	.	A	C	248.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24041056	.	C	T	1248.10	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24041062	.	A	G	1335.50	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24085976	.	G	C	8327.07	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24085990	.	T	C	1986.84	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24086026	.	C	T	15525.19	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	24086055	.	C	T	1260.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24086107	.	A	G	278905.16	PASS	AC=886;AF=0.53893;AN=1644;DS;set=Intersection
22	24086195	.	G	A	1032.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24086257	.	G	T	938.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24086348	.	C	T	1788.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24086454	.	T	G	12645.97	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	24086640	.	C	T	1952.21	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24086754	.	C	T	1105.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24086859	.	G	A	727.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24086905	.	C	T	20027.19	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	24086939	.	G	T	1008.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24086944	.	G	A	8688.78	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24087013	.	C	T	1082.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24087030	.	C	T	6548.12	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24087115	.	T	C	1029.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24087118	.	G	A	8728.05	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24087185	.	T	C	8452.48	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24087231	.	C	T	781.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24087235	.	C	T	1031.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24087319	.	A	C	73418.86	PASS	AC=299;AF=0.18187;AN=1644;DS;set=Intersection
22	24087341	.	T	C	6638.18	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24087350	.	A	G	735.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24087363	.	T	C	1077.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24095103	.	G	A	803.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24095119	.	G	A	717.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24095127	.	C	G	940.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24095199	.	C	T	466.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24095221	.	G	A	4312.10	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	24095278	.	C	T	868.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24095296	.	C	T	1653.20	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24095313	.	G	T	1127.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24095337	.	C	T	1689.23	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24095350	.	G	T	566.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24095351	.	C	T	504.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24095406	.	C	G	323.62	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	24096464	.	C	T	23318.84	PASS	AC=136;AF=0.08293;AN=1640;DS;set=Intersection
22	24096541	.	G	A	22008.22	PASS	AC=68;AF=0.04136;AN=1644;DS;set=Intersection
22	24096578	.	G	A	63.08	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	24106795	.	GTGTCCTTCATCGTC	G	1432.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24106989	.	G	A	840.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24107034	.	G	A	5283.10	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	24108183	.	C	T	89.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24108238	.	C	T	3040.21	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24108282	.	C	T	903.87	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24108288	.	C	G	113892.98	PASS	AC=1286;AF=0.78224;AN=1644;DS;set=Intersection
22	24108303	.	C	A	529.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24108394	.	C	T	184.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24108412	.	G	A	88980.94	PASS	AC=1286;AF=0.78224;AN=1644;DS;set=Intersection
22	24108438	.	G	T	9758.13	PASS	AC=69;AF=0.04296;AN=1606;DS;set=Intersection
22	24109550	.	T	C	55140.56	PASS	AC=1427;AF=0.87225;AN=1636;set=Intersection
22	24109633	.	G	A	31.76	PASS	AC=1;AF=0.00065;AN=1528;set=Intersection
22	24109686	.	C	A	187.93	PASS	AC=5;AF=0.00334;AN=1496;set=Intersection
22	24109975	.	A	C	2505.48	PASS	AC=54;AF=0.03413;AN=1582;set=Intersection
22	24121378	.	C	T	37067.23	PASS	AC=1274;AF=0.77873;AN=1636;set=Intersection
22	24121395	.	G	A	344.40	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	24121441	.	C	T	91.10	PASS	AC=3;AF=0.00184;AN=1634;set=Intersection
22	24121447	.	C	T	305.20	PASS	AC=4;AF=0.00244;AN=1638;set=Intersection
22	24121459	.	C	T	214.87	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	24121521	.	T	C	840.60	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	24121539	.	C	T	97.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24121571	.	C	T	297.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24121626	.	C	T	366.12	PASS	AC=3;AF=0.00183;AN=1636;DS;set=Intersection
22	24122499	.	G	A	77429.75	PASS	AC=627;AF=0.38139;AN=1644;DS;set=Intersection
22	24122582	.	G	C	403.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24122653	.	A	C	373.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24122750	.	C	T	1890.61	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	24122877	.	G	A	2130.34	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	24123011	.	G	A	788.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24123185	.	C	T	1039.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24123376	.	C	A	3173.88	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	24123521	.	C	T	148.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24123563	.	G	C	842.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24123621	.	C	G	482.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24124459	.	C	T	2768.85	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24124468	.	C	T	998.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24124471	.	C	A	12719.27	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	24124492	.	C	T	525.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24125565	.	G	A	216245.20	PASS	AC=1430;AF=0.86983;AN=1644;DS;set=Intersection
22	24125617	.	C	T	392.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24125689	.	T	C	11928.22	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	24129326	.	C	T	181.73	PASS	AC=2;AF=0.00122;AN=1638;DS;set=Intersection
22	24129493	.	G	C	1291.37	PASS	AC=13;AF=0.00800;AN=1624;DS;set=Intersection
22	24133903	.	G	A	796.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24135703	.	A	T	1492.51	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24135722	.	C	G	1572.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24135750	.	C	T	821.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24135882	.	C	T	9835.14	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	24135917	.	G	T	2086.56	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24143185	.	C	G	738.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24143206	.	A	G	1889.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24145459	.	T	G	5739.50	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24145622	.	C	T	517.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24158908	.	C	G	604.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24158936	.	C	A	797.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24167513	.	G	A	38578.17	PASS	AC=134;AF=0.08151;AN=1644;DS;set=Intersection
22	24167594	.	C	T	358.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24175746	.	C	T	729.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24175759	.	C	T	1948.23	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24175888	.	G	A	3016.20	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24176287	.	G	A	10268.47	PASS	AC=162;AF=0.10075;AN=1608;DS;set=Intersection
22	24176298	.	G	A	469.46	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	24176340	.	T	C	59.25	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	24177094	.	C	T	1645.60	PASS	AC=6;AF=0.00455;AN=1318;DS;set=Intersection
22	24179010	.	G	A	1112.33	PASS	AC=3;AF=0.00188;AN=1598;DS;set=Intersection
22	24179038	.	C	T	35.87	PASS	AC=1;AF=0.00062;AN=1604;DS;set=Intersection
22	24179051	.	G	A	532.16	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	24179066	.	G	A	2380.80	PASS	AC=6;AF=0.00368;AN=1630;DS;set=Intersection
22	24179132	.	G	A	49729.05	PASS	AC=297;AF=0.18066;AN=1644;DS;set=Intersection
22	24179176	.	C	G	4260.58	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24179326	.	T	A	113.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24179334	.	C	T	526.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24179357	.	G	A	810.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24179819	.	G	A	6321.75	PASS	AC=48;AF=0.02920;AN=1644;set=Intersection
22	24179872	.	C	T	409.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24179922	.	G	C	43630.44	PASS	AC=219;AF=0.13321;AN=1644;DS;set=Intersection
22	24179952	.	C	T	821.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24179956	.	C	A	2142.28	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24180049	.	A	T	28113.21	PASS	AC=77;AF=0.04684;AN=1644;DS;set=Intersection
22	24180065	.	G	A	415.39	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24180091	.	G	GC	366.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24180581	.	G	C	2177.24	PASS	AC=12;AF=0.00731;AN=1642;DS;set=Intersection
22	24180588	.	C	G	704.59	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	24180674	.	G	GT	310.79	PASS	AC=2;AF=0.00123;AN=1630;DS;set=Intersection
22	24180703	.	C	T	235.90	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	24180746	.	G	A	57.90	PASS	AC=1;AF=0.00061;AN=1630;DS;set=Intersection
22	24181162	.	C	T	80.59	PASS	AC=1;AF=0.00064;AN=1554;set=Intersection
22	24181166	.	C	A	55.16	PASS	AC=1;AF=0.00065;AN=1550;set=Intersection
22	24199110	.	C	A	1451.53	PASS	AC=13;AF=0.00957;AN=1358;set=Intersection
22	24199137	.	C	A	39	PASS	AC=2;AF=0.00148;AN=1352;DS;set=Intersection
22	24199193	.	C	A	489.37	PASS	AC=1;AF=0.00078;AN=1286;DS;set=Intersection
22	24199704	.	C	T	19155.25	PASS	AC=129;AF=0.07847;AN=1644;DS;set=Intersection
22	24199764	.	AC	A,ACC	3082.36	PASS	AC=562,316;AF=0.36118,0.20308;AN=1556;DS;set=Intersection
22	24199766	.	C	CCT	1899.09	PASS	AC=29;AF=0.01847;AN=1570;DS;set=Intersection
22	24200164	.	C	G	535.11	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	24200243	.	C	T	959.84	PASS	AC=1;AF=0.00062;AN=1606;DS;set=Intersection
22	24204278	.	C	T	1930.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24204293	.	TCAGGG	T	1025.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24204310	.	T	A	652.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24204322	.	GC	G	2473.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24204382	.	C	T	937.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24204383	.	G	A	969.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24204422	.	G	C	1009.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24204438	.	G	T	10350.57	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	24210626	.	C	T	1856.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24210694	.	A	G	967.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24210725	.	G	A	2496.95	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24210736	.	C	T	673.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24210816	.	T	C	355.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24210822	.	T	G	757.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24210844	.	A	G	704.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24217275	.	C	T	8974.05	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	24217449	.	A	G	53705.50	PASS	AC=301;AF=0.18309;AN=1644;DS;set=Intersection
22	24219200	.	T	C	2615.83	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24219233	.	G	A	697.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24219864	.	C	G	139.90	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	24220011	.	C	T	171.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24220044	.	G	A	699.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24220053	.	G	C	2166.79	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	24224654	.	C	CA	2089.86	PASS	AC=266;AF=0.16584;AN=1604;set=Intersection
22	24224655	.	G	A	15469.22	PASS	AC=518;AF=0.32416;AN=1598;set=Intersection
22	24224659	.	C	A	11289.15	PASS	AC=516;AF=0.33463;AN=1542;set=Intersection
22	24224668	.	C	T	128.16	PASS	AC=4;AF=0.00254;AN=1574;set=Intersection
22	24224709	.	G	A	184.87	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	24224736	.	G	A	85.73	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	24224826	.	A	G	82.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24224973	.	C	T	1002.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24224974	.	G	A	5542.22	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	24225044	.	G	A	583.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24225971	.	G	A	1000.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24226131	.	G	A	783.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24226242	.	A	G	165312.29	PASS	AC=1160;AF=0.70560;AN=1644;DS;set=Intersection
22	24226251	.	TAGA	T	471.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24226449	.	A	G	7422.72	PASS	AC=33;AF=0.02010;AN=1642;DS;set=Intersection
22	24226520	.	G	C	5810.81	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	24226573	.	G	A	578.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24226584	.	A	T	11274.01	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	24226620	.	G	T	1437.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24226633	.	C	T	1491.92	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24226652	.	G	A	887.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24226801	.	A	C	35585.98	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	24226890	.	G	A	20182.15	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	24226950	.	A	G	33480.30	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	24227053	.	A	G	18164.03	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	24227054	.	G	T	18521.86	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	24227071	.	T	C	5606	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	24236638	.	G	A	2474.49	PASS	AC=10;AF=0.00613;AN=1632;set=Intersection
22	24236666	.	C	G	49.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24236685	.	C	T	67.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24236708	.	C	T	583.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24236819	.	T	C	8879.49	PASS	AC=317;AF=0.19448;AN=1630;set=Intersection
22	24237108	.	G	A	36.79	PASS	AC=2;AF=0.00145;AN=1384;set=Intersection
22	24237189	.	C	T	1326.17	PASS	AC=80;AF=0.06006;AN=1332;set=Intersection
22	24237217	.	C	T	63.43	PASS	AC=1;AF=0.00066;AN=1518;set=Intersection
22	24237218	.	C	T	178.37	PASS	AC=7;AF=0.00460;AN=1522;set=Intersection
22	24237220	.	C	A	265.18	PASS	AC=4;AF=0.00261;AN=1530;set=Intersection
22	24237221	.	C	G	7301.19	PASS	AC=258;AF=0.16732;AN=1542;set=Intersection
22	24237283	.	C	T	464.56	PASS	AC=2;AF=0.00126;AN=1584;set=Intersection
22	24237303	.	G	A	193.84	PASS	AC=3;AF=0.00193;AN=1556;set=Intersection
22	24313449	.	G	C	1371.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24313457	.	T	TAAACATCAGACAGCAGCCCTGAAGATGG	22855.29	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	24313483	.	C	T	1939.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24313484	.	G	A	1120.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24313530	.	GGA	G	7273.62	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	24313802	.	G	A	892.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24313856	.	T	C	8011.16	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	24323153	.	AAGG	A	675.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24376817	.	C	T	563.03	PASS	AC=1;AF=0.00083;AN=1204;DS;set=Intersection
22	24376845	.	C	T	37286.62	PASS	AC=60;AF=0.04983;AN=1204;DS;set=Intersection
22	24376865	.	T	A	750.79	PASS	AC=1;AF=0.00083;AN=1202;DS;set=Intersection
22	24376939	.	C	T	586.49	PASS	AC=1;AF=0.00083;AN=1206;DS;set=Intersection
22	24377034	.	A	G	166745.68	PASS	AC=973;AF=0.80814;AN=1204;DS;set=Intersection
22	24379392	.	C	T	540.76	PASS	AC=1;AF=0.00084;AN=1194;DS;set=Intersection
22	24379402	.	T	G	1745.36	PASS	AC=6;AF=0.00503;AN=1194;DS;set=Intersection
22	24379411	.	A	G	562.53	PASS	AC=2;AF=0.00167;AN=1198;DS;set=Intersection
22	24379487	.	C	T	1653.14	PASS	AC=4;AF=0.00333;AN=1200;DS;set=Intersection
22	24381773	.	C	T	762.86	PASS	AC=2;AF=0.00164;AN=1216;DS;set=Intersection
22	24381811	.	G	A	3213.72	PASS	AC=8;AF=0.00666;AN=1202;DS;set=Intersection
22	24384219	.	G	A	7680.69	PASS	AC=21;AF=0.01741;AN=1206;DS;set=Intersection
22	24431941	.	G	A	1219.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24432541	.	G	A	1154.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24434748	.	A	G	1711.43	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24434779	.	C	T	778.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24434850	.	C	T	451.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24434944	.	T	A	674.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24434951	.	T	C	688.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24437588	.	C	A	574.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24437770	.	G	A	514.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24439328	.	GTGTGTGTGTGTT	G	1251.15	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	24439338	.	GTT	G	1688.55	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	24439560	.	T	TGA	891.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24439576	.	G	A	929.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24445555	.	T	A	646.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24447272	.	C	T	15529.93	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	24447303	.	G	A	30963.25	PASS	AC=52;AF=0.03163;AN=1644;DS;set=Intersection
22	24447387	.	C	T	813.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24447436	.	C	T	1055.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24447470	.	C	T	444.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24451381	.	C	T	2980.71	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24451389	.	G	A	1175.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24451399	.	A	G	709.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24451432	.	G	A	888.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24451450	.	C	T	755.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24451454	.	C	T	607.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24451504	.	C	A	9986.56	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	24451580	.	C	T	561.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24451612	.	C	T	1081.70	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24452809	.	G	A	797.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24452833	.	A	G	1968.36	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24455661	.	A	C	768.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24455841	.	G	A	1417	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24456359	.	A	G	1228.17	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24456473	.	G	A	5800.49	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24456512	.	G	A	262.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24456518	.	G	A	682.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24458502	.	T	C	442.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24459401	.	C	T	20907.41	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	24459438	.	T	C	399621.38	PASS	AC=1546;AF=0.94039;AN=1644;DS;set=Intersection
22	24459474	.	C	T	760.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24459511	.	C	T	536.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24459522	.	C	T	1055.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24459652	.	C	T	710.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24459656	.	C	T	806.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24460450	.	TAGTC	T	1466.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24460548	.	C	A	2353.16	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24460560	.	C	T	1016.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24460593	.	A	C	38444.60	PASS	AC=57;AF=0.03467;AN=1644;DS;set=Intersection
22	24460606	.	C	T	696.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24463123	.	T	G	16026.71	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	24466964	.	C	T	1536.25	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24466967	.	G	A	324.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24467022	.	C	T	716.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24468346	.	C	G	1662.43	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24468386	.	G	A	40125.90	PASS	AC=134;AF=0.08151;AN=1644;DS;set=Intersection
22	24468448	.	C	T	2773.34	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	24468449	.	C	T	641.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24468452	.	C	T	597.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24472082	.	A	C	1975.93	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24472130	.	C	A	269.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24472135	.	A	G	83.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24472173	.	C	T	50633.55	PASS	AC=89;AF=0.05414;AN=1644;DS;set=Intersection
22	24472264	.	C	T	2788.78	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24472269	.	C	G	593.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24472270	.	A	G	180698.12	PASS	AC=1121;AF=0.68187;AN=1644;DS;set=Intersection
22	24479150	.	C	T	421.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24479178	.	C	T	718.25	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24479193	.	C	G	19867.80	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	24479288	.	C	G	219.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24479371	.	G	A	627.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24480503	.	G	A	314289.82	PASS	AC=1505;AF=0.91545;AN=1644;DS;set=Intersection
22	24480504	.	C	T	1841.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24480717	.	C	T	806.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24480788	.	TC	T	785.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24481006	.	C	G	762.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24481078	.	G	T	522.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24483387	.	C	A	706.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24483459	.	G	A	859.69	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24483477	.	G	A	1391.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24483493	.	A	G	343.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24483609	.	C	T	844.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24483621	.	A	G	662.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24483708	.	CCAGA	C	1512.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24487508	.	G	T	656.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24487546	.	C	T	609.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24487551	.	C	T	1180.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24487702	.	A	C	1357.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24487713	.	C	T	492.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24487738	.	C	T	977.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24487739	.	G	A	13762.02	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	24491878	.	G	T	742.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24492004	.	T	C	8286.72	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	24492061	.	T	C	321619.27	PASS	AC=1119;AF=0.68066;AN=1644;DS;set=Intersection
22	24493929	.	A	G	469.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24509492	.	A	G	33349.51	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	24509512	.	T	C	1098.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24509530	.	C	T	1006.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24509662	.	G	A	20055.14	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	24509680	.	C	T	866.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24509711	.	A	G	978.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24509732	.	C	T	971.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24509733	.	G	A	526.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24515286	.	C	A	432.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24515436	.	G	C	832.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24515581	.	C	T	799.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24515679	.	G	A	398.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24530259	.	G	T	1716.53	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24530286	.	C	T	1188.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24530346	.	G	T	396.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24530355	.	C	A	418.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24560427	.	G	T	917.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24560439	.	C	T	654.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24560478	.	C	T	731.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24560481	.	C	T	328.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24560517	.	C	A	345.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24561463	.	T	A	336.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24561480	.	AC	A	92.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24561534	.	G	A	728.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24561582	.	C	T	497.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24561624	.	C	T	1040.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24562664	.	G	A	761.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24562844	.	G	A	257.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24562852	.	G	C	425.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24562940	.	C	T	238.62	PASS	AC=2;AF=0.00122;AN=1640;set=Intersection
22	24562944	.	G	A	81.08	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	24562970	.	G	A	125.25	PASS	AC=1;AF=0.00062;AN=1620;set=Intersection
22	24562977	.	G	A	69.24	PASS	AC=1;AF=0.00062;AN=1602;set=Intersection
22	24563038	.	C	A	185.93	PASS	AC=4;AF=0.00327;AN=1224;set=Intersection
22	24563059	.	C	T	67.25	PASS	AC=3;AF=0.00247;AN=1214;set=Intersection
22	24563104	.	C	T	64.63	PASS	AC=1;AF=0.00061;AN=1630;set=Intersection
22	24563226	.	A	G	71.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24563309	.	A	G	81.08	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	24564371	.	C	A	500.89	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	24564384	.	G	A	2462.79	PASS	AC=8;AF=0.00492;AN=1626;DS;set=Intersection
22	24564391	.	G	A	1697.55	PASS	AC=5;AF=0.00306;AN=1632;DS;set=Intersection
22	24564477	.	C	T	24294.83	PASS	AC=147;AF=0.09142;AN=1608;DS;set=Intersection
22	24564516	.	C	G	585.38	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	24567673	.	C	G	1013.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24567744	.	G	C	3064.55	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24567795	.	C	T	1626.06	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24567805	.	A	C	1765.96	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24567823	.	G	T	639.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24567865	.	C	T	1277.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24567891	.	C	G	5863.15	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24567897	.	A	G	614.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24567910	.	C	T	2492.30	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	24567940	.	C	T	697.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24568003	.	G	A	139.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24568009	.	A	C,G,T	12729.32	PASS	AC=0,41,1;AF=0.00000,0.02494,0.00061;AN=1644;DS;set=Intersection
22	24572034	.	G	A	6089.35	PASS	AC=109;AF=0.06638;AN=1642;set=Intersection
22	24572197	.	G	A	64.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24573434	.	G	A	541.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24573435	.	G	A	17726.81	PASS	AC=69;AF=0.04197;AN=1644;DS;set=Intersection
22	24573537	.	C	T	635.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24573593	.	C	T	15921.76	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	24573761	.	G	A	560.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24573793	.	CAG	C	854.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24573826	.	G	A	563.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24573975	.	G	A	595.85	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24574003	.	G	A	228.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24574017	.	G	A	366.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24574054	.	G	A	1376.64	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24574128	.	C	T	109.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24574137	.	C	G	477.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24574185	.	G	A	332	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24574189	.	C	T	186.37	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	24577531	.	C	T	808.29	PASS	AC=13;AF=0.00809;AN=1606;set=Intersection
22	24577538	.	C	T	268.59	PASS	AC=1;AF=0.00062;AN=1604;set=Intersection
22	24579503	.	T	A	17857.47	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	24579530	.	C	T	3079.82	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	24579597	.	C	T	543.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580150	.	C	T	848.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580156	.	G	A	1115.78	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24580157	.	C	G	4893.66	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24580158	.	G	A	935.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580172	.	G	A	730.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580210	.	G	A	1016.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580261	.	C	T	261.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580268	.	A	G	532.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580694	.	C	T	28945.71	PASS	AC=129;AF=0.07847;AN=1644;DS;set=Intersection
22	24580784	.	CT	C	341.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580807	.	C	T	13925.69	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	24580857	.	G	C	889.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580882	.	C	T	362.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24580897	.	C	T	2484.47	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24580924	.	T	G	52210.94	PASS	AC=194;AF=0.11800;AN=1644;DS;set=Intersection
22	24581018	.	G	A	650.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24581043	.	A	G	123.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24581123	.	C	T	1264.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24581124	.	G	A	463.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24581182	.	T	C	5151.93	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	24581193	.	A	G	419.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24581207	.	C	T	13146.07	PASS	AC=139;AF=0.08455;AN=1644;DS;set=Intersection
22	24581477	.	G	T	60.30	PASS	AC=1;AF=0.00063;AN=1600;set=Intersection
22	24581498	.	C	T	32.45	PASS	AC=1;AF=0.00061;AN=1630;set=Intersection
22	24581617	.	T	G	1685.95	PASS	AC=16;AF=0.00976;AN=1640;set=Intersection
22	24581634	.	G	A	36.50	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	24581638	.	C	T	184.46	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	24581671	.	C	T	176.85	PASS	AC=3;AF=0.00183;AN=1640;set=Intersection
22	24581704	.	C	T	51.88	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	24581769	.	C	G	500.52	PASS	AC=3;AF=0.00182;AN=1644;set=Intersection
22	24581831	.	G	A	134.34	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	24581839	.	C	G	90.31	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	24581853	.	G	A	146.26	PASS	AC=1;AF=0.00062;AN=1624;set=Intersection
22	24581865	.	A	G	155.53	PASS	AC=2;AF=0.00125;AN=1594;set=Intersection
22	24581912	.	G	A	93.11	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	24581921	.	A	T	698.89	PASS	AC=7;AF=0.00426;AN=1644;set=Intersection
22	24582041	.	A	G	23071.75	PASS	AC=159;AF=0.09672;AN=1644;DS;set=Intersection
22	24582080	.	C	T	1623.08	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	24582093	.	G	A	357.43	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	24582098	.	C	T	1203.29	PASS	AC=8;AF=0.00487;AN=1642;DS;set=Intersection
22	24582101	.	G	A	348.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24582151	.	T	C	413.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24582220	.	C	T	1012.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24582236	.	C	T	8944.71	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	24583138	.	G	A	6654.41	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	24583193	.	G	A	1060.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583230	.	G	T	327.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583262	.	A	T	736.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583270	.	C	T	758.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583271	.	G	A	1448.91	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24583377	.	C	G	509.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583384	.	C	T	2672.95	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24583436	.	A	G	660.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583529	.	T	A	797.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583544	.	G	A	656.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583574	.	G	A	998.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583630	.	C	T	705.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583666	.	C	T	2470.86	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24583786	.	G	T	2199.39	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24583829	.	G	A	9910.34	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	24583856	.	C	T	332.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24583879	.	T	C	95027.76	PASS	AC=499;AF=0.30353;AN=1644;DS;set=Intersection
22	24583988	.	G	A	158.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24584021	.	C	T	22087.29	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	24584048	.	C	T	177.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24584090	.	G	A	196.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24584179	.	C	G	1531.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24584359	.	C	T	7366.15	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	24584366	.	C	A	314.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24616013	.	C	T	469.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24616060	.	G	A	269.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24621182	.	G	A	231.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24621190	.	C	T	588.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24621293	.	T	C	8759.61	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	24621324	.	G	A	1580.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24621394	.	G	A	18716.50	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	24621465	.	C	T	62.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24621474	.	G	A	807.16	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24621491	.	C	T	46130.42	PASS	AC=308;AF=0.18735;AN=1644;DS;set=Intersection
22	24621493	.	G	C	383.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24621516	.	G	A	801.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24621521	.	G	T	383.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24621538	.	C	T	1131.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24621540	.	C	T	4846.23	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	24621541	.	G	A	4983.93	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24621543	.	G	A	275.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24621599	.	T	G	42.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24621607	.	C	G	180.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24622020	.	C	T	225.07	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	24622124	.	G	A	9107.66	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	24622136	.	G	A	1080.71	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24622284	.	C	T	65.11	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	24622608	.	C	T	961.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24622648	.	T	C	119233.41	PASS	AC=497;AF=0.30231;AN=1644;DS;set=Intersection
22	24622656	.	C	T	1939.56	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24622734	.	C	T	504.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24627309	.	C	T	10122.88	PASS	AC=212;AF=0.2181;AN=972;set=Intersection
22	24627416	.	G	T	567.66	PASS	AC=3;AF=0.00185;AN=1618;DS;set=Intersection
22	24627458	.	G	A	907.41	PASS	AC=4;AF=0.00244;AN=1636;DS;set=Intersection
22	24627540	.	T	A	100.13	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	24628062	.	C	T	294.10	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24628161	.	G	A	6925.41	PASS	AC=51;AF=0.03117;AN=1636;DS;set=Intersection
22	24628763	.	G	T	2637.74	PASS	AC=49;AF=0.03105;AN=1578;set=Intersection
22	24628852	.	CAG	C	138.90	PASS	AC=1;AF=0.00062;AN=1602;DS;set=Intersection
22	24628872	.	C	T	207.27	PASS	AC=1;AF=0.00063;AN=1598;DS;set=Intersection
22	24628895	.	C	T	79.29	PASS	AC=1;AF=0.00063;AN=1592;set=Intersection
22	24628908	.	G	A	1104	PASS	AC=26;AF=0.01631;AN=1594;set=Intersection
22	24628928	.	G	A	8005.28	PASS	AC=219;AF=0.13670;AN=1602;set=Intersection
22	24629461	.	G	A,T	9574.53	PASS	AC=6,28;AF=0.00365,0.01703;AN=1644;DS;set=Intersection
22	24629478	.	G	A	141.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24629596	.	C	T	4960.71	PASS	AC=48;AF=0.02923;AN=1642;DS;set=Intersection
22	24629793	.	T	C	265.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24629795	.	G	A	2085.57	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24629879	.	G	A	871.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24629905	.	C	T	676.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24629906	.	G	A	657.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24629908	.	C	T	215.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24629912	.	G	A	9841.72	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	24629930	.	G	A	4704.20	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24629959	.	G	C	313.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24640574	.	G	T	1653.02	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24640666	.	T	C	22039.16	PASS	AC=75;AF=0.04562;AN=1644;DS;set=Intersection
22	24640670	.	C	T	1386.24	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	24640687	.	G	A	107.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24698155	.	T	C	1071.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24698357	.	T	G	1088.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24709270	.	G	A	535.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24709420	.	C	T	1052.35	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24717258	.	A	G	2362.79	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24717411	.	C	T	816.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24717444	.	A	G	1215.76	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24717510	.	C	T	8085.94	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	24717517	.	C	T	840.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24717518	.	G	A	101386.78	PASS	AC=382;AF=0.23236;AN=1644;DS;set=Intersection
22	24717548	.	A	T	6632.15	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24717602	.	T	A	785.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24717637	.	C	T	9048.30	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	24717655	.	C	T	2076.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24717820	.	A	G	1142.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24717843	.	A	G	2491.57	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24717850	.	A	G	414110.65	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	24717974	.	G	A	536.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24718096	.	G	C	575.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24718209	.	C	T	1022.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24718253	.	C	T	769.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24718277	.	T	G	6711.48	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24718288	.	A	G	1031.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24718307	.	C	T	2903.68	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24718408	.	G	A	5382.82	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	24718490	.	G	A	567.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24718677	.	A	C	357.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24718681	.	G	A	318.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24720219	.	A	C	1070.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24720253	.	G	A	682.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24724816	.	A	G	1098.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24724872	.	C	T	1411.80	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24726329	.	C	T	890.39	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24726430	.	T	C	1878.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24730340	.	C	T	42467.04	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	24730420	.	C	T	869.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24730548	.	A	G	5323.39	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	24730554	.	T	C	821.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24730558	.	A	G	863.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24730578	.	G	A	1147.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24730582	.	G	A	927.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24730587	.	C	T	185841.76	PASS	AC=909;AF=0.55292;AN=1644;DS;set=Intersection
22	24734322	.	A	G	850.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24734452	.	G	T	1141.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24734459	.	A	G	1063.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24734474	.	T	C	845.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24743056	.	A	G	986.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24743090	.	C	T	5811.84	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	24743154	.	A	G	6808.02	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	24743183	.	A	G	1441.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24759206	.	G	A	305.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24759213	.	T	C	1501.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24759287	.	G	A	948.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24759331	.	A	G	682.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24761415	.	A	G	915.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24761467	.	G	A	360231.69	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	24761498	.	C	T	524.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24761514	.	G	T	850.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24761568	.	A	T	1864.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24761646	.	G	A	1603.44	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24765214	.	T	C	2144.59	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24808628	.	A	T	984.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24808709	.	C	T	1088.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24808722	.	TAAG	T	1222.93	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24810611	.	C	T	812.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24810638	.	C	T	187.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24829383	.	T	C	863.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24829453	.	G	A	301.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24829521	.	C	T	1846.59	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	24829597	.	C	T	884.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24836510	.	C	T	5515.08	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24836650	.	C	T	724.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24836657	.	G	A	21528.82	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	24836665	.	A	G	563.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24836929	.	C	A	13513.96	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	24836998	.	C	T	1131.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24837041	.	G	A	578.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24837103	.	C	T	1184.74	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24837117	.	G	A	860.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24837137	.	G	A	633.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24837236	.	G	A	317.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24837243	.	C	T	393.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24837262	.	C	T	11729.65	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	24837301	.	T	C	56396.93	PASS	AC=839;AF=0.51034;AN=1644;DS;set=Intersection
22	24837325	.	G	C	486.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24837364	.	C	T	140.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24837424	.	C	A	2198.31	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	24837499	.	T	C	446.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24891355	.	A	T	58595.83	PASS	AC=268;AF=0.16302;AN=1644;DS;set=Intersection
22	24891370	.	C	T	608.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24891380	.	C	T	296.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24891453	.	G	A	272.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24891462	.	G	A	1352.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24896044	.	T	C	511.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24896068	.	C	G	827.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24896069	.	A	G	141.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24896158	.	A	T	1251.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24896179	.	G	C	977.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24896224	.	C	A	2637.40	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	24898056	.	T	A	1008.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24898063	.	A	C	792.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24898092	.	A	G	949.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24898175	.	G	T	2067.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24906668	.	CAG	C	192.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24906689	.	A	G	1114.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24906723	.	C	A	884.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24909316	.	G	GT	1245	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24909346	.	G	A	2942.99	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24909465	.	A	G	854.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24911233	.	C	A	799.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24911249	.	C	T	8846.03	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24911253	.	C	T	906.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24911294	.	GGC	G	1200.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24911318	.	G	A	953.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24916355	.	C	A	451.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24916373	.	C	T	739.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24916385	.	C	T	700.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24916409	.	C	T	6465.48	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	24916420	.	T	C	535.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24916426	.	G	A	488.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24916438	.	T	A	844.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24916445	.	C	T	6634.02	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	24917944	.	T	TA	295.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24917983	.	A	G	921.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24919586	.	G	A	1749.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24919590	.	A	G	510.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24919611	.	A	G	679.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24919627	.	G	A	2571.43	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	24919646	.	C	A	2983.70	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24919647	.	G	A	9713.59	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	24919675	.	T	G	840.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24921693	.	T	C	1134.87	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24921714	.	C	T	1629.07	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24921729	.	G	A	5945.13	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	24921764	.	C	A	1143.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24921765	.	G	A	4932.63	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	24921785	.	G	A	1150.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24939115	.	A	G	1061.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24939814	.	G	T	161.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24939868	.	C	T	4662.28	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	24939873	.	C	T	453.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24939919	.	G	A	532.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24939922	.	A	G	75.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24939978	.	C	A	741.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24939982	.	C	T	5654.91	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	24940063	.	A	AG	567.52	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	24940093	.	A	G	764.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	24942835	.	T	G	943.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24942853	.	A	T	497.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24942937	.	G	A	1063.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24943848	.	T	C	874.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24943869	.	C	T	602.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24943979	.	C	T	710.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24943981	.	G	C	962.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24944053	.	C	T	226393.92	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	24944927	.	T	G	799.16	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	24944943	.	C	T	772.62	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	24950924	.	G	A	373.03	PASS	AC=2;AF=0.00122;AN=1636;DS;set=Intersection
22	24953595	.	A	G	706.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24953606	.	G	A	510.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24953611	.	C	G	988.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24953708	.	G	A	1047.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24953714	.	C	T	1750.78	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	24963975	.	C	T	906.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24964128	.	T	C	299320.55	PASS	AC=1260;AF=0.76642;AN=1644;DS;set=Intersection
22	24964151	.	G	T	770.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24967838	.	T	G	939.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24967842	.	C	T	7700.18	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	24967888	.	C	T	890.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24967962	.	G	A	610.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	24981880	.	C	T	7768.88	PASS	AC=23;AF=0.01846;AN=1246;set=Intersection
22	24981881	.	G	A	566.62	PASS	AC=2;AF=0.00160;AN=1250;set=Intersection
22	24981938	.	C	T	2449.02	PASS	AC=14;AF=0.01124;AN=1246;DS;set=Intersection
22	24981958	.	G	T	524.46	PASS	AC=1;AF=0.00078;AN=1284;DS;set=Intersection
22	24981983	.	G	A	1246.79	PASS	AC=3;AF=0.00232;AN=1294;DS;set=Intersection
22	24981993	.	C	T	557.81	PASS	AC=1;AF=0.00077;AN=1294;DS;set=Intersection
22	24982011	.	C	T	1599.61	PASS	AC=2;AF=0.00159;AN=1256;DS;set=Intersection
22	24982103	.	C	G	745.25	PASS	AC=1;AF=0.00073;AN=1366;DS;set=Intersection
22	24982126	.	G	A	5631.15	PASS	AC=5;AF=0.00371;AN=1346;DS;set=Intersection
22	24982137	.	C	T	7011.14	PASS	AC=6;AF=0.00435;AN=1378;DS;set=Intersection
22	24982154	.	G	A	758.58	PASS	AC=1;AF=0.00071;AN=1418;DS;set=Intersection
22	24982181	.	C	T	541.19	PASS	AC=1;AF=0.00075;AN=1338;DS;set=Intersection
22	24982233	.	G	A	1194.63	PASS	AC=1;AF=0.00078;AN=1282;DS;set=Intersection
22	24982253	.	C	T	775.01	PASS	AC=1;AF=0.00074;AN=1346;DS;set=Intersection
22	24982254	.	G	A	8916.88	PASS	AC=17;AF=0.01267;AN=1342;DS;set=Intersection
22	24982301	.	G	T	684.34	PASS	AC=1;AF=0.00077;AN=1292;DS;set=Intersection
22	24982335	.	A	G	544.15	PASS	AC=1;AF=0.00079;AN=1266;DS;set=Intersection
22	24984143	.	A	G	90.38	PASS	AC=1;AF=0.00067;AN=1494;set=Intersection
22	24984186	.	T	G	2538.56	PASS	AC=14;AF=0.01007;AN=1390;set=Intersection
22	24984189	.	G	T	275.78	PASS	AC=1;AF=0.00072;AN=1388;set=Intersection
22	24984204	.	G	A	328.03	PASS	AC=1;AF=0.00073;AN=1372;DS;set=Intersection
22	24984215	.	C	G	1065.57	PASS	AC=8;AF=0.00594;AN=1346;DS;set=Intersection
22	24984260	.	C	A	4437.98	PASS	AC=9;AF=0.00651;AN=1382;DS;set=Intersection
22	24984261	.	G	A	402.08	PASS	AC=1;AF=0.00073;AN=1372;DS;set=Intersection
22	24984270	.	T	C	215.23	PASS	AC=1;AF=0.00073;AN=1364;DS;set=Intersection
22	24984275	.	G	A	805.70	PASS	AC=4;AF=0.00294;AN=1360;DS;set=Intersection
22	24984304	.	G	A	365.47	PASS	AC=1;AF=0.00075;AN=1332;DS;set=Intersection
22	24985742	.	C	A	551.91	PASS	AC=23;AF=0.02003;AN=1148;set=Intersection
22	24985840	.	G	T	13902.96	PASS	AC=54;AF=0.04419;AN=1222;DS;set=Intersection
22	24985853	.	G	A	522.58	PASS	AC=3;AF=0.00247;AN=1214;DS;set=Intersection
22	24988805	.	A	C	65.12	PASS	AC=5;AF=0.0086;AN=582;set=Intersection
22	24988920	.	C	T	399.86	PASS	AC=49;AF=0.2917;AN=168;set=Intersection
22	25010885	.	G	A	32689.73	PASS	AC=59;AF=0.04429;AN=1332;DS;set=Intersection
22	25010967	.	G	C	18393.61	PASS	AC=58;AF=0.04610;AN=1258;DS;set=Intersection
22	25010979	.	C	T	359.46	PASS	AC=2;AF=0.00166;AN=1204;DS;set=Intersection
22	25019903	.	CCACTGTGGGTGTGGGG	C	682.44	PASS	AC=37;AF=0.0421;AN=878;DS;set=Intersection
22	25019904	.	CACTGTGGGTGTGGGG	C	656.74	PASS	AC=37;AF=0.0419;AN=884;DS;set=Intersection
22	25019919	.	G	GC,GCC,GGC	1993	PASS	AC=187,70,154;AF=0.16877,0.06318,0.13899;AN=1108;DS;set=Intersection
22	25023367	.	ACCT	A	113.51	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	25024850	.	TACTC	T	67476.76	PASS	AC=137;AF=0.08333;AN=1644;DS;set=Intersection
22	25115424	.	GTCT	G	3671.70	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25115449	.	A	G	7013.59	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	25115456	.	G	A	33607.96	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	25115459	.	T	G	873.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25115475	.	C	T	836.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25115524	.	T	C	4312.56	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25115717	.	G	A	617.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25115747	.	A	G	871.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25115749	.	G	A	754.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25115799	.	G	A	2172.27	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	25115814	.	G	A	1677.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25119062	.	C	T	4902.94	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	25119070	.	C	G	794.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25119120	.	A	G	4755.55	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	25119191	.	G	A	1524.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25119210	.	A	C	25781.98	PASS	AC=107;AF=0.06509;AN=1644;DS;set=Intersection
22	25120883	.	C	T	1612.75	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25121376	.	T	C	1569.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25121409	.	G	A	2594.29	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	25121428	.	C	T	1022.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25121518	.	A	G	417.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25123900	.	T	C	1816.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25123975	.	C	T	830.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25124021	.	CTTAAGT	C	1775.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25124095	.	C	T	229909.18	PASS	AC=1086;AF=0.66058;AN=1644;DS;set=Intersection
22	25124143	.	C	T	2441.74	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	25124155	.	C	T	1002.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25124413	.	G	A	1575.81	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	25124414	.	C	A	1674.83	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	25130024	.	T	C	878.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25130050	.	C	A	1736.47	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25130068	.	T	C	2663.26	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	25130085	.	G	A	868.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25130156	.	G	A	740.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25130158	.	T	C	7624.84	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	25130160	.	C	G	170.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25131837	.	T	C	676.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25144846	.	T	C	1877.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25144912	.	C	T	142177.70	PASS	AC=340;AF=0.20681;AN=1644;DS;set=Intersection
22	25144996	.	T	C	691	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25145331	.	T	C	833.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25145393	.	C	A	891.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25145453	.	C	T	347340.60	PASS	AC=1521;AF=0.92518;AN=1644;DS;set=Intersection
22	25145471	.	A	G	239234.78	PASS	AC=1083;AF=0.65876;AN=1644;DS;set=Intersection
22	25145501	.	C	T	1089.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25145511	.	C	A	1207.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25145631	.	T	A	971.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25145676	.	C	T	683.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25145713	.	G	A	1184.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25145753	.	G	A	12491.02	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	25145799	.	C	CAA	1540.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25147324	.	A	G	165938.93	PASS	AC=331;AF=0.20134;AN=1644;DS;set=Intersection
22	25147389	.	C	T	740.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25147423	.	C	T	32450.54	PASS	AC=58;AF=0.03528;AN=1644;DS;set=Intersection
22	25147456	.	G	T	6139.22	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	25147461	.	T	C	1078.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25149952	.	T	G	174.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25149988	.	G	C	2193.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25150005	.	A	C	339.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25150051	.	C	T	681.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25150073	.	A	G	477.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25150138	.	A	G	2184.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25150199	.	A	T	535.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25150209	.	T	TA	9573.25	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	25150220	.	C	G	60.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25150757	.	C	T	978	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25150797	.	G	A	1214.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25151741	.	G	A	6451.04	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	25151792	.	C	T	10743.73	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	25151833	.	C	T	1157.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25151880	.	T	TA	116117.85	PASS	AC=742;AF=0.45134;AN=1644;DS;set=Intersection
22	25151888	.	AAC	A	36390.79	PASS	AC=718;AF=0.43674;AN=1644;DS;set=Intersection
22	25151889	.	AC	A	72633.17	PASS	AC=728;AF=0.44282;AN=1644;DS;set=Intersection
22	25151890	.	CA	C	148426.83	PASS	AC=1137;AF=0.69161;AN=1644;DS;set=Intersection
22	25152416	.	AAGAG	A	272.69	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25152463	.	C	T	232.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25152471	.	G	A	12614.05	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	25152475	.	G	A	806.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25152477	.	G	A	6137.57	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	25152499	.	C	T	224.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25152511	.	G	A	1391.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25152553	.	G	A	932.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25152618	.	C	T	97.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25152652	.	G	C	1318.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25153864	.	G	A	1963.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25153963	.	G	A	21382	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	25153966	.	C	T	593.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25154022	.	C	T	1103.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25155857	.	CTGCTCCTCCTCT	C	1035.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25155922	.	C	T	1207.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25155925	.	G	A	769.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25155952	.	TG	T	995.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25155983	.	T	C	1099.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25158326	.	A	G	131060.52	PASS	AC=727;AF=0.44221;AN=1644;DS;set=Intersection
22	25158384	.	C	T	804.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25158391	.	C	T	971.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25158398	.	T	C	6794.40	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	25158404	.	T	A	13422.56	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	25158423	.	C	T	1789	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25158438	.	C	T	1276.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25158439	.	G	C	646.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25158443	.	G	A	589.60	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25158444	.	C	T	1032.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25158445	.	G	A	3206.66	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	25158505	.	T	C	985.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25158513	.	A	G	958	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25202463	.	G	C	42.34	PASS	AC=1;AF=0.0011;AN=936;set=Intersection
22	25240847	.	T	C	759.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25240987	.	C	T	582.43	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	25243557	.	G	A	1791.85	PASS	AC=14;AF=0.01040;AN=1346;set=Intersection
22	25243626	.	C	T	332.52	PASS	AC=1;AF=0.00076;AN=1318;set=Intersection
22	25243706	.	C	T	150.44	PASS	AC=1;AF=0.00076;AN=1316;DS;set=Intersection
22	25243709	.	C	T	93.09	PASS	AC=1;AF=0.00077;AN=1302;DS;set=Intersection
22	25246287	.	C	G	8855.55	PASS	AC=15;AF=0.01179;AN=1272;DS;set=Intersection
22	25246311	.	C	T	365.40	PASS	AC=1;AF=0.00077;AN=1304;DS;set=Intersection
22	25246313	.	A	G	640.09	PASS	AC=1;AF=0.00077;AN=1304;DS;set=Intersection
22	25246440	.	C	A	334	PASS	AC=1;AF=0.00075;AN=1340;DS;set=Intersection
22	25251027	.	T	C	743.23	PASS	AC=2;AF=0.00153;AN=1310;DS;set=Intersection
22	25251372	.	C	T	2252.64	PASS	AC=11;AF=0.00908;AN=1212;DS;set=Intersection
22	25251378	.	C	A	360.17	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	25251477	.	C	G	5354.88	PASS	AC=13;AF=0.00997;AN=1304;DS;set=Intersection
22	25251500	.	C	T	6244.09	PASS	AC=37;AF=0.02774;AN=1334;DS;set=Intersection
22	25251504	.	A	C	3113.97	PASS	AC=7;AF=0.00519;AN=1348;DS;set=Intersection
22	25251516	.	A	G	295.38	PASS	AC=1;AF=0.00074;AN=1348;DS;set=Intersection
22	25251520	.	A	C	262.80	PASS	AC=1;AF=0.00074;AN=1352;DS;set=Intersection
22	25251671	.	A	C	2536.52	PASS	AC=9;AF=0.00616;AN=1462;DS;set=Intersection
22	25255688	.	C	T	9984.20	PASS	AC=32;AF=0.02516;AN=1272;DS;set=Intersection
22	25263048	.	G	A	10266.16	PASS	AC=121;AF=0.09409;AN=1286;set=Intersection
22	25263123	.	G	A	16722.68	PASS	AC=35;AF=0.02668;AN=1312;DS;set=Intersection
22	25264353	.	C	T	1526.15	PASS	AC=7;AF=0.00474;AN=1476;DS;set=Intersection
22	25264482	.	G	A	1111.43	PASS	AC=1;AF=0.00070;AN=1422;DS;set=Intersection
22	25264646	.	A	ACAGAT	9457.42	PASS	AC=7;AF=0.00492;AN=1422;DS;set=Intersection
22	25264651	.	T	C	636.06	PASS	AC=1;AF=0.00072;AN=1398;DS;set=Intersection
22	25264730	.	G	A	2279.99	PASS	AC=5;AF=0.00391;AN=1278;DS;set=Intersection
22	25264776	.	G	A	947.71	PASS	AC=1;AF=0.00079;AN=1258;DS;set=Intersection
22	25264869	.	C	T	905.98	PASS	AC=1;AF=0.00081;AN=1232;DS;set=Intersection
22	25270344	.	C	A	947.11	PASS	AC=8;AF=0.00618;AN=1294;set=Intersection
22	25270390	.	G	A	245.65	PASS	AC=1;AF=0.00074;AN=1348;DS;set=Intersection
22	25270441	.	G	C	4730.36	PASS	AC=10;AF=0.00715;AN=1398;DS;set=Intersection
22	25270455	.	G	C	10944.85	PASS	AC=146;AF=0.10311;AN=1416;DS;set=Intersection
22	25270520	.	C	T	627.04	PASS	AC=2;AF=0.00142;AN=1408;set=Intersection
22	25270529	.	C	T	1281.85	PASS	AC=7;AF=0.00494;AN=1416;set=Intersection
22	25270567	.	G	T	1260.41	PASS	AC=14;AF=0.00967;AN=1448;set=Intersection
22	25272533	.	A	G	909.71	PASS	AC=1;AF=0.00070;AN=1430;DS;set=Intersection
22	25272606	.	C	T	699.49	PASS	AC=1;AF=0.00073;AN=1362;DS;set=Intersection
22	25272645	.	G	A	629.12	PASS	AC=1;AF=0.00077;AN=1300;DS;set=Intersection
22	25275393	.	T	C	14037.66	PASS	AC=132;AF=0.10427;AN=1266;set=Intersection
22	25275523	.	C	A	11481.61	PASS	AC=90;AF=0.07329;AN=1228;DS;set=Intersection
22	25280022	.	C	T	12763.99	PASS	AC=33;AF=0.02627;AN=1256;set=Intersection
22	25280048	.	C	T	855.58	PASS	AC=2;AF=0.00160;AN=1250;DS;set=Intersection
22	25280070	.	C	T	2326.24	PASS	AC=6;AF=0.00490;AN=1224;DS;set=Intersection
22	25280157	.	G	A	452.58	PASS	AC=1;AF=0.00079;AN=1264;DS;set=Intersection
22	25280181	.	G	A	18789.23	PASS	AC=37;AF=0.02927;AN=1264;DS;set=Intersection
22	25280189	.	T	G	14792.81	PASS	AC=28;AF=0.02201;AN=1272;DS;set=Intersection
22	25282605	.	C	T	1588.36	PASS	AC=21;AF=0.01672;AN=1256;set=Intersection
22	25282635	.	C	T	236.56	PASS	AC=1;AF=0.00077;AN=1296;set=Intersection
22	25282676	.	C	T	67.48	PASS	AC=1;AF=0.00077;AN=1304;set=Intersection
22	25282711	.	T	C	2719.19	PASS	AC=61;AF=0.04446;AN=1372;set=Intersection
22	25289356	.	C	T	627.68	PASS	AC=3;AF=0.00233;AN=1286;set=Intersection
22	25289448	.	G	A	9667.21	PASS	AC=21;AF=0.01628;AN=1290;DS;set=Intersection
22	25289468	.	G	A	402.25	PASS	AC=1;AF=0.00081;AN=1240;DS;set=Intersection
22	25289499	.	C	A	84.37	PASS	AC=1;AF=0.00080;AN=1250;DS;set=Intersection
22	25289589	.	C	T	474.78	PASS	AC=6;AF=0.00430;AN=1396;set=Intersection
22	25289609	.	G	T	567.95	PASS	AC=4;AF=0.00280;AN=1428;set=Intersection
22	25291182	.	TTTC	T	17613.23	PASS	AC=242;AF=0.16899;AN=1432;set=Intersection
22	25291210	.	G	A	268.33	PASS	AC=1;AF=0.00068;AN=1474;set=Intersection
22	25293936	.	C	T	343.37	PASS	AC=1;AF=0.00068;AN=1470;set=Intersection
22	25293954	.	G	C	165.15	PASS	AC=1;AF=0.00067;AN=1488;set=Intersection
22	25294155	.	A	C	72360.78	PASS	AC=95;AF=0.06681;AN=1422;DS;set=Intersection
22	25294234	.	G	A	803.85	PASS	AC=1;AF=0.00069;AN=1448;DS;set=Intersection
22	25294247	.	C	T	987.64	PASS	AC=1;AF=0.00071;AN=1414;DS;set=Intersection
22	25294260	.	C	T	394.22	PASS	AC=1;AF=0.00072;AN=1392;DS;set=Intersection
22	25294346	.	C	T	5627.41	PASS	AC=7;AF=0.00500;AN=1400;DS;set=Intersection
22	25294369	.	G	A	33744.80	PASS	AC=135;AF=0.09712;AN=1390;DS;set=Intersection
22	25294376	.	C	T	34092.73	PASS	AC=127;AF=0.09243;AN=1374;DS;set=Intersection
22	25294399	.	C	T	836.25	PASS	AC=1;AF=0.00073;AN=1364;DS;set=Intersection
22	25294420	.	C	T	687.92	PASS	AC=1;AF=0.00074;AN=1356;DS;set=Intersection
22	25294511	.	C	T	967.91	PASS	AC=2;AF=0.00148;AN=1352;DS;set=Intersection
22	25294514	.	C	T	526.13	PASS	AC=1;AF=0.00075;AN=1340;DS;set=Intersection
22	25294534	.	A	G	903.67	PASS	AC=1;AF=0.00073;AN=1364;DS;set=Intersection
22	25294539	.	G	A	275.07	PASS	AC=2;AF=0.00146;AN=1370;DS;set=Intersection
22	25297751	.	A	G	105.70	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	25297755	.	G	A	32375.87	PASS	AC=534;AF=0.32482;AN=1644;set=Intersection
22	25297771	.	C	A	7065.14	PASS	AC=29;AF=0.01764;AN=1644;set=Intersection
22	25297780	.	C	G	1686.60	PASS	AC=13;AF=0.00791;AN=1644;set=Intersection
22	25297856	.	G	A	395.49	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25297965	.	T	C	11126.34	PASS	AC=847;AF=0.56093;AN=1510;set=Intersection
22	25301037	.	C	T	935.85	PASS	AC=1;AF=0.00070;AN=1422;DS;set=Intersection
22	25301038	.	G	A	5670.12	PASS	AC=6;AF=0.00418;AN=1434;DS;set=Intersection
22	25301142	.	A	G	3020.48	PASS	AC=13;AF=0.00851;AN=1528;DS;set=Intersection
22	25308602	.	T	C	558.93	PASS	AC=3;AF=0.00187;AN=1608;set=Intersection
22	25308671	.	C	T	1534.13	PASS	AC=20;AF=0.01233;AN=1622;DS;set=Intersection
22	25315753	.	G	A	53849.15	PASS	AC=361;AF=0.27642;AN=1306;DS;set=Intersection
22	25315760	.	A	G	783.25	PASS	AC=1;AF=0.00076;AN=1318;DS;set=Intersection
22	25315849	.	G	A	355.62	PASS	AC=1;AF=0.00071;AN=1400;DS;set=Intersection
22	25320250	.	T	C	1219.95	PASS	AC=8;AF=0.00596;AN=1342;DS;set=Intersection
22	25320256	.	C	T	2358.60	PASS	AC=33;AF=0.02459;AN=1342;DS;set=Intersection
22	25331271	.	G	A	10686.09	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	25331451	.	C	T	10105.82	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	25331492	.	G	A	1545.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25331546	.	C	A	526.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25334094	.	T	C	41020.08	PASS	AC=75;AF=0.04562;AN=1644;DS;set=Intersection
22	25334184	.	G	T	23198.76	PASS	AC=70;AF=0.04258;AN=1644;DS;set=Intersection
22	25334292	.	C	G	1877.55	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	25597331	.	T	C	272014.98	PASS	AC=1052;AF=0.63990;AN=1644;DS;set=Intersection
22	25597369	.	G	A	2592.45	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25597384	.	A	G	889.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25597401	.	C	G	973.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25597456	.	G	A	1678.33	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25597467	.	C	T	533.72	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	25598661	.	G	T	563.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25598664	.	C	T	543.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25598690	.	C	T	626.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25598782	.	C	T	1542.12	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	25598790	.	C	T	124.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25599723	.	C	G	1016.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25599759	.	G	A	949.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25599769	.	G	A	843.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25599770	.	T	A	706.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25599849	.	G	A	16533.32	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	25601173	.	G	A	581.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25601196	.	C	G	244846.25	PASS	AC=1148;AF=0.69830;AN=1644;DS;set=Intersection
22	25601239	.	G	A	578.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25601251	.	T	C	179.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25602990	.	A	G	776.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25603008	.	C	T	15828.86	PASS	AC=60;AF=0.03650;AN=1644;DS;set=Intersection
22	25603018	.	G	A	8381.53	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	25603035	.	C	A	1187.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25603067	.	G	A	311.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25603095	.	G	C	179.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25603110	.	G	A	4700.11	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	25603127	.	G	A	596.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25603136	.	G	A	195.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25617436	.	T	A	19900.86	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	25617474	.	G	T	303.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25620851	.	G	A	1049.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25620853	.	G	C	975.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25623839	.	G	T	7483.56	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	25623919	.	G	A	2291.19	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	25627604	.	G	A	89127.62	PASS	AC=491;AF=0.29866;AN=1644;DS;set=Intersection
22	25627692	.	C	T	772.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25627788	.	G	A	1436.23	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	25747716	.	A	G	70232.61	PASS	AC=251;AF=0.15268;AN=1644;DS;set=Intersection
22	25747749	.	G	A	26633.47	PASS	AC=54;AF=0.03285;AN=1644;DS;set=Intersection
22	25747750	.	C	G	1782.62	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	25747779	.	G	A	896.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25747801	.	C	T	4492.69	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	25747810	.	T	A	2423.66	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	25747853	.	C	T	1045.75	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	25750534	.	C	T	72287.86	PASS	AC=241;AF=0.14659;AN=1644;DS;set=Intersection
22	25750552	.	C	A	850.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25750578	.	C	G	14104.07	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	25750606	.	G	A	974.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25750631	.	C	T	1018.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25750656	.	G	A	792	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25750663	.	G	A	842.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25750783	.	C	G	15801.61	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	25750809	.	T	TGGGCCA	119539.56	PASS	AC=628;AF=0.38200;AN=1644;DS;set=Intersection
22	25750814	.	C	CAGGGCA	219934.53	PASS	AC=639;AF=0.38869;AN=1644;DS;set=Intersection
22	25750815	.	A	AGGGCAG	157728.25	PASS	AC=628;AF=0.38200;AN=1644;DS;set=Intersection
22	25750818	.	GCCATGC	G,GCAAGGCCCATGC	115865.90	PASS	AC=747,235;AF=0.45438,0.14294;AN=1644;DS;set=Intersection
22	25753175	.	G	A	1167.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25753189	.	C	T	519.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25753213	.	G	A	1120.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25753231	.	G	A	144411.01	PASS	AC=684;AF=0.41606;AN=1644;DS;set=Intersection
22	25753310	.	T	C	513.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25753339	.	C	T	6881.95	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	25753349	.	C	T	869.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25753387	.	C	T	49740.81	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	25753397	.	GAGA	G	5560.03	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	25755760	.	GCCTGGC	G	3106.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	25755765	.	G	A	8146.57	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	25755787	.	G	A	9103.53	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	25755878	.	G	A	8684.93	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	25755880	.	C	T	50523.71	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	25755885	.	C	T	58212.72	PASS	AC=72;AF=0.04380;AN=1644;DS;set=Intersection
22	25755895	.	A	G	2732.87	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	25755908	.	G	A	491.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25755914	.	T	C	530.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25755924	.	G	A	842.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25755925	.	G	C	2861.08	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	25755942	.	C	A,G,T	1437.24	PASS	AC=0,3,2;AF=0.00000,0.00182,0.00122;AN=1644;DS;set=Intersection
22	25755980	.	G	A	1137.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	25755984	.	G	A	1956.79	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	25755987	.	C	T	2979.02	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	25756024	.	C	T	11080.33	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	25961139	.	G	A	210.05	PASS	AC=11;AF=0.00937;AN=1174;set=Intersection
22	26000466	.	A	C	580.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26040629	.	A	G	1928.37	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26057521	.	A	G	1157.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26059551	.	T	C	1364.56	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	26059552	.	T	C	127.52	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	26059700	.	G	T	528.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26063679	.	G	A	1029.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26068246	.	A	T	1055.63	PASS	AC=1;AF=0.00062;AN=1616;DS;set=Intersection
22	26068254	.	C	A	1047.83	PASS	AC=2;AF=0.00123;AN=1622;DS;set=Intersection
22	26068297	.	G	A	1031.99	PASS	AC=2;AF=0.00122;AN=1634;DS;set=Intersection
22	26070516	.	T	C	255.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26074740	.	A	G	869.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26074921	.	T	C	1116.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26081111	.	T	C	714.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26083608	.	C	A	905.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26083642	.	C	T	8421.70	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	26086152	.	T	G	6848.39	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26086262	.	G	A	729.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26091030	.	A	T	460.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26099429	.	A	G	20918.17	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	26099498	.	T	C	7966.96	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26099537	.	C	T	1553.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26099541	.	G	A	1479.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26100037	.	A	G	10191.84	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	26100043	.	G	A	657.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26100063	.	G	A	2694	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	26100085	.	C	T	762.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26100144	.	C	T	725.60	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26100168	.	C	T	401.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26105847	.	T	C	6440.46	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26105861	.	C	T	1205.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26105968	.	C	T	707.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26105974	.	G	A	865.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26106994	.	G	A	787.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26110530	.	C	T	487.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26114187	.	C	T	778.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26114191	.	T	C	12679.52	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	26114216	.	C	T	615.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26114243	.	C	T	984.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26114389	.	G	A	1617.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26117202	.	A	G	785.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26117229	.	A	G	1397.68	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26117343	.	A	G	1646.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26118231	.	C	T	1654.63	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26118244	.	A	G	863.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26118294	.	C	T	755.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26565698	.	C	T	225.56	PASS	AC=15;AF=0.0235;AN=638;set=Intersection
22	26688357	.	T	C	159.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26688377	.	C	T	370.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26688378	.	T	C	32.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26688388	.	A	C	21231.22	PASS	AC=92;AF=0.05596;AN=1644;DS;set=Intersection
22	26688401	.	T	C	43467.04	PASS	AC=119;AF=0.07238;AN=1644;DS;set=Intersection
22	26688413	.	C	G	792.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26688580	.	G	T	913.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26688621	.	C	G	67.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26688727	.	G	A	510.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26688777	.	C	T	326.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26688778	.	G	A	291.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26688797	.	G	A	550.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26688831	.	G	T	82036.83	PASS	AC=106;AF=0.06448;AN=1644;DS;set=Intersection
22	26688838	.	C	T	27998.10	PASS	AC=102;AF=0.06204;AN=1644;DS;set=Intersection
22	26688840	.	G	A	4789.58	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	26688940	.	C	T	456	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26689053	.	A	G	313.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26689105	.	G	A	22468.67	PASS	AC=99;AF=0.06044;AN=1638;DS;set=Intersection
22	26690407	.	T	C	106615	PASS	AC=397;AF=0.24148;AN=1644;DS;set=Intersection
22	26690427	.	G	C	830.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26690435	.	G	T	715.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26692913	.	T	C	311.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26692922	.	C	T	1491.10	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26692955	.	G	A	199.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26693079	.	C	T	847.67	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	26694919	.	T	C	365.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26695053	.	C	A	720.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26695077	.	G	T	40177.37	PASS	AC=322;AF=0.19586;AN=1644;DS;set=Intersection
22	26695104	.	G	A	74.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26701907	.	G	A	2569.14	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26701917	.	A	G	733.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26701928	.	AC	A	12020	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	26701977	.	A	G	855.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26701988	.	C	T	904.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26702015	.	A	C	194297.52	PASS	AC=607;AF=0.36922;AN=1644;DS;set=Intersection
22	26702041	.	C	T	1492.26	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	26706696	.	C	T	1431	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26706697	.	G	A	6769.62	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	26706743	.	G	A	795.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26706747	.	C	T	872.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26706755	.	C	T	531.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26706780	.	C	T	1993.36	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26706824	.	C	T	563.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26706826	.	T	C	93633.73	PASS	AC=336;AF=0.20438;AN=1644;DS;set=Intersection
22	26707702	.	T	C	970.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26707735	.	G	T	2014.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26707892	.	G	A	1513.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26709694	.	A	G	7155.08	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26709720	.	T	C	988.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26709797	.	C	T	1684.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26709895	.	TAATTTGGCA	T	28014.58	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	26736393	.	C	A	818.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26736445	.	G	A	948.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26736617	.	C	T	827.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26743636	.	G	A	1304.72	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26743689	.	A	G	3088.13	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	26743751	.	A	T	390.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26743797	.	C	T	879.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26743809	.	C	T	1021.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26743866	.	A	T	4613.27	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26743875	.	G	A	667.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26747085	.	G	A	617.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26747216	.	C	A	301.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26747241	.	T	C	904.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26761396	.	G	C	2838.16	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26761444	.	C	T	1076.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26761474	.	C	T	1377.41	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26761572	.	G	T	192.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26769463	.	CG	C	349.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26771504	.	C	G	915.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26771563	.	G	A	2705.37	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26771580	.	A	G	424.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26771672	.	G	A	1782.67	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	26771682	.	G	A	703.95	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26773724	.	C	G	701.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26773758	.	C	A	5063.57	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26773759	.	G	A	835.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26776183	.	C	T	974.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26776221	.	C	G	10736.89	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	26776228	.	G	A	3198.24	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	26776246	.	T	C	1094.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26776311	.	C	T	9003.82	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	26829914	.	T	C	19675.24	PASS	AC=122;AF=0.07421;AN=1644;DS;set=Intersection
22	26829954	.	A	G	308.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26829980	.	C	T	418.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26830094	.	C	T	832.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26830148	.	A	C	856.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26830256	.	C	T	623.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26830285	.	A	G	31112.59	PASS	AC=59;AF=0.03589;AN=1644;DS;set=Intersection
22	26830316	.	G	A	47266.35	PASS	AC=118;AF=0.07178;AN=1644;DS;set=Intersection
22	26830388	.	G	A	859.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26830413	.	A	T	743.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26830478	.	A	G	292737.70	PASS	AC=1436;AF=0.87348;AN=1644;DS;set=Intersection
22	26830495	.	G	A	5378.72	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26838430	.	A	C	1384.32	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26838459	.	G	T	783.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26839055	.	C	T	920.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26839058	.	C	G	1013.65	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26839059	.	C	A	3197.25	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26839081	.	C	T	920.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26839084	.	G	A	894.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26839103	.	T	C	5011.55	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26839187	.	C	T	529.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26839213	.	G	A	10175.28	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	26849285	.	C	T	668.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26849364	.	G	A	3030.11	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26849395	.	C	T	843.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26849402	.	A	G	2737.49	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	26853787	.	G	A	95.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26853798	.	G	A	768.94	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	26853807	.	C	T	1022.20	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26853833	.	C	T	6845.89	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	26853881	.	G	A	7226.87	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	26853883	.	C	G	871.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26853897	.	C	T	2155.75	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26853905	.	C	A	171248.59	PASS	AC=1365;AF=0.83029;AN=1644;DS;set=Intersection
22	26853966	.	A	G	1566.24	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	26853980	.	T	C	90764.95	PASS	AC=1422;AF=0.86496;AN=1644;DS;set=Intersection
22	26854381	.	G	A	944.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26854441	.	G	A	252705.34	PASS	AC=1365;AF=0.83029;AN=1644;DS;set=Intersection
22	26859896	.	G	A	1612.18	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26859942	.	C	T	194857.93	PASS	AC=1323;AF=0.80474;AN=1644;DS;set=Intersection
22	26859956	.	C	G	1427.66	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26859981	.	C	A	923.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860015	.	G	A	1018.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860199	.	C	T	878.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860236	.	G	T	560.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860269	.	G	C	119178.42	PASS	AC=554;AF=0.33698;AN=1644;DS;set=Intersection
22	26860289	.	T	C	988.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860364	.	C	T	1119.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860437	.	A	T	911.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860535	.	G	C	10773.90	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	26860536	.	A	T	10650.17	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	26860582	.	G	A	1367.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860650	.	C	T	729.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860651	.	G	A	709.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860708	.	G	A	413.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26860801	.	CAA	C	1784.91	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26861429	.	C	T	840.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26861473	.	T	A	2140.58	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26861483	.	A	C,G,T	5974.23	PASS	AC=0,1,11;AF=0.00000,0.00061,0.00669;AN=1644;DS;set=Intersection
22	26861501	.	C	T	839.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26861514	.	G	A	9267.58	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	26861545	.	A	G	219522.01	PASS	AC=1382;AF=0.84063;AN=1644;DS;set=Intersection
22	26861556	.	AG	A	863.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26862153	.	C	A	268878.79	PASS	AC=1323;AF=0.80474;AN=1644;DS;set=Intersection
22	26862156	.	C	T	10105.44	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	26862184	.	C	G	7070.83	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26862202	.	C	T	20779.05	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	26862212	.	T	C	262222	PASS	AC=1323;AF=0.80474;AN=1644;DS;set=Intersection
22	26862218	.	G	A	636.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26864568	.	C	T	772.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26866641	.	A	G	237.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26866688	.	C	T	391.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26866711	.	G	A	755.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26866718	.	T	C	1458.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26866723	.	C	T	7288.51	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	26866724	.	G	A	2173.72	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26866738	.	C	A	686.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26866787	.	G	C	54.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26868324	.	T	C	2211.97	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26868359	.	G	A	900.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26868748	.	G	A	1851.34	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26868809	.	G	C	1505.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26868862	.	C	T	461.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26868938	.	T	C	770.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26868946	.	CT	C	2594.14	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26872985	.	T	C	1945.31	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26873006	.	G	T	778.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26873051	.	G	A	767.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26873114	.	G	A	522.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26875223	.	T	C	1305.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26875255	.	G	A	761.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26875370	.	C	T	19077.19	PASS	AC=64;AF=0.03893;AN=1644;DS;set=Intersection
22	26877706	.	T	A	1007.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26877774	.	C	G	728.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26879823	.	C	A	1607.09	PASS	AC=273;AF=0.7890;AN=346;set=Intersection
22	26879967	.	A	G	36.58	PASS	AC=3;AF=0.031;AN=98;set=Intersection
22	26884039	.	G	A	190700.78	PASS	AC=1023;AF=0.82633;AN=1238;DS;set=Intersection
22	26884042	.	C	T	1154.42	PASS	AC=1;AF=0.00081;AN=1238;DS;set=Intersection
22	26884152	.	C	T	1140.16	PASS	AC=2;AF=0.00151;AN=1322;DS;set=Intersection
22	26884266	.	G	C	1021.08	PASS	AC=1;AF=0.00077;AN=1294;DS;set=Intersection
22	26884278	.	TCTC	T	15271.88	PASS	AC=30;AF=0.02336;AN=1284;DS;set=Intersection
22	26884324	.	G	A	13316.87	PASS	AC=11;AF=0.00879;AN=1252;DS;set=Intersection
22	26886030	.	C	T	993.68	PASS	AC=1;AF=0.00087;AN=1154;DS;set=Intersection
22	26886069	.	G	A	1791.83	PASS	AC=2;AF=0.00172;AN=1162;DS;set=Intersection
22	26886189	.	T	C	429.53	PASS	AC=1;AF=0.00085;AN=1182;DS;set=Intersection
22	26886953	.	GT	G	113375.84	PASS	AC=1058;AF=0.81135;AN=1304;DS;set=Intersection
22	26886971	.	T	G	1355.80	PASS	AC=3;AF=0.00221;AN=1356;DS;set=Intersection
22	26886973	.	G	T	10681.39	PASS	AC=15;AF=0.01105;AN=1358;DS;set=Intersection
22	26887051	.	A	G	14004.33	PASS	AC=37;AF=0.02639;AN=1402;DS;set=Intersection
22	26887452	.	T	G	746.72	PASS	AC=1;AF=0.00078;AN=1284;DS;set=Intersection
22	26887510	.	T	G	638.35	PASS	AC=1;AF=0.00072;AN=1380;DS;set=Intersection
22	26888024	.	C	T	2932.90	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	26888033	.	G	A	6850	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	26888060	.	G	A	8121.88	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	26888204	.	G	A	1669.89	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26888258	.	G	A	5954.09	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26888264	.	G	A	954.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26888345	.	G	C	538.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26888377	.	G	A	565.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26890086	.	A	T	4573.06	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	26890155	.	T	C	1876.52	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	26890736	.	C	T	953.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26890927	.	T	C	970.32	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26892031	.	A	G	1111.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26892136	.	G	A	955.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26892229	.	G	A	862.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26892241	.	G	A	1058.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26892292	.	G	C	1358.64	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26892306	.	G	C	3020.31	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	26892659	.	C	T	750.60	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26892752	.	T	C	1783.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26892763	.	C	G	945.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26892844	.	T	C	1014.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26892898	.	C	T	29232.55	PASS	AC=104;AF=0.06326;AN=1644;DS;set=Intersection
22	26894879	.	G	A	23897.93	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	26894974	.	G	A	22671.97	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	26894985	.	C	T	292049.31	PASS	AC=1325;AF=0.80596;AN=1644;DS;set=Intersection
22	26895047	.	G	T	1384.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26895049	.	T	C	982.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26895061	.	G	A	356723.09	PASS	AC=1526;AF=0.92822;AN=1644;DS;set=Intersection
22	26895127	.	A	G	583.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26895128	.	G	A	681.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26895204	.	C	T	511.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26895227	.	C	T	680.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26895246	.	G	A	754.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26895248	.	T	G	566.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26895337	.	G	A	275727.13	PASS	AC=1317;AF=0.80109;AN=1644;DS;set=Intersection
22	26895387	.	T	G	1534.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26895496	.	T	C	444.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26895517	.	A	T	10673.31	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	26895528	.	C	T	509.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26895613	.	G	A	888.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26897819	.	A	C	1224.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26897834	.	A	T	2205.13	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26897845	.	G	C	11059.20	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	26899695	.	G	A	4967.98	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	26899784	.	AG	A	588.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26902371	.	T	C	11554.23	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	26902750	.	C	T	919.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26902835	.	G	A	1038.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26902890	.	G	A	795.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26906031	.	G	A	946.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26906086	.	G	A	570.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26906089	.	G	C	10930.57	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	26906159	.	G	A	781.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26906185	.	A	G	675.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26906216	.	C	T	3148.25	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	26924139	.	C	G	2674.40	PASS	AC=13;AF=0.00818;AN=1590;DS;set=Intersection
22	26924142	.	G	A	967.19	PASS	AC=1;AF=0.00063;AN=1598;DS;set=Intersection
22	26924149	.	C	T	45793.13	PASS	AC=434;AF=0.26990;AN=1608;DS;set=Intersection
22	26924177	.	T	C	2550.36	PASS	AC=4;AF=0.00246;AN=1628;DS;set=Intersection
22	26928613	.	G	A	11359.20	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	26928626	.	A	G	1148.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26928676	.	C	T	1214.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26932231	.	C	T	582.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26932305	.	G	A	649.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26932404	.	C	T	601.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26936723	.	G	A	8763.90	PASS	AC=40;AF=0.02433;AN=1644;set=Intersection
22	26936724	.	T	G	306.04	PASS	AC=2;AF=0.00122;AN=1644;set=Intersection
22	26936766	.	G	A	15087.85	PASS	AC=107;AF=0.06509;AN=1644;DS;set=Intersection
22	26936804	.	G	A	303.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26936828	.	C	T	375.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26936889	.	C	T	495.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26936897	.	G	A	49812.37	PASS	AC=213;AF=0.12956;AN=1644;DS;set=Intersection
22	26936928	.	G	C	1741	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	26936997	.	C	T	761.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26937033	.	G	A	683.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26937045	.	G	A	370.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26937049	.	C	T	843.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26937087	.	C	A	24042.24	PASS	AC=68;AF=0.04136;AN=1644;DS;set=Intersection
22	26937139	.	C	T	4929.57	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	26937198	.	C	G	2632.04	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	26937219	.	C	G	181.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26937244	.	C	T	423.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26937321	.	G	A	11613.07	PASS	AC=75;AF=0.04568;AN=1642;DS;set=Intersection
22	26937327	.	C	G	112626.82	PASS	AC=1589;AF=0.96772;AN=1642;DS;set=Intersection
22	26937420	.	G	A	241.72	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	26937450	.	C	T	388.74	PASS	AC=2;AF=0.00122;AN=1638;DS;set=Intersection
22	26995408	.	G	A	1568.47	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	26995448	.	G	T	887.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26995457	.	C	T	898.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26995462	.	G	A	461.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26995502	.	C	T	480.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26995524	.	C	T	1042.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26995572	.	C	T	748	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26995640	.	G	T	791.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	26997863	.	G	A	343.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26997874	.	G	A	871.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	26998002	.	C	T	479.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27003813	.	G	A	1444.33	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	27003886	.	A	G	837.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	27003902	.	G	A	976.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27003957	.	G	A	1165.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27004005	.	T	A	449.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27008020	.	G	T	22672.57	PASS	AC=75;AF=0.04562;AN=1644;DS;set=Intersection
22	27008022	.	C	T	559.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27008121	.	G	A	1089.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27008181	.	G	A	1033.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27008195	.	G	C	640.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27012067	.	G	A	936.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27012128	.	C	T	895.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	27012132	.	G	T	1539.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	27012210	.	C	T	1033.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	27012289	.	C	T	528.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27018631	.	G	C	742.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27019154	.	G	A	22385.06	PASS	AC=85;AF=0.05170;AN=1644;DS;set=Intersection
22	27019197	.	G	C	2685.44	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	27019219	.	G	A	722.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27019225	.	C	T	2592.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	27019235	.	G	A	1628.16	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	27019264	.	G	A	7056.28	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	27021401	.	G	A	87355.29	PASS	AC=354;AF=0.21533;AN=1644;DS;set=Intersection
22	27021409	.	C	T	25098.79	PASS	AC=102;AF=0.06204;AN=1644;DS;set=Intersection
22	27021425	.	A	G	231553.08	PASS	AC=947;AF=0.57603;AN=1644;DS;set=Intersection
22	27021457	.	T	C	333274.03	PASS	AC=1512;AF=0.91971;AN=1644;DS;set=Intersection
22	27021502	.	C	T	871.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	27021508	.	T	C	836.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27021589	.	A	G	27071.80	PASS	AC=102;AF=0.06204;AN=1644;DS;set=Intersection
22	27021611	.	C	A	573.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27021614	.	G	A	922.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27024258	.	C	T	6274.15	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	27024275	.	A	T	9341.30	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	27024296	.	C	T	982.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27024442	.	G	C	908.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27026286	.	G	A	18152.72	PASS	AC=74;AF=0.04501;AN=1644;DS;set=Intersection
22	27026290	.	T	C	1144.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	27026325	.	G	A	854.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	27026487	.	A	G	55.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	28146947	.	C	T	238.87	PASS	AC=1;AF=0.00071;AN=1410;DS;set=Intersection
22	28192719	.	G	T	550.30	PASS	AC=1;AF=0.00083;AN=1200;DS;set=Intersection
22	28192805	.	TGTC	T	969.93	PASS	AC=1;AF=0.00079;AN=1262;DS;set=Intersection
22	28192982	.	C	G	741.38	PASS	AC=5;AF=0.00422;AN=1186;DS;set=Intersection
22	28193097	.	C	T	7063.88	PASS	AC=41;AF=0.03694;AN=1110;set=Intersection
22	28193245	.	G	A	330.09	PASS	AC=2;AF=0.00183;AN=1090;set=Intersection
22	28193262	.	G	A	418.19	PASS	AC=1;AF=0.00093;AN=1080;set=Intersection
22	28193448	.	C	T	591.58	PASS	AC=1;AF=0.00089;AN=1118;DS;set=Intersection
22	28193458	.	A	G	612.25	PASS	AC=1;AF=0.00089;AN=1126;DS;set=Intersection
22	28193591	.	C	A	78.13	PASS	AC=1;AF=0.00089;AN=1118;DS;set=Intersection
22	28193715	.	G	A	259.50	PASS	AC=1;AF=0.00090;AN=1116;set=Intersection
22	28194663	.	C	A	42.07	PASS	AC=1;AF=0.0011;AN=900;set=Intersection
22	28194747	.	C	T	2126.58	PASS	AC=67;AF=0.05867;AN=1142;set=Intersection
22	28194880	.	CGCT	C	118.50	PASS	AC=43;AF=0.02901;AN=1482;set=Intersection
22	28194933	.	TTGC	T	148.83	PASS	AC=48;AF=0.03561;AN=1348;set=Intersection
22	28195186	.	G	C	81.07	PASS	AC=1;AF=0.00078;AN=1274;DS;set=Intersection
22	28195332	.	C	T	208.57	PASS	AC=2;AF=0.00170;AN=1178;set=Intersection
22	28195386	.	C	A	493.69	PASS	AC=17;AF=0.01351;AN=1258;set=Intersection
22	28195473	.	C	T	39.23	PASS	AC=2;AF=0.0021;AN=944;set=Intersection
22	28195715	.	C	A	134.30	PASS	AC=4;AF=0.00274;AN=1460;set=Intersection
22	28195977	.	G	T	468.71	PASS	AC=5;AF=0.00404;AN=1238;set=Intersection
22	28196205	.	C	T	52.14	PASS	AC=1;AF=0.00079;AN=1260;DS;set=Intersection
22	28196225	.	C	A	68.17	PASS	AC=1;AF=0.00080;AN=1254;DS;set=Intersection
22	28196226	.	C	G	202.12	PASS	AC=2;AF=0.00160;AN=1252;DS;set=Intersection
22	28196248	.	T	C	304.56	PASS	AC=2;AF=0.00168;AN=1190;DS;set=Intersection
22	28196290	.	C	G	94.73	PASS	AC=1;AF=0.00088;AN=1138;DS;set=Intersection
22	28196476	.	C	T	453.62	PASS	AC=1;AF=0.00080;AN=1252;DS;set=Intersection
22	28196548	.	AG	A	530.20	PASS	AC=3;AF=0.00248;AN=1208;DS;set=Intersection
22	28196550	.	G	A	295.96	PASS	AC=1;AF=0.00084;AN=1194;DS;set=Intersection
22	28256235	.	T	C	934.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	28269716	.	C	T	1986.96	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	28269798	.	G	A	948.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	28290521	.	A	C	824.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	28292528	.	G	A	1352.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	28293069	.	A	G	5151.85	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	28306905	.	T	TAA	714.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	28306930	.	G	A	929.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	28306948	.	T	C	1012.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	28307000	.	T	G	776.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	28310364	.	A	G	1329.45	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	29091147	.	A	C	4890.95	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	29091803	.	C	T	1039.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29091856	.	AG	A	2562.92	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29092870	.	C	T	458.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29095813	.	G	A	621.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29095818	.	T	C	3007.32	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29099571	.	A	G	429.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29105959	.	A	G	1425.48	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29105977	.	CAT	C	604.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29106058	.	C	T	669.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29106075	.	T	A	705.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29107858	.	G	A	1456.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29115403	.	G	C	241.59	PASS	AC=1;AF=0.00061;AN=1630;DS;set=Intersection
22	29115487	.	G	A	709.74	PASS	AC=6;AF=0.00373;AN=1608;DS;set=Intersection
22	29120956	.	T	C	239.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29120980	.	G	A	888.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29121018	.	C	T	607.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29121019	.	G	A	5782.49	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	29121087	.	A	G	5006.89	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29121207	.	G	A	1265.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29121226	.	C	T	830.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29121294	.	T	C	937.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29121360	.	A	T	1248.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29130347	.	G	GT	90622.39	PASS	AC=386;AF=0.23479;AN=1644;DS;set=Intersection
22	29130456	.	G	A	1372.69	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29130458	.	T	C	29970.31	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	29130637	.	C	T	638.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29130657	.	C	T	470.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29130695	.	C	T	785.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29138115	.	G	A	1992.88	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	29138293	.	T	C	555.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29138301	.	A	G	490.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29139897	.	G	A	938.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29139978	.	G	A	820.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29140559	.	T	C	1661.15	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29140662	.	C	T	725.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29141917	.	A	G	27901.88	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	29141927	.	G	T	926.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29141930	.	A	C	782.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29142035	.	T	C	1053.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29147195	.	A	G	709.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29147293	.	A	G	18926.86	PASS	AC=83;AF=0.05049;AN=1644;DS;set=Intersection
22	29147323	.	C	T	54.99	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	29153031	.	A	G	490.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29153049	.	GTC	G	772.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29169063	.	G	A	38.66	PASS	AC=4;AF=0.50;AN=8;set=Intersection
22	29169681	.	C	G	822.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29169709	.	A	G	637.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29169720	.	G	GTTCAC	346.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29169729	.	A	G	246.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29169761	.	T	G	945.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29169810	.	T	C	1166.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29176976	.	T	C	1028.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29177074	.	A	G	3212.85	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29177136	.	G	C	890.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29177200	.	C	T	36307.34	PASS	AC=235;AF=0.14294;AN=1644;DS;set=Intersection
22	29179482	.	CTTAA	C	1358.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29179647	.	C	T	1329.70	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29182070	.	G	C	18196.70	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	29182147	.	T	A	882.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29182169	.	C	T	2948.34	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29182278	.	G	A	3076.57	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29191576	.	C	A	1015.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29191668	.	T	C	2331.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29191998	.	G	A	993.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29192019	.	T	A	1055.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29192184	.	G	T	337.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29195174	.	A	G	456.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29196274	.	C	A	246.36	PASS	AC=10;AF=0.00711;AN=1406;set=Intersection
22	29196306	.	G	A	1294.68	PASS	AC=63;AF=0.04639;AN=1358;set=Intersection
22	29196494	.	C	T	544.79	PASS	AC=53;AF=0.0789;AN=672;set=Intersection
22	29196526	.	G	A	1147.60	PASS	AC=113;AF=0.1638;AN=690;set=Intersection
22	29196534	.	C	A	38.02	PASS	AC=6;AF=0.0096;AN=626;set=Intersection
22	29383081	.	A	G	3168.58	PASS	AC=6;AF=0.00493;AN=1216;DS;set=Intersection
22	29383193	.	A	C	1088.33	PASS	AC=1;AF=0.00079;AN=1262;DS;set=Intersection
22	29383196	.	A	G	12137.70	PASS	AC=29;AF=0.02291;AN=1266;DS;set=Intersection
22	29438603	.	G	T	277.55	PASS	AC=2;AF=0.00155;AN=1288;DS;set=Intersection
22	29439452	.	G	A	954.06	PASS	AC=1;AF=0.00083;AN=1206;DS;set=Intersection
22	29440848	.	C	T	1708.04	PASS	AC=4;AF=0.00290;AN=1378;DS;set=Intersection
22	29440901	.	G	A	704.49	PASS	AC=2;AF=0.00150;AN=1332;DS;set=Intersection
22	29442666	.	G	A	10938.92	PASS	AC=13;AF=0.01030;AN=1262;DS;set=Intersection
22	29444336	.	G	A	477.88	PASS	AC=1;AF=0.00072;AN=1398;DS;set=Intersection
22	29444368	.	C	T	429.58	PASS	AC=3;AF=0.00209;AN=1434;DS;set=Intersection
22	29444445	.	C	A	2011.27	PASS	AC=7;AF=0.00480;AN=1458;DS;set=Intersection
22	29445171	.	C	T	1236.17	PASS	AC=1;AF=0.00071;AN=1406;DS;set=Intersection
22	29445258	.	C	T	1923.71	PASS	AC=3;AF=0.00219;AN=1372;DS;set=Intersection
22	29445468	.	C	T	447.40	PASS	AC=2;AF=0.00142;AN=1408;DS;set=Intersection
22	29445676	.	G	A	355.78	PASS	AC=2;AF=0.00156;AN=1280;DS;set=Intersection
22	29445841	.	G	A	465.59	PASS	AC=1;AF=0.00082;AN=1214;DS;set=Intersection
22	29445906	.	G	A	1010.62	PASS	AC=1;AF=0.00082;AN=1216;DS;set=Intersection
22	29446059	.	C	T	612.78	PASS	AC=1;AF=0.00090;AN=1112;DS;set=Intersection
22	29446077	.	G	C	800.38	PASS	AC=5;AF=0.00447;AN=1118;DS;set=Intersection
22	29446367	.	T	C	345.36	PASS	AC=1;AF=0.00085;AN=1172;set=Intersection
22	29446401	.	C	T	461.87	PASS	AC=3;AF=0.00260;AN=1152;DS;set=Intersection
22	29446403	.	C	T	566.84	PASS	AC=4;AF=0.00348;AN=1150;DS;set=Intersection
22	29446543	.	G	A	103.65	PASS	AC=1;AF=0.00087;AN=1154;DS;set=Intersection
22	29446601	.	C	T	72.58	PASS	AC=1;AF=0.00090;AN=1112;set=Intersection
22	29446611	.	A	C	35606.73	PASS	AC=610;AF=0.53792;AN=1134;set=Intersection
22	29446693	.	C	T	341.59	PASS	AC=2;AF=0.00169;AN=1182;set=Intersection
22	29446695	.	G	A	493.21	PASS	AC=7;AF=0.00595;AN=1176;set=Intersection
22	29446787	.	C	G	220.35	PASS	AC=1;AF=0.00082;AN=1220;set=Intersection
22	29446801	.	C	G	237.24	PASS	AC=1;AF=0.00080;AN=1250;set=Intersection
22	29446886	.	G	A	256.89	PASS	AC=1;AF=0.00082;AN=1224;DS;set=Intersection
22	29446903	.	C	A	237.99	PASS	AC=1;AF=0.00080;AN=1252;DS;set=Intersection
22	29446975	.	T	C	71031.09	PASS	AC=570;AF=0.42986;AN=1326;DS;set=Intersection
22	29454778	.	G	A	52502.76	PASS	AC=114;AF=0.06934;AN=1644;DS;set=Intersection
22	29454909	.	G	C	787.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29454948	.	C	T	624.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29454998	.	G	A	1481.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29455017	.	G	A	1027.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29455048	.	G	T	1963.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29455058	.	G	A	775.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29455084	.	C	T	7534.84	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	29455139	.	G	A	951.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29456360	.	C	T	54671.46	PASS	AC=99;AF=0.06022;AN=1644;DS;set=Intersection
22	29456407	.	C	G	704.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29456467	.	T	C	1023.26	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29456529	.	C	T	2277.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29456545	.	C	G	1014.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29456671	.	G	A	2444.37	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	29456699	.	A	G	63232.45	PASS	AC=198;AF=0.12044;AN=1644;DS;set=Intersection
22	29456731	.	G	A	785.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29456733	.	T	C	205581.93	PASS	AC=791;AF=0.48114;AN=1644;DS;set=Intersection
22	29456786	.	G	A	950.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29456796	.	A	G	8256.37	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	29456797	.	G	A	1646.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29456871	.	C	T	1903.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29457808	.	G	C	740.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29469130	.	A	C	62.27	PASS	AC=11;AF=0.611;AN=18;set=Intersection
22	29469262	.	C	G	61.17	PASS	AC=6;AF=0.0185;AN=324;set=Intersection
22	29490246	.	A	G	300.03	PASS	AC=1;AF=0.00083;AN=1200;DS;set=Intersection
22	29490261	.	A	G	797.49	PASS	AC=1;AF=0.00082;AN=1226;DS;set=Intersection
22	29490378	.	AG	A	913.73	PASS	AC=2;AF=0.00156;AN=1278;DS;set=Intersection
22	29490381	.	G	C	874.30	PASS	AC=2;AF=0.00157;AN=1270;DS;set=Intersection
22	29490457	.	CTCT	C	2606.97	PASS	AC=4;AF=0.00312;AN=1282;DS;set=Intersection
22	29494985	.	C	T	11968.90	PASS	AC=19;AF=0.01448;AN=1312;DS;set=Intersection
22	29517463	.	G	T	29579.05	PASS	AC=79;AF=0.04805;AN=1644;DS;set=Intersection
22	29521226	.	G	A	1461.17	PASS	AC=2;AF=0.00130;AN=1540;DS;set=Intersection
22	29521228	.	G	C	578.43	PASS	AC=1;AF=0.00065;AN=1540;DS;set=Intersection
22	29521292	.	C	T	17943.83	PASS	AC=21;AF=0.01413;AN=1486;DS;set=Intersection
22	29521440	.	C	T	11954.98	PASS	AC=17;AF=0.01189;AN=1430;DS;set=Intersection
22	29533437	.	C	T	5117.37	PASS	AC=7;AF=0.00545;AN=1284;DS;set=Intersection
22	29533499	.	G	A	37470.76	PASS	AC=148;AF=0.11916;AN=1242;DS;set=Intersection
22	29533536	.	G	A	823.80	PASS	AC=2;AF=0.00163;AN=1224;DS;set=Intersection
22	29533551	.	C	T	392.12	PASS	AC=1;AF=0.00079;AN=1258;DS;set=Intersection
22	29533553	.	C	T	5864.35	PASS	AC=8;AF=0.00639;AN=1252;DS;set=Intersection
22	29533572	.	C	G	37668.04	PASS	AC=150;AF=0.11538;AN=1300;DS;set=Intersection
22	29533687	.	G	C	147.33	PASS	AC=3;AF=0.00230;AN=1302;DS;set=Intersection
22	29533703	.	C	A	4418.76	PASS	AC=13;AF=0.00995;AN=1306;DS;set=Intersection
22	29534621	.	A	G	8043.21	PASS	AC=17;AF=0.01218;AN=1396;DS;set=Intersection
22	29534635	.	G	A	1761.31	PASS	AC=3;AF=0.00218;AN=1378;DS;set=Intersection
22	29534659	.	G	T	899.01	PASS	AC=1;AF=0.00074;AN=1360;DS;set=Intersection
22	29534664	.	C	T	8506.21	PASS	AC=13;AF=0.00953;AN=1364;DS;set=Intersection
22	29534832	.	T	C	13828.56	PASS	AC=21;AF=0.01544;AN=1360;DS;set=Intersection
22	29536238	.	A	G	1183.87	PASS	AC=1;AF=0.00080;AN=1252;DS;set=Intersection
22	29536343	.	C	T	23939.30	PASS	AC=35;AF=0.02765;AN=1266;DS;set=Intersection
22	29536383	.	C	T	340.62	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	29537940	.	G	A	1171.30	PASS	AC=2;AF=0.00162;AN=1234;DS;set=Intersection
22	29537965	.	G	A	7823.67	PASS	AC=10;AF=0.00826;AN=1210;DS;set=Intersection
22	29537989	.	G	A	1783.34	PASS	AC=3;AF=0.00247;AN=1216;DS;set=Intersection
22	29602009	.	G	A	66.28	PASS	AC=4;AF=0.0110;AN=364;set=Intersection
22	29602136	.	C	T	156.67	PASS	AC=25;AF=0.0278;AN=898;set=Intersection
22	29602159	.	T	C	207.48	PASS	AC=18;AF=0.0199;AN=906;set=Intersection
22	29610881	.	G	A	839.42	PASS	AC=1;AF=0.00065;AN=1536;DS;set=Intersection
22	29611019	.	C	T	35.34	PASS	AC=1;AF=0.00063;AN=1594;DS;set=Intersection
22	29621128	.	C	G	211788.11	PASS	AC=689;AF=0.41910;AN=1644;DS;set=Intersection
22	29621173	.	G	A	4940.83	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	29621188	.	G	A	451.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29621222	.	C	T	980.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29627111	.	G	A	2215.27	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29627151	.	C	G	730.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29627166	.	C	T	716.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29627532	.	G	T	34.72	PASS	AC=2;AF=0.00137;AN=1462;set=Intersection
22	29627536	.	C	G	4388.46	PASS	AC=93;AF=0.06405;AN=1452;set=Intersection
22	29627567	.	T	C	71.13	PASS	AC=1;AF=0.00066;AN=1524;DS;set=Intersection
22	29627577	.	C	G	733	PASS	AC=9;AF=0.00587;AN=1534;DS;set=Intersection
22	29628228	.	G	A	407.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29628260	.	C	G	2934.34	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	29628283	.	G	C	79.46	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	29628412	.	A	G	48.62	PASS	AC=1;AF=0.00061;AN=1630;set=Intersection
22	29629375	.	A	G	1896.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29629402	.	C	G	604.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29629432	.	G	A	2829.36	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29629433	.	C	A	2765.68	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29629573	.	C	T	786.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29629574	.	G	A	2316.51	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29629600	.	C	T	874.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29629632	.	G	T	238.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29630098	.	A	G	327.79	PASS	AC=3;AF=0.00183;AN=1638;DS;set=Intersection
22	29630187	.	G	C	5823.21	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	29630215	.	G	A	96.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29630267	.	G	A	815.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29630269	.	C	T	5075.48	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	29630275	.	TCTC	T	749.81	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29630300	.	C	T	667.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29630337	.	G	A	62554.16	PASS	AC=269;AF=0.16363;AN=1644;DS;set=Intersection
22	29630349	.	C	T	403.47	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29630359	.	C	T	960.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29639484	.	C	T	945.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29650178	.	T	C	903.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29650296	.	C	T	5790	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	29654770	.	C	T	1459.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29654833	.	C	T	1933.75	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	29654849	.	C	T	201.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29654946	.	C	T	413.55	PASS	AC=5;AF=0.00306;AN=1632;DS;set=Intersection
22	29656145	.	G	A	484.27	PASS	AC=4;AF=0.00244;AN=1636;set=Intersection
22	29656159	.	G	A	130.61	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	29656171	.	C	T	182.60	PASS	AC=1;AF=0.00062;AN=1624;set=Intersection
22	29656209	.	C	T	147.96	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	29656238	.	G	C	471.15	PASS	AC=2;AF=0.00122;AN=1640;set=Intersection
22	29656240	.	G	A	872.05	PASS	AC=5;AF=0.00305;AN=1640;set=Intersection
22	29656251	.	G	T	340.39	PASS	AC=3;AF=0.00182;AN=1644;set=Intersection
22	29656253	.	G	A	178.23	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	29656359	.	G	A	202.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29656389	.	G	T	34708.77	PASS	AC=344;AF=0.20925;AN=1644;DS;set=Intersection
22	29656431	.	C	T	857.90	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	29656568	.	G	C	259.16	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	29656608	.	G	A	345.22	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	29656697	.	C	A	357.99	PASS	AC=2;AF=0.00122;AN=1642;set=Intersection
22	29656706	.	T	C	634.15	PASS	AC=6;AF=0.00366;AN=1640;set=Intersection
22	29656842	.	C	A	46.21	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	29659797	.	C	T	1347.09	PASS	AC=21;AF=0.01321;AN=1590;set=Intersection
22	29659830	.	G	A	68.42	PASS	AC=3;AF=0.00190;AN=1580;set=Intersection
22	29659845	.	C	T	69.77	PASS	AC=1;AF=0.00063;AN=1584;set=Intersection
22	29659846	.	G	A	87.82	PASS	AC=6;AF=0.00379;AN=1582;set=Intersection
22	29659878	.	T	G	135.53	PASS	AC=1;AF=0.00065;AN=1548;set=Intersection
22	29659951	.	G	A	41.80	PASS	AC=1;AF=0.00066;AN=1522;set=Intersection
22	29659953	.	G	A	58.34	PASS	AC=1;AF=0.00066;AN=1522;set=Intersection
22	29659960	.	C	T	8151.28	PASS	AC=344;AF=0.22251;AN=1546;set=Intersection
22	29659996	.	T	C	88.92	PASS	AC=2;AF=0.00126;AN=1592;set=Intersection
22	29660099	.	G	A	221.67	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	29661507	.	G	A	324.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29661652	.	T	C	696.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29664301	.	A	G	760.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29664307	.	C	G	948.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29664323	.	A	G	997.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29668189	.	C	T	867.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29668199	.	C	T	42592.38	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	29668215	.	C	T	787.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29668263	.	G	A	1044.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29668264	.	T	C	1285.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29668432	.	AATAATTAC	A	13428.11	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	29668433	.	A	G	2113.84	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29669693	.	T	C	177448.83	PASS	AC=577;AF=0.35097;AN=1644;DS;set=Intersection
22	29669712	.	C	G	26919.69	PASS	AC=58;AF=0.03528;AN=1644;DS;set=Intersection
22	29669713	.	G	GT	6159.16	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	29669885	.	G	A	1041.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29669901	.	T	C	1572.73	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	29678394	.	C	G	801.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29682903	.	C	G	1650.89	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29682930	.	G	A	613.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29683035	.	G	A	1555.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29683098	.	A	G	2919.42	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	29684676	.	G	A	318.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29688208	.	G	A	4459.90	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29688446	.	A	G	1319.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29688460	.	C	G	6999	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	29688598	.	C	T	955.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29688632	.	T	G	70122.30	PASS	AC=253;AF=0.15389;AN=1644;DS;set=Intersection
22	29692205	.	C	T	961.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29692240	.	A	G	2580.05	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29692328	.	A	G	1082.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29692364	.	A	T	1409.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29693776	.	G	A	1628.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29693794	.	G	C	961.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29693915	.	G	A	5918.26	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	29693954	.	C	T	1092.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29694684	.	A	G	842.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29694688	.	A	G	1154.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29694707	.	G	C	1001.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29694892	.	A	G	810.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29694913	.	C	T	459.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29694917	.	A	G	7591.52	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	29695192	.	G	A	1055.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29695545	.	G	A	1162.50	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	29695737	.	C	T	805.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29695761	.	C	T	517.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29695865	.	G	A	588.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29695871	.	C	T	6722.25	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	29695872	.	G	A	613.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29695875	.	A	G	64.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29696069	.	C	T	9269.59	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	29696085	.	A	C	900.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29704125	.	C	T	22574.90	PASS	AC=548;AF=0.34122;AN=1606;set=Intersection
22	29704131	.	G	A	240.65	PASS	AC=5;AF=0.00307;AN=1630;set=Intersection
22	29704164	.	G	A	281.67	PASS	AC=3;AF=0.00183;AN=1640;set=Intersection
22	29704255	.	A	T	95.08	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	29704333	.	C	T	128.41	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	29704409	.	C	T	144.78	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	29704627	.	C	T	303.83	PASS	AC=5;AF=0.00307;AN=1628;set=Intersection
22	29704642	.	G	A	57.27	PASS	AC=1;AF=0.00062;AN=1620;set=Intersection
22	29704662	.	C	G	2308.97	PASS	AC=49;AF=0.03021;AN=1622;set=Intersection
22	29704688	.	C	T	130.43	PASS	AC=1;AF=0.00062;AN=1626;set=Intersection
22	29704761	.	G	A	53.29	PASS	AC=1;AF=0.00065;AN=1538;set=Intersection
22	29706514	.	C	G	1420.78	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29706550	.	G	A	125.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29706560	.	C	T	14554.05	PASS	AC=69;AF=0.04197;AN=1644;DS;set=Intersection
22	29706587	.	G	A	175.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29706784	.	C	T	772.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29706796	.	G	GCCTGT	2211.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29706885	.	C	T	4545.65	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	29706907	.	G	T	562.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29706919	.	G	A	2737.28	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29706927	.	C	G	8824.57	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	29709359	.	G	A	607.19	PASS	AC=32;AF=0.03065;AN=1044;set=Intersection
22	29709518	.	G	T	149.14	PASS	AC=2;AF=0.00145;AN=1384;set=Intersection
22	29709601	.	G	A	148.63	PASS	AC=2;AF=0.00129;AN=1552;set=Intersection
22	29709804	.	T	A	373.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29709844	.	G	A	218.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29709989	.	G	A	4640	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	29711158	.	G	A	78.43	PASS	AC=1;AF=0.00073;AN=1378;set=Intersection
22	29711247	.	G	C	147.40	PASS	AC=55;AF=0.0982;AN=560;set=Intersection
22	29724792	.	T	C	13351.86	PASS	AC=64;AF=0.03902;AN=1640;DS;set=Intersection
22	29724916	.	C	A	10844.29	PASS	AC=21;AF=0.01280;AN=1640;DS;set=Intersection
22	29725674	.	C	T	615.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29726339	.	G	A	746.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29726356	.	G	A	243.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29726395	.	C	T	1004.24	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29726466	.	G	A	738.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29726601	.	G	A	314.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29726624	.	G	A	1943.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29727535	.	G	C	564.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29727729	.	C	T	736.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29727866	.	C	T	113858.34	PASS	AC=902;AF=0.54866;AN=1644;DS;set=Intersection
22	29727881	.	G	C	607.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29727886	.	T	C	140204.94	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	29727944	.	T	G	354.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29730232	.	G	C	616.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29730346	.	G	A	804.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29730446	.	C	T	505.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29734941	.	C	G	926.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29734950	.	CCCG	C	2280.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29734952	.	C	T	39379.07	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	29735000	.	T	A	738.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29735056	.	C	T	1227.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29735065	.	C	T	1922.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29735105	.	G	A	806.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29735733	.	T	C	211.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29736660	.	A	G	5289.10	PASS	AC=35;AF=0.02145;AN=1632;DS;set=Intersection
22	29736756	.	C	T	91.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29736816	.	G	C	455.24	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	29737470	.	G	A	657.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29737521	.	C	T	529.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29737526	.	C	A	706.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29737551	.	T	C	2324.35	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29737579	.	C	T	1683.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29737773	.	A	G	636.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29737788	.	G	C	12846.91	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	29738254	.	G	A	1931.56	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	29738399	.	G	T	411.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29738400	.	A	G	1103.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29745417	.	C	T	915.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29746062	.	G	A	1010.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29746186	.	C	G	1016.78	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29747112	.	C	T	1357.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29747266	.	A	G	16088.99	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	29747644	.	T	C	292.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29747684	.	C	T	4434.77	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	29747700	.	G	A	1061.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29747766	.	G	A	342.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29747778	.	G	A	1113.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29750596	.	C	A	863.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29750602	.	G	A	510.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29750620	.	C	T	3207.31	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	29750695	.	G	A	1230.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29750757	.	A	G	1557.86	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29752399	.	C	T	427.05	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29752404	.	A	C	264.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29752566	.	C	T	227.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29752621	.	G	A	12917.22	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	29754665	.	A	C	743.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29754707	.	T	C	503.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29754721	.	G	T	612.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29754730	.	G	A	1057.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29754770	.	T	C	817.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29754793	.	G	A	662.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29754937	.	G	T	840.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29754996	.	G	A	1205.63	PASS	AC=5;AF=0.00305;AN=1638;DS;set=Intersection
22	29755802	.	C	T	4339.32	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	29755803	.	G	A	834.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29755888	.	T	C	305605.67	PASS	AC=1053;AF=0.64051;AN=1644;DS;set=Intersection
22	29755964	.	G	A	641.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29834741	.	G	A	470.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29834747	.	G	A	1090.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29834766	.	A	G	37499.71	PASS	AC=166;AF=0.10097;AN=1644;DS;set=Intersection
22	29834957	.	C	T	757.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29834993	.	C	G	542.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29835060	.	T	C	106750.03	PASS	AC=236;AF=0.14355;AN=1644;DS;set=Intersection
22	29835175	.	C	T	503.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29835187	.	G	A	23742.19	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	29837564	.	ACTT	A	26626.45	PASS	AC=434;AF=0.26399;AN=1644;DS;set=Intersection
22	29837566	.	TTCC	T	143621.45	PASS	AC=480;AF=0.29197;AN=1644;DS;set=Intersection
22	29837572	.	CTCA	C	32115.99	PASS	AC=430;AF=0.26156;AN=1644;DS;set=Intersection
22	29837583	.	C	T	46587.07	PASS	AC=58;AF=0.03528;AN=1644;DS;set=Intersection
22	29837599	.	C	T	24103.22	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	29837638	.	G	A	9039.01	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	29837978	.	C	T	745.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29838068	.	C	T	760.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29838088	.	G	T	19542.74	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	29838141	.	T	G	857.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29876272	.	G	A	48.02	PASS	AC=1;AF=0.0012;AN=832;set=Intersection
22	29876374	.	T	C	753.73	PASS	AC=32;AF=0.0341;AN=938;set=Intersection
22	29876548	.	G	A	2236.97	PASS	AC=55;AF=0.04068;AN=1352;set=Intersection
22	29876806	.	A	C	502.51	PASS	AC=15;AF=0.0375;AN=400;set=Intersection
22	29877010	.	G	T	965.72	PASS	AC=38;AF=0.0469;AN=810;set=Intersection
22	29877061	.	G	C	57.45	PASS	AC=1;AF=0.0011;AN=876;set=Intersection
22	29879534	.	C	A	761.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29881828	.	C	T	48806.27	PASS	AC=162;AF=0.09854;AN=1644;DS;set=Intersection
22	29881844	.	G	A	980.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29881863	.	G	C	499.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29881877	.	T	G	2214.50	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29881884	.	G	A	226887.58	PASS	AC=1612;AF=0.98054;AN=1644;DS;set=Intersection
22	29884863	.	C	T	1120.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29884976	.	G	C	996.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29885016	.	G	A	31509.42	PASS	AC=66;AF=0.04015;AN=1644;DS;set=Intersection
22	29885075	.	G	A	8756.82	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	29885127	.	G	GAAACAA	2746.62	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29885256	.	G	A	1017.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29885352	.	C	T	10420.60	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	29885368	.	C	T	776.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29885369	.	C	T	5655.82	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	29885412	.	C	T	11526.80	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	29885543	.	CAAGTCTCCAACGAAGGAGGAAGCA	C	511.51	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	29885569	.	A	AGTCCCCTGAGAAGGCCAA	459030.42	PASS	AC=1146;AF=0.69708;AN=1644;DS;set=Intersection
22	29885580	.	AAGGCCAAGTCCCCAGAGAAGGAAG	A	216054.35	PASS	AC=736;AF=0.44769;AN=1644;DS;set=Intersection
22	29885598	.	AAGGAAG	A	85434.29	PASS	AC=685;AF=0.41667;AN=1644;DS;set=Intersection
22	29885735	.	AAAGTCCCCTGAGAAGGCC	A	0	PASS	AC=0;AF=0.00000;AN=1644;DS;set=Intersection
22	29885777	.	AAAGTCCCCTGAGAAGGCC	A	3325.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29885936	.	A	C	3033.53	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29885956	.	C	G	1144.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29886043	.	A	C	46990.98	PASS	AC=190;AF=0.11557;AN=1644;DS;set=Intersection
22	29886118	.	C	T	809.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29886158	.	G	A	860.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29886200	.	G	A	784.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29886341	.	C	T	8056.30	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	29886343	.	C	T	842.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29886382	.	A	G	1853.87	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29886386	.	C	T	4543.73	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	29886406	.	C	T	731.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29886413	.	A	G	291170.07	PASS	AC=1362;AF=0.82847;AN=1644;DS;set=Intersection
22	29886714	.	G	A	147.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29904439	.	C	A	1128.80	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29904479	.	G	T	767.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29904515	.	G	T	606	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29904519	.	T	C	71883.65	PASS	AC=356;AF=0.21655;AN=1644;DS;set=Intersection
22	29907077	.	C	A	2531.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29907200	.	C	T	665.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29907273	.	C	T	994.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29907284	.	G	C	1097.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29907322	.	T	C	589.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29907965	.	C	G	488.24	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29907987	.	T	C	2420.10	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29908002	.	G	T	641.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29908025	.	G	A	18177.61	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	29908072	.	C	T	117329.14	PASS	AC=454;AF=0.27616;AN=1644;DS;set=Intersection
22	29908154	.	G	T	148415.99	PASS	AC=861;AF=0.52372;AN=1644;DS;set=Intersection
22	29912968	.	T	C	105078.62	PASS	AC=208;AF=0.12652;AN=1644;DS;set=Intersection
22	29912993	.	C	T	104152.41	PASS	AC=208;AF=0.12652;AN=1644;DS;set=Intersection
22	29913025	.	C	T	652.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29913033	.	T	C	8473.37	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	29913272	.	C	T	175761.12	PASS	AC=860;AF=0.52311;AN=1644;DS;set=Intersection
22	29913278	.	C	T	7713.47	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	29913377	.	G	A	1546.81	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29913379	.	C	T	1258.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29913380	.	G	A	2019.57	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29915144	.	C	T	57521.63	PASS	AC=406;AF=0.24696;AN=1644;DS;set=Intersection
22	29916963	.	G	A	113935.65	PASS	AC=207;AF=0.12591;AN=1644;DS;set=Intersection
22	29917009	.	G	C	1789.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29917122	.	C	T	767.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29921795	.	G	A	4670.87	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29921813	.	C	T	823.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29924156	.	C	T	935.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29924212	.	T	C	111522.47	PASS	AC=458;AF=0.27859;AN=1644;DS;set=Intersection
22	29924481	.	AGAG	A	24040.29	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	29925129	.	C	T	830.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29925140	.	C	T	4539.59	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	29925221	.	C	T	101650.99	PASS	AC=207;AF=0.12591;AN=1644;DS;set=Intersection
22	29925239	.	AG	A	862.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29927821	.	A	G	739.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29927836	.	C	T	5280.18	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	29927873	.	G	A	1371.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29927912	.	T	A	422.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29927922	.	T	C	827.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29927961	.	A	G	2584.13	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	29927967	.	C	G	10754.67	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	29927979	.	C	A	2031.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29932568	.	G	C	429.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29935299	.	C	T	565.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29935380	.	T	C	515.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29935472	.	A	G	647.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29935491	.	C	G	459.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29935507	.	A	T	801.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29938798	.	G	A	284.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29938807	.	G	T	8553.58	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	29938976	.	G	A	999.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29939379	.	G	A	1675.39	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29939387	.	G	A	653.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29939391	.	G	T	8570.17	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	29939414	.	C	T	4540.79	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	29940404	.	T	A	487.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29940556	.	G	C	5369.92	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	29945158	.	G	A	849.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29945186	.	C	A	654.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29951963	.	A	G	871.90	PASS	AC=1;AF=0.00068;AN=1466;DS;set=Intersection
22	29952016	.	CAG	C	44255.63	PASS	AC=289;AF=0.20352;AN=1420;DS;set=Intersection
22	29954815	.	T	C	1019.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29954848	.	G	C	9469.98	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	29954905	.	G	A	959.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29954954	.	G	T	871.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29954961	.	C	T	390.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29956742	.	G	A	2107.85	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29956860	.	G	A	962.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29957117	.	A	C	1493.32	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	29957137	.	CCA	C	12016.89	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	29957194	.	G	A	870.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29957474	.	G	A	1033.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29957570	.	G	A	83832.65	PASS	AC=348;AF=0.21168;AN=1644;DS;set=Intersection
22	29957676	.	G	A	879.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29957796	.	C	T	2745.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29957826	.	G	A	758.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29957894	.	C	T	3016.05	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	29965168	.	G	C	26365.09	PASS	AC=141;AF=0.08577;AN=1644;DS;set=Intersection
22	29965308	.	C	T	810.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29966242	.	C	G	1060.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29966409	.	G	A	556.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29966487	.	G	A	1054.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	29966549	.	G	A	1159.17	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29966558	.	T	C	1146.69	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	29976952	.	C	T	697.41	PASS	AC=32;AF=0.0361;AN=886;set=Intersection
22	29977067	.	G	A	31.67	PASS	AC=1;AF=0.0011;AN=928;set=Intersection
22	29999970	.	G	A	333.26	PASS	AC=1;AF=0.00061;AN=1630;DS;set=Intersection
22	29999986	.	C	G	50.77	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	30032880	.	C	T	966.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30035076	.	C	T	1178.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30038152	.	A	C	145121.19	PASS	AC=445;AF=0.27068;AN=1644;DS;set=Intersection
22	30054302	.	T	C	6723.36	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	30057159	.	G	A	755.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30057174	.	T	C	936.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30057201	.	A	G	707.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30060945	.	C	T	857.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30060962	.	C	G	102.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30061050	.	G	A	825.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30064290	.	A	G	857.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30064307	.	C	T	624.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30064339	.	C	T	869.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30064440	.	G	A	229.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30064474	.	T	TG	261.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30067776	.	C	A	140.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30067780	.	G	A	1549.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30067811	.	G	A	638.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30067928	.	C	T	8194.11	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	30067973	.	T	C	1078.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30069252	.	C	T	116.11	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	30069504	.	G	A	250.38	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	30070923	.	C	T	546.72	PASS	AC=1;AF=0.00062;AN=1624;DS;set=Intersection
22	30074278	.	A	G	1176.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30074349	.	G	A	515.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30077384	.	A	G	1353.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30077423	.	G	A	1739.89	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30078975	.	T	A	817.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30079091	.	G	A	685.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30090756	.	G	A	325.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30090795	.	G	A	695.26	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30123605	.	G	A	799.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30123615	.	G	A	1045.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30123751	.	C	T	14211.74	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	30123802	.	C	T	8689.95	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	30123833	.	T	C	153.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30124614	.	A	T	140314.05	PASS	AC=789;AF=0.47993;AN=1644;DS;set=Intersection
22	30124708	.	G	A	809.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30124780	.	T	C	24146.50	PASS	AC=60;AF=0.03650;AN=1644;DS;set=Intersection
22	30125023	.	C	T	1348.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30125032	.	CCCCT	C	12970.03	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	30125235	.	G	A	111.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30125381	.	G	A	326.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30125422	.	C	T	345.62	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	30125490	.	G	A	800.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30125596	.	C	T	18520.51	PASS	AC=118;AF=0.07178;AN=1644;DS;set=Intersection
22	30127189	.	T	TG	597.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30127365	.	G	A	18729.97	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	30127367	.	G	T	11708.73	PASS	AC=86;AF=0.05231;AN=1644;DS;set=Intersection
22	30134285	.	G	T	217.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30134299	.	G	A	964.54	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30134366	.	G	A	805.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30134381	.	C	T	737.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30136606	.	C	T	2537.22	PASS	AC=7;AF=0.00427;AN=1638;DS;set=Intersection
22	30136701	.	G	C	384.83	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	30136748	.	G	C	180.62	PASS	AC=3;AF=0.00183;AN=1640;DS;set=Intersection
22	30136752	.	G	A	55.08	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	30138497	.	G	A	11444.11	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	30163403	.	T	C	419.89	PASS	AC=1;AF=0.00085;AN=1174;DS;set=Intersection
22	30163526	.	A	G	42285.24	PASS	AC=147;AF=0.12586;AN=1168;DS;set=Intersection
22	30163571	.	G	A,T	1084.35	PASS	AC=4,1;AF=0.00337,0.00084;AN=1188;DS;set=Intersection
22	30165686	.	A	G	243.01	PASS	AC=1;AF=0.00077;AN=1298;set=Intersection
22	30184982	.	C	G	2518.60	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30185114	.	C	T	959.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30185198	.	C	T	681.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30188532	.	T	A	897.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30189343	.	C	T	4903.16	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	30189346	.	C	T	402.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30189497	.	T	A	10418.58	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	30189504	.	G	A	1786.16	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30189592	.	C	T	5272.79	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	30189642	.	C	T	18194.86	PASS	AC=69;AF=0.04197;AN=1644;DS;set=Intersection
22	30196931	.	T	C	6564.38	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	30197031	.	T	C	2744.90	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30197937	.	G	A	85.87	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	30197953	.	C	T	33.40	PASS	AC=1;AF=0.00061;AN=1628;DS;set=Intersection
22	30198025	.	C	T	27613.30	PASS	AC=152;AF=0.09246;AN=1644;DS;set=Intersection
22	30198063	.	G	A	1447.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30198126	.	C	T	800.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30198183	.	G	A	2817.77	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30198225	.	G	T	1456.10	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	30200616	.	C	G	5666.92	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	30200621	.	A	G	673.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30200643	.	T	A	1332.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30200696	.	G	A	756.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30200713	.	G	A	20196.44	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	30200760	.	T	C	1753.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30200761	.	C	G	38341.98	PASS	AC=84;AF=0.05109;AN=1644;DS;set=Intersection
22	30200801	.	G	C	1176.26	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30202249	.	G	A	1800.71	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30202518	.	G	A	278.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30202556	.	C	T	1916.05	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30202736	.	G	C	9259.52	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	30202774	.	G	C	174855.44	PASS	AC=863;AF=0.52494;AN=1644;DS;set=Intersection
22	30202795	.	A	C	781.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30202866	.	G	A	830.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30202898	.	G	T	5231.08	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	30209369	.	T	C	64409.31	PASS	AC=114;AF=0.06934;AN=1644;DS;set=Intersection
22	30209374	.	C	T	1233.14	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30209434	.	T	C	1116.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30209489	.	T	C	2295.62	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30210600	.	TG	T	2176.93	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30210624	.	C	T	181.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30210631	.	G	A	163.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30212006	.	T	C	1200.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30221053	.	C	T	876.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30221077	.	T	C	1739.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30221120	.	C	T	30432.04	PASS	AC=78;AF=0.04745;AN=1644;DS;set=Intersection
22	30221122	.	C	T	1137.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30221125	.	C	T	1097.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30221177	.	C	T	2841.45	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30221181	.	G	A	1066.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30221201	.	G	A	107463.17	PASS	AC=214;AF=0.13017;AN=1644;DS;set=Intersection
22	30221653	.	G	A	637.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30221712	.	T	C	893.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30221725	.	C	T	906.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30221816	.	G	A	1088.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30228227	.	G	A	2132.53	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30228231	.	C	T	245.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30228238	.	G	A	801.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30228261	.	T	C	819.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30228268	.	G	A	283.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30367014	.	A	T	31769.76	PASS	AC=213;AF=0.12956;AN=1644;DS;set=Intersection
22	30367081	.	AAAAC	A	240.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30367085	.	C	A	1084.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30367094	.	CTG	C	211.89	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30374414	.	G	A	7110.11	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	30374555	.	A	G	2778.29	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30374920	.	C	T	40498.68	PASS	AC=159;AF=0.09672;AN=1644;DS;set=Intersection
22	30374956	.	CAG	C	416.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30374960	.	G	A	5284.74	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30374975	.	C	T	1229.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30384572	.	G	A	188449.47	PASS	AC=761;AF=0.46290;AN=1644;DS;set=Intersection
22	30384599	.	T	G	12357.89	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	30387470	.	A	G	301.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30394731	.	G	GT	37272.44	PASS	AC=231;AF=0.14051;AN=1644;DS;set=Intersection
22	30398858	.	C	G	13333.46	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	30398922	.	A	C	1056.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30398935	.	T	C	522.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30399000	.	A	G	29824.10	PASS	AC=157;AF=0.09550;AN=1644;DS;set=Intersection
22	30403307	.	C	T	1157.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30403357	.	A	G	539.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30403909	.	T	C	2208.58	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30403941	.	A	G	450.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30403996	.	C	T	139109.33	PASS	AC=482;AF=0.29319;AN=1644;DS;set=Intersection
22	30405151	.	T	C	264181.44	PASS	AC=1085;AF=0.65998;AN=1644;DS;set=Intersection
22	30408316	.	T	TA	1488.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30408427	.	G	A	860.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30409297	.	G	T	4960.65	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30409367	.	T	C	772.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30409523	.	C	T	859.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30412469	.	A	C	274.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30412523	.	C	T	6102.74	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30412701	.	A	G	7498.83	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	30413877	.	T	C	41992.43	PASS	AC=132;AF=0.08029;AN=1644;DS;set=Intersection
22	30414091	.	C	T	31863.44	PASS	AC=143;AF=0.08698;AN=1644;DS;set=Intersection
22	30415423	.	A	G	16924.79	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	30415666	.	C	T	1689.01	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30415669	.	G	T	833.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30415938	.	G	T	6284.70	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	30415940	.	C	T	2387.32	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30415983	.	C	T	2812.23	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	30416038	.	G	A	1130.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30416057	.	G	T	841.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30416107	.	A	G	1221.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30416131	.	T	C	605	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30416292	.	C	T	1913.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30416350	.	G	A	757.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30416362	.	G	A	1020.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30416383	.	G	A	818.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30416468	.	G	A	1756.07	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30416486	.	C	T	257.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30416490	.	C	T	999.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30416527	.	A	G	28599.01	PASS	AC=75;AF=0.04562;AN=1644;DS;set=Intersection
22	30416531	.	G	A	779.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30418004	.	T	G	4725.14	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30418035	.	G	A	858.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30418161	.	A	C	183320.80	PASS	AC=1087;AF=0.66119;AN=1644;DS;set=Intersection
22	30418173	.	T	G	1795.59	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30418548	.	A	G	978.23	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	30419479	.	A	G	370.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30421786	.	A	T	12263.48	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	30489945	.	G	A	1229.55	PASS	AC=5;AF=0.00395;AN=1266;DS;set=Intersection
22	30494830	.	TG	T	2425.85	PASS	AC=2;AF=0.00181;AN=1106;DS;set=Intersection
22	30494847	.	G	C	20439.40	PASS	AC=21;AF=0.01892;AN=1110;DS;set=Intersection
22	30494910	.	A	G	1008.64	PASS	AC=2;AF=0.00182;AN=1098;DS;set=Intersection
22	30494958	.	T	C	2177.97	PASS	AC=2;AF=0.00183;AN=1090;DS;set=Intersection
22	30499392	.	T	C	39.74	PASS	AC=4;AF=0.00385;AN=1040;set=Intersection
22	30499486	.	G	A	98.67	PASS	AC=2;AF=0.00182;AN=1096;set=Intersection
22	30500351	.	A	T	951.19	PASS	AC=1;AF=0.00095;AN=1052;DS;set=Intersection
22	30500435	.	G	A	12436.23	PASS	AC=11;AF=0.01028;AN=1070;DS;set=Intersection
22	30507834	.	C	G	93.12	PASS	AC=1;AF=0.00093;AN=1078;set=Intersection
22	30515049	.	T	C	22837.84	PASS	AC=200;AF=0.17762;AN=1126;set=Intersection
22	30515053	.	T	A	1800.40	PASS	AC=11;AF=0.00975;AN=1128;set=Intersection
22	30517650	.	G	A	71.96	PASS	AC=1;AF=0.00089;AN=1124;set=Intersection
22	30517756	.	G	C	758.21	PASS	AC=1;AF=0.00089;AN=1126;DS;set=Intersection
22	30517949	.	G	A	856.07	PASS	AC=1;AF=0.00086;AN=1168;set=Intersection
22	30518166	.	G	A	625.71	PASS	AC=3;AF=0.00254;AN=1180;DS;set=Intersection
22	30518233	.	G	A	14385.87	PASS	AC=62;AF=0.05317;AN=1166;DS;set=Intersection
22	30572002	.	A	T	1303.75	PASS	AC=5;AF=0.00408;AN=1226;DS;set=Intersection
22	30572072	.	G	A	1272.95	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	30572192	.	A	C	796.56	PASS	AC=2;AF=0.00172;AN=1160;DS;set=Intersection
22	30639700	.	C	T	915.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30639745	.	G	A	5951.03	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30639834	.	C	T	4797.43	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30639835	.	G	A	408.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30639969	.	C	T	16443.85	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	30639993	.	C	T	631.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30639994	.	G	A	863.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30640044	.	C	T	180.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30640057	.	G	C	219.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30640765	.	G	C	6156.89	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30640836	.	T	C	409.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30640849	.	G	A	609.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30640909	.	C	T	759.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30640926	.	G	A	3045.46	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30642644	.	G	A	583.33	PASS	AC=1;AF=0.00073;AN=1372;set=Intersection
22	30642652	.	G	A	156.95	PASS	AC=3;AF=0.00214;AN=1404;set=Intersection
22	30659852	.	G	A	4590.97	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30659934	.	G	A	620.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30659983	.	C	T	1274.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30659994	.	C	T	310.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30659996	.	C	A	2802.98	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30660085	.	C	T	610.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30660097	.	G	T	30.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30660123	.	G	C	1894.29	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30660177	.	A	C	477.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30660199	.	G	A	2298.71	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30660284	.	C	T	696.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30660363	.	G	A	489.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30660478	.	G	T	688.89	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30660948	.	T	G	868.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30661028	.	T	C	1059.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30661059	.	C	T	809.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30662763	.	G	A	14653.15	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	30662806	.	C	T	600.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30662813	.	C	T	2788.14	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	30662817	.	C	T	973.33	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30681713	.	G	A	69.22	PASS	AC=2;AF=0.00173;AN=1156;set=Intersection
22	30681796	.	CT	C	13830.65	PASS	AC=520;AF=0.40562;AN=1282;set=Intersection
22	30681797	.	T	TCTGCCCCAGCCCTTGGTGCTCCCC	178573.94	PASS	AC=1137;AF=0.88828;AN=1280;set=Intersection
22	30681977	.	G	A	162.44	PASS	AC=2;AF=0.00154;AN=1302;set=Intersection
22	30682006	.	A	G	391.89	PASS	AC=1;AF=0.00078;AN=1280;set=Intersection
22	30682317	.	C	T	135.39	PASS	AC=1;AF=0.00074;AN=1356;DS;set=Intersection
22	30682404	.	C	T	328.42	PASS	AC=2;AF=0.00158;AN=1268;DS;set=Intersection
22	30682767	.	T	C	4624.98	PASS	AC=33;AF=0.02212;AN=1492;DS;set=Intersection
22	30682865	.	G	A	499.79	PASS	AC=1;AF=0.00066;AN=1516;DS;set=Intersection
22	30682874	.	T	A	1738.73	PASS	AC=4;AF=0.00265;AN=1512;DS;set=Intersection
22	30682971	.	C	T	333.47	PASS	AC=1;AF=0.00070;AN=1424;DS;set=Intersection
22	30683105	.	G	A	13613.47	PASS	AC=26;AF=0.02054;AN=1266;DS;set=Intersection
22	30683285	.	C	G	45804.31	PASS	AC=254;AF=0.17887;AN=1420;DS;set=Intersection
22	30683474	.	G	A	2380.56	PASS	AC=3;AF=0.00214;AN=1404;DS;set=Intersection
22	30683560	.	G	A	39.68	PASS	AC=1;AF=0.00071;AN=1400;DS;set=Intersection
22	30684777	.	T	G	784.44	PASS	AC=1;AF=0.00083;AN=1198;DS;set=Intersection
22	30684781	.	G	T	389.85	PASS	AC=2;AF=0.00167;AN=1198;DS;set=Intersection
22	30685364	.	G	A	8045.90	PASS	AC=184;AF=0.17490;AN=1052;set=Intersection
22	30685495	.	G	A	699.90	PASS	AC=24;AF=0.0271;AN=886;set=Intersection
22	30685499	.	G	C	64.71	PASS	AC=2;AF=0.0023;AN=886;set=Intersection
22	30688339	.	G	A	28191	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	30688366	.	A	G	1028.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688414	.	G	A	389.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688448	.	AGGGGCTGAGTCCTTG	A	1760.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688478	.	C	T	666.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688486	.	C	T	968.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688488	.	T	C	2334.32	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30688517	.	G	A	5241.59	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	30688540	.	G	C	731.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688548	.	G	A	658.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688602	.	T	C	537.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688611	.	G	C	3188.35	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30688659	.	C	T	30673.67	PASS	AC=104;AF=0.06326;AN=1644;DS;set=Intersection
22	30688689	.	C	T	470.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688721	.	G	A	818.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688808	.	A	T	119.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30688827	.	G	A	111.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30689749	.	G	A	2211.14	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30689892	.	C	G	7412.04	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	30689998	.	G	A	99236.57	PASS	AC=335;AF=0.20377;AN=1644;DS;set=Intersection
22	30690020	.	C	T	6605.65	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	30690082	.	G	A	861.89	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30690109	.	C	T	552.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30690794	.	G	A	620.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30690805	.	C	T	431.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30690904	.	C	A	24455.30	PASS	AC=107;AF=0.06509;AN=1644;DS;set=Intersection
22	30690945	.	C	T	395.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30695398	.	G	A	949.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30695423	.	G	A	3172.38	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	30695449	.	T	C	447.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30695459	.	A	T	837.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30700607	.	T	G	49782.63	PASS	AC=285;AF=0.17336;AN=1644;DS;set=Intersection
22	30700657	.	G	A	862.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30700669	.	C	T	802.83	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	30722834	.	G	T	76.27	PASS	AC=1;AF=0.00063;AN=1582;DS;set=Intersection
22	30730541	.	G	A	2196.46	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30730572	.	G	T	2340.31	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30730701	.	G	A	2921.13	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30730711	.	A	G	63753.43	PASS	AC=284;AF=0.17275;AN=1644;DS;set=Intersection
22	30731610	.	A	G	7830.86	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	30731647	.	C	T	1195.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30731782	.	G	A	1180.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30733111	.	C	A	62128.32	PASS	AC=284;AF=0.17275;AN=1644;DS;set=Intersection
22	30733761	.	C	T	334.71	PASS	AC=2;AF=0.00123;AN=1632;DS;set=Intersection
22	30733763	.	C	T	354.12	PASS	AC=1;AF=0.00061;AN=1632;DS;set=Intersection
22	30733826	.	T	C	225.30	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	30733854	.	G	A	83.99	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	30733914	.	C	A	23232.64	PASS	AC=353;AF=0.21551;AN=1638;DS;set=Intersection
22	30734739	.	G	C	969.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30734788	.	C	T	687.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30735047	.	A	G	70242.73	PASS	AC=128;AF=0.07786;AN=1644;DS;set=Intersection
22	30735079	.	C	CG	778.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30735093	.	G	A	1051.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30735185	.	G	A	798.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30736147	.	G	A	59687.30	PASS	AC=564;AF=0.34432;AN=1638;DS;set=Intersection
22	30736176	.	C	T	285.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30736350	.	C	T	724.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30736416	.	C	A	7841.08	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	30736835	.	G	A	22162.95	PASS	AC=72;AF=0.04380;AN=1644;DS;set=Intersection
22	30737645	.	G	GA	1018.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30737668	.	C	T	6663.61	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	30737748	.	T	C	5276.01	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30737771	.	G	T	20035.72	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	30737858	.	G	A	397.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30737881	.	G	A	583.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30737919	.	AC	A	343.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30738161	.	C	T	275257.66	PASS	AC=1185;AF=0.72080;AN=1644;DS;set=Intersection
22	30738190	.	T	C	584.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30740914	.	C	G	17470.11	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	30741021	.	C	T	908.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30741087	.	G	A	1181.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30741129	.	A	G	351.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30741150	.	G	A,C,T	893.05	PASS	AC=1,1,0;AF=0.00061,0.00061,0.00000;AN=1644;DS;set=Intersection
22	30742275	.	AGTG	A	3102.88	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30742418	.	G	T	783.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30742434	.	T	C	1121.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30742468	.	T	C	935.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30742540	.	C	A	1663.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30748927	.	G	A	746.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30749058	.	T	C	915.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30752696	.	G	T	48004.04	PASS	AC=855;AF=0.57306;AN=1492;set=Intersection
22	30752703	.	G	A	993.54	PASS	AC=11;AF=0.00727;AN=1514;set=Intersection
22	30762095	.	C	T	685.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30762096	.	G	A	638.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30762139	.	C	T	40968.20	PASS	AC=105;AF=0.06387;AN=1644;DS;set=Intersection
22	30762140	.	G	A	70355.59	PASS	AC=285;AF=0.17336;AN=1644;DS;set=Intersection
22	30762151	.	C	T	718.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30762178	.	G	A	10079.67	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	30762187	.	C	T	1281.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30762280	.	C	T	468.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30765380	.	C	T	563.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30765502	.	G	A	39893.41	PASS	AC=287;AF=0.17457;AN=1644;DS;set=Intersection
22	30765503	.	G	A	681.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30765621	.	T	C	179.38	PASS	AC=3;AF=0.00184;AN=1634;set=Intersection
22	30766366	.	G	A	775.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30766428	.	A	G	650.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30766439	.	A	G	4458.99	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30766466	.	C	T	26881.10	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	30766527	.	C	T	7676.23	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	30766535	.	T	C	630.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30766542	.	G	A	932.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30766850	.	A	G	554.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30766868	.	G	A	412.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30766905	.	T	C	231.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30767590	.	G	A	768.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30767708	.	A	G	601.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30767729	.	A	G	53172.83	PASS	AC=285;AF=0.17336;AN=1644;DS;set=Intersection
22	30768048	.	C	T	35.47	PASS	AC=1;AF=0.00063;AN=1594;DS;set=Intersection
22	30768118	.	GGCAGGTGCAGCAGCTGGAGGA	G	453.47	PASS	AC=2;AF=0.00124;AN=1618;DS;set=Intersection
22	30768234	.	AAGG	A	4418.74	PASS	AC=20;AF=0.01230;AN=1626;DS;set=Intersection
22	30768265	.	G	A	218.46	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	30768269	.	C	T	237.39	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	30768297	.	G	C	1693.76	PASS	AC=34;AF=0.02086;AN=1630;DS;set=Intersection
22	30768304	.	C	T	168.49	PASS	AC=3;AF=0.00184;AN=1630;DS;set=Intersection
22	30768305	.	A	G	174.41	PASS	AC=2;AF=0.00123;AN=1626;DS;set=Intersection
22	30768321	.	G	A	126.59	PASS	AC=1;AF=0.00062;AN=1608;DS;set=Intersection
22	30769572	.	C	T	113.47	PASS	AC=2;AF=0.00125;AN=1596;set=Intersection
22	30769605	.	G	A	187.58	PASS	AC=1;AF=0.00062;AN=1604;set=Intersection
22	30769685	.	C	T	378.36	PASS	AC=1;AF=0.00063;AN=1588;set=Intersection
22	30769901	.	G	C	20796.44	PASS	AC=275;AF=0.16748;AN=1642;DS;set=Intersection
22	30769906	.	T	C	23194.65	PASS	AC=274;AF=0.16687;AN=1642;DS;set=Intersection
22	30769997	.	G	A	1447.03	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	30770021	.	G	A	1747.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30770027	.	G	A	901.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30770084	.	G	C	568.71	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	30771458	.	T	C	66955.42	PASS	AC=286;AF=0.17397;AN=1644;DS;set=Intersection
22	30771554	.	T	G	300583.01	PASS	AC=1609;AF=0.97871;AN=1644;DS;set=Intersection
22	30771573	.	G	A	950.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30772208	.	C	T	177.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30772305	.	C	A	2047.49	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30772396	.	G	A	807.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30772424	.	C	T	190.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30772457	.	C	G	872.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30772599	.	C	T	1750.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30772680	.	A	G	867.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30772686	.	C	T	25350.33	PASS	AC=196;AF=0.11922;AN=1644;DS;set=Intersection
22	30772687	.	C	T	1353.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30772688	.	G	A	293.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30775543	.	G	A	1086.44	PASS	AC=1;AF=0.00065;AN=1538;DS;set=Intersection
22	30775598	.	G	A	1591.53	PASS	AC=3;AF=0.00190;AN=1576;DS;set=Intersection
22	30775675	.	G	A	36792.30	PASS	AC=278;AF=0.17182;AN=1618;DS;set=Intersection
22	30775694	.	G	A	1837.07	PASS	AC=18;AF=0.01104;AN=1630;DS;set=Intersection
22	30775729	.	G	A	1523.96	PASS	AC=3;AF=0.00183;AN=1640;DS;set=Intersection
22	30775766	.	G	A	77.71	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	30775815	.	G	A	165.59	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	30776095	.	C	T	43794.63	PASS	AC=262;AF=0.15937;AN=1644;DS;set=Intersection
22	30776106	.	G	C	1500.06	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	30776122	.	C	A	650.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30776129	.	C	T	792.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30776173	.	C	T	2000.61	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30776199	.	G	C	912.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30776328	.	G	A	274.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30776357	.	G	A	777.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30776404	.	C	T	210.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30776419	.	T	C	34024.76	PASS	AC=566;AF=0.34428;AN=1644;DS;set=Intersection
22	30780285	.	G	A	5269.07	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30780307	.	A	G	830.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30780351	.	C	T	1237.63	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30780397	.	G	A	950.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30780416	.	G	T	819.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30780493	.	G	T	704.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30780503	.	G	A	6171.56	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	30780517	.	G	A	741.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30782001	.	G	A	325.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30782002	.	C	A	855.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30782043	.	G	A	618.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30782089	.	A	G	54848.76	PASS	AC=555;AF=0.33759;AN=1644;DS;set=Intersection
22	30782672	.	G	A	239.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30782722	.	C	T	6667.57	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	30782731	.	G	A	69232.80	PASS	AC=410;AF=0.24939;AN=1644;DS;set=Intersection
22	30793065	.	C	T	57.60	PASS	AC=1;AF=0.00080;AN=1250;set=Intersection
22	30793091	.	C	A	205.67	PASS	AC=1;AF=0.00073;AN=1366;set=Intersection
22	30793103	.	A	G	77.74	PASS	AC=1;AF=0.00072;AN=1380;DS;set=Intersection
22	30793137	.	G	A	24011.53	PASS	AC=472;AF=0.34203;AN=1380;DS;set=Intersection
22	30795636	.	G	A	331.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30795742	.	G	C	9062.47	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	30802297	.	C	A	509.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30802379	.	G	C	802.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30803096	.	C	T	1044.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30803114	.	G	A	1325.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30803123	.	A	G	1172.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30803159	.	C	T	5548.53	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30803377	.	A	C	976.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30803469	.	C	T	840.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30803508	.	C	G	1064.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30803555	.	A	G	749.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30803579	.	A	G	14791.64	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	30803627	.	C	T	6431.66	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	30805171	.	T	G	379.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30805295	.	AG	A	4395.77	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	30805444	.	C	T	7210.27	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	30805457	.	C	T	504.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30805497	.	A	G	1006.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30811825	.	C	T	891.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30811904	.	C	A	1207.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30812022	.	G	A	1461.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30812247	.	G	A	675.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30812379	.	T	C	699.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30812387	.	G	A	863.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30821951	.	G	A	85.93	PASS	AC=1;AF=0.00094;AN=1062;set=Intersection
22	30822680	.	A	G	1167.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30822813	.	A	G	607.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30822855	.	A	AC	618	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30822873	.	CT	C	368.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30823113	.	T	G	81897.18	PASS	AC=439;AF=0.26703;AN=1644;DS;set=Intersection
22	30823133	.	G	A	15455.29	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	30823145	.	C	G	993.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30823148	.	C	T	1953.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30823196	.	T	C	185663.29	PASS	AC=898;AF=0.54623;AN=1644;DS;set=Intersection
22	30823218	.	G	T	516.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30823230	.	C	G	668.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30823250	.	G	A	5978.72	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	30823323	.	G	A	1483.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30823346	.	G	A	770.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30823365	.	C	A	1009.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30823379	.	C	T	1680.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30824403	.	A	G	1981.42	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30824488	.	C	T	666.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30824621	.	A	T	27510.36	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	30824659	.	T	TA	7565.21	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	30824694	.	G	A	917.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30824706	.	G	A	146.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30855970	.	C	A	6554.56	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	30856115	.	C	T	955.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30856121	.	G	A	24644.36	PASS	AC=85;AF=0.05170;AN=1644;DS;set=Intersection
22	30856151	.	G	A	521.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30857287	.	G	T	501.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30857329	.	T	A	1039.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30857353	.	T	C	2757.99	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30857373	.	A	C	296838.26	PASS	AC=1213;AF=0.73783;AN=1644;DS;set=Intersection
22	30857438	.	T	C	538.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30857448	.	A	G	251492.46	PASS	AC=1188;AF=0.72263;AN=1644;DS;set=Intersection
22	30857477	.	G	GA	6517.44	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	30857549	.	C	T	638.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30857619	.	G	A	446.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30857634	.	C	T	191.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30857645	.	C	G	952.99	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	30857699	.	G	A	2638.74	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	30860830	.	C	T	86201.12	PASS	AC=379;AF=0.23054;AN=1644;DS;set=Intersection
22	30860831	.	G	A	2091.53	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30860934	.	T	C	4741.45	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	30862291	.	C	T	1614.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30862293	.	C	T	360.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30862373	.	G	A	985.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30862400	.	T	A	251295.15	PASS	AC=1214;AF=0.73844;AN=1644;DS;set=Intersection
22	30862941	.	G	A	856.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30863040	.	C	T	858.89	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30864463	.	C	T	16751.04	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	30864494	.	C	A	1184.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30864545	.	T	A	1847.64	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30864610	.	A	G	170290.10	PASS	AC=666;AF=0.40511;AN=1644;DS;set=Intersection
22	30864655	.	A	G	12247.61	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	30864692	.	G	A	265306.01	PASS	AC=1194;AF=0.72628;AN=1644;DS;set=Intersection
22	30864720	.	C	T	7254.87	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	30865966	.	C	T	886.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30865992	.	C	T	788.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30866053	.	G	A	13014.76	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	30866272	.	C	G	511.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30866462	.	CT	C	962.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30866471	.	A	G	44454.83	PASS	AC=105;AF=0.06387;AN=1644;DS;set=Intersection
22	30867865	.	C	T	10843.08	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	30867866	.	G	A	792.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30867940	.	G	A	992.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30867965	.	G	A	679.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30867981	.	T	C	462.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30886156	.	C	T	9920.87	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	30886214	.	G	A	2151.12	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30886224	.	C	T	923.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30886271	.	C	T	865.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30887555	.	C	T	2884.17	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	30887668	.	C	G	13050.19	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	30887919	.	G	A	12164.18	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	30888412	.	C	T	18353.54	PASS	AC=94;AF=0.05718;AN=1644;DS;set=Intersection
22	30888485	.	G	A	738.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30888492	.	C	G	10928.94	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	30888494	.	C	T	58583.45	PASS	AC=256;AF=0.15572;AN=1644;DS;set=Intersection
22	30888504	.	C	T	6212.81	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	30888505	.	G	A	973.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30888527	.	C	T	55929.48	PASS	AC=258;AF=0.15693;AN=1644;DS;set=Intersection
22	30888589	.	G	A	33154.68	PASS	AC=95;AF=0.05779;AN=1644;DS;set=Intersection
22	30890087	.	C	T	661.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30890090	.	A	G	978.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30890105	.	T	C	855.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30890129	.	G	A	406.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30890171	.	A	G	665.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30890223	.	G	A	1574.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30890886	.	G	A	9916.50	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	30890934	.	G	A	975.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30891227	.	C	A	396.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30891232	.	G	A	361.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30891250	.	T	C	46919.56	PASS	AC=273;AF=0.16606;AN=1644;DS;set=Intersection
22	30891264	.	C	A	19625.50	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	30891294	.	G	C	63824.09	PASS	AC=260;AF=0.15815;AN=1644;DS;set=Intersection
22	30891300	.	G	A	8720.17	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	30891400	.	A	G	13585.80	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	30891412	.	G	A	59635.89	PASS	AC=110;AF=0.06691;AN=1644;DS;set=Intersection
22	30891459	.	T	A	822.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30891560	.	C	T	5667.03	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	30891561	.	G	A	2167.58	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30891616	.	C	T	914.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30891649	.	G	A	864.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30891871	.	C	T	898.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30891942	.	C	A	1817.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30891967	.	AGAG	A	11433.94	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	30899617	.	C	T	26373.89	PASS	AC=139;AF=0.08455;AN=1644;DS;set=Intersection
22	30899709	.	T	G	1685.36	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30899741	.	T	A	500.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30899745	.	C	T	967.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30899785	.	G	A	68.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30901528	.	C	T	626.49	PASS	AC=13;AF=0.00827;AN=1572;set=Intersection
22	30901592	.	T	C	5766.73	PASS	AC=299;AF=0.19241;AN=1554;set=Intersection
22	30901636	.	C	A	35.99	PASS	AC=3;AF=0.00242;AN=1242;set=Intersection
22	30951199	.	T	C	261.70	PASS	AC=1;AF=0.00061;AN=1630;DS;set=Intersection
22	30951208	.	C	T	182.38	PASS	AC=1;AF=0.00062;AN=1624;DS;set=Intersection
22	30951226	.	C	T	2747.51	PASS	AC=20;AF=0.01235;AN=1620;DS;set=Intersection
22	30951404	.	G	A	5337.75	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	30951450	.	G	A	823.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951482	.	G	C	998.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951501	.	C	T	537.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951651	.	G	C	659.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951726	.	C	T	591.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951728	.	C	T	633.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951813	.	G	C	344.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951848	.	C	T	673.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951882	.	G	A	11073.61	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	30951948	.	G	A	7887.71	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	30951956	.	T	C	506.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951984	.	G	T	581.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30951985	.	C	T	59.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30952014	.	G	A	1502.88	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	30952023	.	G	A	3116.52	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	30952041	.	G	A	351.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30952062	.	C	T	395.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30953203	.	T	C	416	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30953261	.	C	G	349.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30953280	.	C	T	9286.15	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	30953295	.	C	T	80475.76	PASS	AC=528;AF=0.32117;AN=1644;DS;set=Intersection
22	30953332	.	C	T	1993.20	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30953352	.	C	T	667.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30973025	.	G	A	37509.39	PASS	AC=138;AF=0.08394;AN=1644;DS;set=Intersection
22	30973075	.	C	T	951.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30973076	.	G	A	926.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30973146	.	AG	A	24812.53	PASS	AC=135;AF=0.08212;AN=1644;DS;set=Intersection
22	30973148	.	GT	G	2064.29	PASS	AC=112;AF=0.06813;AN=1644;DS;set=Intersection
22	30973150	.	A	G	944.40	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	30974798	.	A	G	4280.43	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30975026	.	C	T	681.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30975119	.	C	A	2333.87	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	30975162	.	G	C	731.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30975199	.	TTCC	T	892.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30975286	.	G	C	957.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30975327	.	T	G	14852.68	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	30975706	.	G	A	895.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30975789	.	C	T	1667.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30975861	.	C	T	65555.03	PASS	AC=179;AF=0.10888;AN=1644;DS;set=Intersection
22	30975864	.	C	T	676.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30975865	.	G	A	16368.89	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	30975882	.	C	T	607.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30976075	.	G	A	4462.93	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30976107	.	C	T	1966.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30976109	.	T	A	1147.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30976190	.	C	T	1070.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30976521	.	G	A	7300.36	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	30976572	.	C	A	698.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30976660	.	C	G	976.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30976704	.	C	T	16919.88	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	30976713	.	G	A	5851.46	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	30977131	.	C	T	283.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30977277	.	C	T	703.63	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30977316	.	C	T	492.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30977353	.	T	A	15684.38	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	30977410	.	G	T	559.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30977444	.	C	T	218.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30977486	.	G	A	627.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30977576	.	G	A	5771.26	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	30977634	.	G	A	315.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30980358	.	G	A	195.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30980446	.	G	C	1411.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30980503	.	G	C	11445.42	PASS	AC=79;AF=0.04805;AN=1644;DS;set=Intersection
22	30980547	.	G	C	150.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30980610	.	C	T	195.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30983970	.	C	T	1492.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30983971	.	G	A	1767.66	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	30984027	.	T	C	2333.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	30984170	.	C	T	717.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30985251	.	G	A	392.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	30987750	.	C	A	298.93	PASS	AC=1;AF=0.00063;AN=1588;DS;set=Intersection
22	30987759	.	C	G	932.49	PASS	AC=1;AF=0.00063;AN=1600;DS;set=Intersection
22	30987822	.	G	T	1168.84	PASS	AC=3;AF=0.00188;AN=1596;DS;set=Intersection
22	30987845	.	G	A	206.50	PASS	AC=4;AF=0.00248;AN=1614;DS;set=Intersection
22	30987861	.	G	C	107054.48	PASS	AC=759;AF=0.47556;AN=1596;DS;set=Intersection
22	30987864	.	C	T	1150.90	PASS	AC=26;AF=0.01633;AN=1592;DS;set=Intersection
22	31003283	.	C	T	901.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31003285	.	A	G	992.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31003393	.	C	T	882.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31006810	.	C	T	577.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31006841	.	C	T	4490.43	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	31006860	.	A	G	56729.92	PASS	AC=160;AF=0.09732;AN=1644;DS;set=Intersection
22	31006882	.	T	G	4778.47	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31006932	.	C	A	922.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31006977	.	A	G	1971.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31006985	.	G	A	1238.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31007023	.	A	T	28548.67	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	31007082	.	C	T	1105.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31008867	.	T	C	1444.08	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	31008882	.	G	A	1082.61	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31008889	.	G	A	437.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31008962	.	G	A	2063.63	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31009026	.	A	G	428.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31009046	.	C	T	1036.91	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31009064	.	G	A	1509	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31010297	.	G	T	292.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31010305	.	G	A	1131.62	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31010313	.	C	T	8053.39	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	31010408	.	A	T	1163.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31010417	.	G	A	9669.83	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	31010431	.	G	A	338.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31010455	.	G	A	693.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31010462	.	C	T	1537.76	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31010504	.	C	T	290.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31010505	.	G	T	912.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31011280	.	A	C	106317.85	PASS	AC=270;AF=0.16423;AN=1644;DS;set=Intersection
22	31011330	.	G	A	2310.96	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31011350	.	C	T	92254.87	PASS	AC=96;AF=0.05839;AN=1644;DS;set=Intersection
22	31011478	.	GA	G	1081.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31011504	.	CAG	C	65559.60	PASS	AC=218;AF=0.13260;AN=1644;DS;set=Intersection
22	31011557	.	T	C	224301.95	PASS	AC=966;AF=0.58759;AN=1644;DS;set=Intersection
22	31011558	.	T	A	157.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31011609	.	C	T	1000.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31011610	.	G	C	252152.60	PASS	AC=966;AF=0.58759;AN=1644;DS;set=Intersection
22	31011618	.	G	C	1232.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31011644	.	G	A	988.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31011674	.	T	C	8273.70	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	31011691	.	C	T	879.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31011711	.	C	T	2444.80	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31013284	.	C	T	695.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31013296	.	G	A	99353.69	PASS	AC=282;AF=0.17153;AN=1644;DS;set=Intersection
22	31013304	.	C	T	5756.63	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	31013308	.	C	T	826.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31013374	.	C	T	12686.58	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	31013399	.	G	A	18322.94	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	31013419	.	C	T	50842.95	PASS	AC=152;AF=0.09246;AN=1644;DS;set=Intersection
22	31013532	.	A	AT	676.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31018914	.	C	G	1240.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31018975	.	T	C	25842.75	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	31019044	.	G	A	37892.44	PASS	AC=59;AF=0.03589;AN=1644;DS;set=Intersection
22	31019094	.	G	C	934.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31019116	.	T	C	373.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31022401	.	G	A	294.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31022453	.	C	G	1145.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31022537	.	C	A	6683.15	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	31032604	.	GGCT	G	1421.23	PASS	AC=403;AF=0.24907;AN=1618;set=Intersection
22	31032608	.	GCT	G	1151.01	PASS	AC=278;AF=0.17182;AN=1618;set=Intersection
22	31032704	.	G	A	619.79	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	31032836	.	G	A	1872.49	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31032881	.	G	A	30756.48	PASS	AC=121;AF=0.07360;AN=1644;DS;set=Intersection
22	31032909	.	C	T	253.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31032920	.	A	G	71646.53	PASS	AC=1018;AF=0.61922;AN=1644;DS;set=Intersection
22	31032926	.	G	T	211.92	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	31032952	.	T	G	409.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31033016	.	C	T	360.08	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	31042592	.	G	A	6091.01	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	31042606	.	G	A	1082.68	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31042664	.	G	A	331.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31042881	.	C	T	795.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31042955	.	C	T	719.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31042974	.	C	T	378.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31042989	.	C	T	7518.24	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	31043064	.	T	C	305.65	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	31059380	.	T	C	2272.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31059444	.	G	A	1006.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31059446	.	A	T	694.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31059498	.	GCA	G	3620.80	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31059504	.	T	C	723.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31059663	.	G	A	745.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31059865	.	A	G	901.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31059929	.	G	GA	1409.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31060029	.	G	C	117561.08	PASS	AC=758;AF=0.46107;AN=1644;DS;set=Intersection
22	31090869	.	C	T	74.57	PASS	AC=1;AF=0.0034;AN=296;set=Intersection
22	31090879	.	C	A	117.18	PASS	AC=2;AF=0.0050;AN=400;set=Intersection
22	31090971	.	G	C	168.38	PASS	AC=7;AF=0.0073;AN=956;set=Intersection
22	31091064	.	C	T	21696.19	PASS	AC=143;AF=0.12160;AN=1176;set=Intersection
22	31091139	.	A	G	66762.93	PASS	AC=349;AF=0.27787;AN=1256;DS;set=Intersection
22	31091154	.	G	A	474.85	PASS	AC=3;AF=0.00242;AN=1238;DS;set=Intersection
22	31091250	.	C	T	685.40	PASS	AC=1;AF=0.00077;AN=1296;DS;set=Intersection
22	31091263	.	G	A	566.36	PASS	AC=2;AF=0.00156;AN=1278;DS;set=Intersection
22	31091265	.	A	G	369.53	PASS	AC=2;AF=0.00157;AN=1270;DS;set=Intersection
22	31091305	.	C	T	1293.50	PASS	AC=6;AF=0.00480;AN=1250;DS;set=Intersection
22	31091347	.	C	T	835.49	PASS	AC=2;AF=0.00160;AN=1248;DS;set=Intersection
22	31091382	.	T	C	1180.66	PASS	AC=1;AF=0.00073;AN=1374;DS;set=Intersection
22	31091429	.	C	T	1045.53	PASS	AC=1;AF=0.00068;AN=1460;DS;set=Intersection
22	31091525	.	T	G	1325.19	PASS	AC=2;AF=0.00126;AN=1584;DS;set=Intersection
22	31137298	.	G	C	344.07	PASS	AC=1;AF=0.00073;AN=1378;DS;set=Intersection
22	31266373	.	C	T	314.09	PASS	AC=1;AF=0.00075;AN=1330;DS;set=Intersection
22	31266546	.	T	C	134622.77	PASS	AC=1054;AF=0.70549;AN=1494;DS;set=Intersection
22	31266552	.	C	T	2506.50	PASS	AC=5;AF=0.00334;AN=1496;DS;set=Intersection
22	31266574	.	G	A	437.37	PASS	AC=1;AF=0.00066;AN=1512;DS;set=Intersection
22	31266699	.	G	A	903.12	PASS	AC=2;AF=0.00124;AN=1610;DS;set=Intersection
22	31283376	.	A	T	1352.63	PASS	AC=11;AF=0.00815;AN=1350;DS;set=Intersection
22	31283427	.	C	T	1087.31	PASS	AC=1;AF=0.00069;AN=1448;DS;set=Intersection
22	31283492	.	G	A	382.25	PASS	AC=1;AF=0.00073;AN=1376;DS;set=Intersection
22	31283493	.	C	T	425.35	PASS	AC=1;AF=0.00073;AN=1368;DS;set=Intersection
22	31283494	.	G	A	592.85	PASS	AC=1;AF=0.00073;AN=1372;DS;set=Intersection
22	31283526	.	G	A	308.56	PASS	AC=1;AF=0.00074;AN=1344;DS;set=Intersection
22	31283544	.	C	T	213.36	PASS	AC=1;AF=0.00072;AN=1392;DS;set=Intersection
22	31283602	.	G	A	64.51	PASS	AC=1;AF=0.00074;AN=1360;DS;set=Intersection
22	31284271	.	T	C	912.44	PASS	AC=2;AF=0.00148;AN=1352;DS;set=Intersection
22	31284281	.	G	T	1520.04	PASS	AC=4;AF=0.00299;AN=1340;DS;set=Intersection
22	31285136	.	T	C	11757.27	PASS	AC=21;AF=0.01672;AN=1256;DS;set=Intersection
22	31285190	.	C	G	879.07	PASS	AC=5;AF=0.00392;AN=1276;DS;set=Intersection
22	31285230	.	G	C	834.03	PASS	AC=1;AF=0.00079;AN=1264;DS;set=Intersection
22	31285255	.	G	A	443.27	PASS	AC=2;AF=0.00163;AN=1228;DS;set=Intersection
22	31285271	.	G	C	188.67	PASS	AC=1;AF=0.00080;AN=1244;DS;set=Intersection
22	31285597	.	C	T	1050.45	PASS	AC=1;AF=0.00063;AN=1592;DS;set=Intersection
22	31286725	.	A	G	224.32	PASS	AC=1;AF=0.00075;AN=1326;DS;set=Intersection
22	31286843	.	T	C	12856.14	PASS	AC=23;AF=0.01748;AN=1316;DS;set=Intersection
22	31286928	.	G	A	4135.14	PASS	AC=25;AF=0.01880;AN=1330;DS;set=Intersection
22	31286965	.	G	C	329.37	PASS	AC=1;AF=0.00077;AN=1300;DS;set=Intersection
22	31286989	.	C	T	216.09	PASS	AC=1;AF=0.00083;AN=1210;DS;set=Intersection
22	31289092	.	T	A	5908.97	PASS	AC=8;AF=0.00647;AN=1236;DS;set=Intersection
22	31289123	.	C	G	627.85	PASS	AC=2;AF=0.00163;AN=1230;DS;set=Intersection
22	31289126	.	C	T	492.51	PASS	AC=1;AF=0.00081;AN=1236;DS;set=Intersection
22	31289164	.	G	A	533.35	PASS	AC=1;AF=0.00081;AN=1240;DS;set=Intersection
22	31289232	.	G	A	849.91	PASS	AC=1;AF=0.00080;AN=1248;DS;set=Intersection
22	31289244	.	G	A	440.81	PASS	AC=2;AF=0.00159;AN=1256;DS;set=Intersection
22	31289477	.	G	C	2355.23	PASS	AC=7;AF=0.00552;AN=1268;DS;set=Intersection
22	31289563	.	G	A	1055.14	PASS	AC=1;AF=0.00082;AN=1216;DS;set=Intersection
22	31289570	.	G	C	820.49	PASS	AC=1;AF=0.00081;AN=1238;DS;set=Intersection
22	31289579	.	T	C	1444.86	PASS	AC=2;AF=0.00162;AN=1238;DS;set=Intersection
22	31289591	.	G	T	881.96	PASS	AC=3;AF=0.00241;AN=1244;DS;set=Intersection
22	31289599	.	C	T	609.86	PASS	AC=1;AF=0.00080;AN=1244;DS;set=Intersection
22	31289782	.	C	T	684.09	PASS	AC=1;AF=0.00083;AN=1206;set=Intersection
22	31289891	.	A	G	321.16	PASS	AC=5;AF=0.00392;AN=1276;set=Intersection
22	31289923	.	C	T	12206.21	PASS	AC=65;AF=0.05151;AN=1262;set=Intersection
22	31301792	.	A	AGCCACC	1632.06	PASS	AC=27;AF=0.01724;AN=1566;set=Intersection
22	31301817	.	G	A	33.68	PASS	AC=1;AF=0.00062;AN=1614;set=Intersection
22	31302233	.	T	C	101645.93	PASS	AC=641;AF=0.45917;AN=1396;DS;set=Intersection
22	31302243	.	G	C	632.42	PASS	AC=1;AF=0.00071;AN=1412;DS;set=Intersection
22	31322826	.	G	A	781.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31323997	.	C	G	665.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31324124	.	G	C	1213.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31324221	.	G	A	226.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31328325	.	C	T	847.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31328326	.	G	A	14362	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	31328420	.	G	A	1279.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31328525	.	CAT	C	1217.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31328570	.	G	A	972.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31328601	.	C	T	715.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31328630	.	G	A	918.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31328696	.	G	A	454.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31328770	.	A	G	1465.99	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31328841	.	G	A	1075.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31328929	.	C	G	4877.58	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	31329056	.	G	C	219918.03	PASS	AC=957;AF=0.58212;AN=1644;DS;set=Intersection
22	31330134	.	T	C	4133.22	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31330169	.	T	C	944.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31330837	.	C	A	1059.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31331019	.	T	C	1065.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31331210	.	C	T	761.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31331293	.	C	T	594.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31332494	.	G	A	1160.97	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31332657	.	C	T	1109.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31332906	.	A	T	128.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31333033	.	A	G	690.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31333544	.	CG	C	561.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31333631	.	T	C	162878.95	PASS	AC=753;AF=0.45803;AN=1644;DS;set=Intersection
22	31333724	.	T	C	1224.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31333747	.	T	C	3131.16	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31333797	.	A	T	898.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31333830	.	C	T	956.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31334000	.	G	A	2374.18	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31334011	.	A	G	37385.95	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	31334218	.	G	T	6339.30	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31334230	.	G	A	493.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31335643	.	G	A	918.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31335724	.	T	A	175909.23	PASS	AC=958;AF=0.58273;AN=1644;DS;set=Intersection
22	31335958	.	C	T	122.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31335967	.	T	A	40245.18	PASS	AC=71;AF=0.04319;AN=1644;DS;set=Intersection
22	31336717	.	C	G	1451.61	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31337378	.	C	T	562.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31337552	.	A	G	813.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31337565	.	A	G	9248.26	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	31337579	.	CT	C	332.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31337581	.	G	C	388.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31337589	.	A	G	1183.76	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31337950	.	T	C	22540.52	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	31338017	.	C	T	7329.94	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	31338027	.	G	A	917.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31338030	.	C	T	1130.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31338050	.	A	T	887.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31338069	.	C	T	933.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31338196	.	C	A	1641.36	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31338246	.	G	A	1030.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31342283	.	CAG	C	1575.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31342349	.	A	G	1679.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31342355	.	C	T	1333.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31342376	.	G	C	166405.42	PASS	AC=628;AF=0.38200;AN=1644;DS;set=Intersection
22	31342429	.	T	C	991.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31345821	.	A	C	7123.84	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	31345878	.	G	A	881.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31346345	.	A	G	4880.62	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	31346442	.	AG	A	322.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31479234	.	G	A	4340.38	PASS	AC=19;AF=0.01157;AN=1642;DS;set=Intersection
22	31479282	.	C	T	32.71	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	31479328	.	G	A	1982.60	PASS	AC=15;AF=0.00916;AN=1638;DS;set=Intersection
22	31483908	.	G	A	177.35	PASS	AC=2;AF=0.00122;AN=1642;set=Intersection
22	31483934	.	T	C	3091.85	PASS	AC=40;AF=0.02433;AN=1644;set=Intersection
22	31484003	.	G	A	102.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31484055	.	G	A	419.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31484483	.	C	T	131.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31484604	.	G	T	661.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31484880	.	G	A	2160.66	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31484930	.	C	T	1892.35	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31485000	.	AC	A	616.59	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31485002	.	C	T	111.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31485687	.	G	A	387.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31485749	.	G	A	632.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31485865	.	T	C	431.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31485923	.	C	T	4296.54	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	31486760	.	C	T	50731.55	PASS	AC=66;AF=0.04015;AN=1644;DS;set=Intersection
22	31486774	.	C	A	6874.89	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31486785	.	A	T	831.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31486870	.	T	C	13855.79	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	31486900	.	C	T	1353.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31486911	.	C	G	144422.23	PASS	AC=456;AF=0.27737;AN=1644;DS;set=Intersection
22	31486985	.	C	T	2470.44	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31487064	.	C	T	558.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31487268	.	G	A	464.07	PASS	AC=2;AF=0.00122;AN=1638;set=Intersection
22	31487354	.	G	A	721.41	PASS	AC=6;AF=0.00369;AN=1628;DS;set=Intersection
22	31487510	.	G	A	42.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31487512	.	A	T	185.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31487679	.	G	A	753.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31487682	.	C	T	8500.42	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	31487693	.	C	T	352.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31487701	.	C	T	12206.65	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	31487704	.	C	T	1196.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31487706	.	G	A	282.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31487732	.	C	T	3121.98	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	31487733	.	G	A	831.84	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31487814	.	G	A	770.24	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	31491249	.	T	C	590.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31491295	.	G	C	152957.26	PASS	AC=759;AF=0.46168;AN=1644;DS;set=Intersection
22	31491332	.	C	T	43421.92	PASS	AC=219;AF=0.13321;AN=1644;DS;set=Intersection
22	31492743	.	G	A	547.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31492750	.	G	A	655.47	PASS	AC=5;AF=0.00305;AN=1638;DS;set=Intersection
22	31492781	.	C	T	23197.16	PASS	AC=86;AF=0.05238;AN=1642;DS;set=Intersection
22	31492783	.	C	T	5826.19	PASS	AC=16;AF=0.00974;AN=1642;DS;set=Intersection
22	31492816	.	C	G	866.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31492904	.	G	A	452.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31492934	.	C	T	619.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31492951	.	C	A	10600.10	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	31493052	.	G	A	330.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31493064	.	C	T	605.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31494795	.	A	T	77.56	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	31494813	.	G	C	1673.80	PASS	AC=46;AF=0.02805;AN=1640;DS;set=Intersection
22	31494866	.	G	T	13611.84	PASS	AC=431;AF=0.26377;AN=1634;set=Intersection
22	31495154	.	C	T	189.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31495175	.	G	A	876.68	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31495684	.	G	C	2741.14	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	31496837	.	C	A	27627.42	PASS	AC=420;AF=0.28075;AN=1496;DS;set=Intersection
22	31497024	.	C	T	42.17	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	31497025	.	G	A	62.06	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	31497035	.	G	A	54.30	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	31497054	.	A	C	125970.85	PASS	AC=1519;AF=0.92397;AN=1644;DS;set=Intersection
22	31500260	.	G	A	11577.13	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	31500411	.	C	T	799.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31500415	.	G	A	1013.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31500991	.	G	A	46.98	PASS	AC=1;AF=0.00087;AN=1152;DS;set=Intersection
22	31501031	.	G	A	316.23	PASS	AC=1;AF=0.00087;AN=1152;DS;set=Intersection
22	31501121	.	C	T	2849.42	PASS	AC=8;AF=0.00681;AN=1174;DS;set=Intersection
22	31501245	.	A	G	204.05	PASS	AC=1;AF=0.00081;AN=1238;set=Intersection
22	31501259	.	T	G	200.17	PASS	AC=1;AF=0.00077;AN=1294;set=Intersection
22	31501285	.	T	G	389.37	PASS	AC=1;AF=0.00073;AN=1362;set=Intersection
22	31501708	.	T	C	763.81	PASS	AC=1;AF=0.00080;AN=1252;DS;set=Intersection
22	31501981	.	G	A	11488.62	PASS	AC=25;AF=0.02056;AN=1216;DS;set=Intersection
22	31520866	.	C	T	222.26	PASS	AC=1;AF=0.00079;AN=1272;DS;set=Intersection
22	31520893	.	G	T	94.59	PASS	AC=1;AF=0.00079;AN=1258;DS;set=Intersection
22	31520899	.	T	C	341.42	PASS	AC=1;AF=0.00081;AN=1242;DS;set=Intersection
22	31522377	.	A	G	1223.25	PASS	AC=3;AF=0.00246;AN=1218;DS;set=Intersection
22	31522450	.	G	A	907.66	PASS	AC=1;AF=0.00082;AN=1216;DS;set=Intersection
22	31522455	.	C	T	609.72	PASS	AC=1;AF=0.00083;AN=1204;DS;set=Intersection
22	31522491	.	A	C	1632.70	PASS	AC=2;AF=0.00172;AN=1166;DS;set=Intersection
22	31522624	.	A	G	558.47	PASS	AC=1;AF=0.00080;AN=1254;DS;set=Intersection
22	31522949	.	G	A	270.51	PASS	AC=1;AF=0.00081;AN=1238;set=Intersection
22	31522981	.	C	T	1319.16	PASS	AC=8;AF=0.00657;AN=1218;set=Intersection
22	31522999	.	G	A	117.38	PASS	AC=1;AF=0.00081;AN=1242;set=Intersection
22	31523492	.	G	A	342.29	PASS	AC=1;AF=0.00070;AN=1436;DS;set=Intersection
22	31523495	.	C	T	283.02	PASS	AC=1;AF=0.00071;AN=1406;DS;set=Intersection
22	31523541	.	A	T	231.99	PASS	AC=5;AF=0.00367;AN=1364;DS;set=Intersection
22	31523892	.	C	A	242.35	PASS	AC=1;AF=0.00078;AN=1274;set=Intersection
22	31523973	.	T	C	482.80	PASS	AC=1;AF=0.00075;AN=1342;DS;set=Intersection
22	31524086	.	C	T	444.43	PASS	AC=1;AF=0.00077;AN=1300;DS;set=Intersection
22	31524151	.	C	T	82.41	PASS	AC=2;AF=0.00153;AN=1308;set=Intersection
22	31524175	.	A	G	1997.18	PASS	AC=12;AF=0.00920;AN=1304;set=Intersection
22	31524249	.	G	A	130.31	PASS	AC=1;AF=0.00078;AN=1286;set=Intersection
22	31529043	.	C	A	5140.51	PASS	AC=297;AF=0.21275;AN=1396;set=Intersection
22	31529142	.	G	A	488.44	PASS	AC=7;AF=0.00487;AN=1436;set=Intersection
22	31529185	.	C	T	76.04	PASS	AC=1;AF=0.00068;AN=1474;set=Intersection
22	31529353	.	T	C	511.76	PASS	AC=2;AF=0.00140;AN=1430;set=Intersection
22	31529463	.	C	A	55006.58	PASS	AC=322;AF=0.23958;AN=1344;DS;set=Intersection
22	31529679	.	C	T	6461.14	PASS	AC=12;AF=0.00910;AN=1318;set=Intersection
22	31529903	.	C	T	673.52	PASS	AC=1;AF=0.00078;AN=1282;DS;set=Intersection
22	31529904	.	G	A	852.36	PASS	AC=2;AF=0.00154;AN=1296;DS;set=Intersection
22	31529916	.	G	A	337.44	PASS	AC=1;AF=0.00076;AN=1320;DS;set=Intersection
22	31530073	.	C	T	2136.78	PASS	AC=21;AF=0.01756;AN=1196;set=Intersection
22	31530271	.	G	A	425.02	PASS	AC=5;AF=0.00407;AN=1228;set=Intersection
22	31530308	.	G	A	138.92	PASS	AC=2;AF=0.00172;AN=1162;set=Intersection
22	31530344	.	A	C	45.56	PASS	AC=6;AF=0.00542;AN=1108;set=Intersection
22	31531662	.	GCCATGGGCAAGGT	G	1152.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31531788	.	A	C	4465.57	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31531849	.	G	A	8482.33	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	31531875	.	C	T	911.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31532644	.	C	G	5545.29	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31532649	.	C	T	6306.74	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	31532697	.	G	A	2009.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31532702	.	A	G	798.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31532870	.	C	T	756.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31532873	.	G	A	893.94	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31532894	.	C	T	469.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31532899	.	C	T	672.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31532960	.	C	T	41339.33	PASS	AC=250;AF=0.15263;AN=1638;DS;set=Intersection
22	31533709	.	G	A	964.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31533751	.	C	G	1024.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31533796	.	G	C	99901.07	PASS	AC=255;AF=0.15511;AN=1644;DS;set=Intersection
22	31533843	.	G	A	7518.70	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	31533855	.	G	A	786.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31533869	.	G	C	952.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31533906	.	G	A	863.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31533952	.	G	A	11562.44	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	31533967	.	G	A	129724.51	PASS	AC=785;AF=0.47749;AN=1644;DS;set=Intersection
22	31534258	.	G	A	244.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31534280	.	G	A	2056.64	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31534357	.	C	T	876.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31534658	.	G	A	652.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31535777	.	C	G	558.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31535808	.	C	T	439.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31535872	.	G	C	87852.50	PASS	AC=255;AF=0.15511;AN=1644;DS;set=Intersection
22	31535947	.	G	A	781.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31535981	.	C	T	557.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31535995	.	C	G	83022.43	PASS	AC=309;AF=0.18796;AN=1644;DS;set=Intersection
22	31536005	.	C	G	734.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31536074	.	A	T	803.25	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31536092	.	G	A	271.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31536133	.	A	C	259686.28	PASS	AC=1345;AF=0.81813;AN=1644;DS;set=Intersection
22	31536134	.	C	CT	1674.21	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31536159	.	C	T	651.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31536160	.	G	A	433.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31536194	.	G	T	857.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31536232	.	C	T	1028.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31536233	.	G	C	159.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31583078	.	A	C	722.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31583112	.	C	T	881.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31583129	.	G	A	805.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31583169	.	G	A	811.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31583300	.	T	G	64239.64	PASS	AC=90;AF=0.05474;AN=1644;DS;set=Intersection
22	31583301	.	G	A	4408.45	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31588676	.	G	A	10200.76	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	31588735	.	A	G	960.51	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31591512	.	C	A	2223.75	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	31591595	.	C	T	147.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31597434	.	G	A	19269.88	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	31600460	.	T	C	368605.06	PASS	AC=1341;AF=0.81569;AN=1644;DS;set=Intersection
22	31608375	.	A	G	216.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31608400	.	C	T	109.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31608421	.	G	C	209.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31621683	.	C	G	1540.89	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31621779	.	C	T	345.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31621792	.	G	A	91653.53	PASS	AC=319;AF=0.19404;AN=1644;DS;set=Intersection
22	31621835	.	A	G	224.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31644691	.	T	C	611.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31644710	.	G	A	715.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31644730	.	T	G	825.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31644731	.	A	G	786.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31654293	.	G	A	766.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31655145	.	C	T	6825.14	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31655196	.	G	A	902.54	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31655208	.	C	T	2617.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31655844	.	C	CA	434.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31656011	.	G	A	689.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31658156	.	C	T	1332.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31658175	.	C	G	850.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31658205	.	C	T	2210.60	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31658215	.	G	A	2268.11	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31658757	.	A	C	335.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31662010	.	C	T	4560.69	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31663018	.	C	A	951.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31663066	.	T	C	7201.63	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	31663842	.	C	G	374428.51	PASS	AC=1334;AF=0.81144;AN=1644;DS;set=Intersection
22	31663875	.	G	A	23883	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	31663885	.	C	T	1009.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31663927	.	T	C	6242.63	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	31664080	.	C	T	899.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31664090	.	A	T	708.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31664108	.	A	C	984.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31664174	.	C	T	743.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31664213	.	C	A	1050.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31664233	.	G	A	498.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31664234	.	T	C	260.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31667166	.	G	A	791.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31668720	.	C	T	52264.10	PASS	AC=88;AF=0.05353;AN=1644;DS;set=Intersection
22	31668721	.	G	A	2363.61	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31671123	.	T	G	12501.03	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	31671190	.	T	C	520.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31671256	.	G	T	1112.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31672752	.	A	C	57508.60	PASS	AC=1302;AF=0.80669;AN=1614;DS;set=Intersection
22	31672754	.	G	A	785.49	PASS	AC=7;AF=0.00435;AN=1610;DS;set=Intersection
22	31672761	.	G	C	1672.28	PASS	AC=9;AF=0.00551;AN=1634;DS;set=Intersection
22	31672776	.	G	GC	996.48	PASS	AC=9;AF=0.00548;AN=1642;DS;set=Intersection
22	31672782	.	C	T	474.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31672837	.	G	A	582.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31672933	.	A	G	1073.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31673092	.	C	T	492.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31673111	.	A	G	83520.62	PASS	AC=242;AF=0.14720;AN=1644;DS;set=Intersection
22	31673116	.	A	G	83260.91	PASS	AC=242;AF=0.14720;AN=1644;DS;set=Intersection
22	31673119	.	A	G	2307.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31673172	.	A	G	2762.52	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31673173	.	C	A	554.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31674299	.	T	C	3095.80	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31674324	.	C	G	824.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31674447	.	AG	A	440.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31674453	.	G	T	1119.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31679064	.	G	T	1664.65	PASS	AC=9;AF=0.00548;AN=1642;DS;set=Intersection
22	31679110	.	G	C	189475.21	PASS	AC=1334;AF=0.81144;AN=1644;DS;set=Intersection
22	31679211	.	A	G	563.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31679286	.	AAAAC	A	120877.84	PASS	AC=309;AF=0.18796;AN=1644;DS;set=Intersection
22	31679321	.	A	T	907.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31685256	.	C	G	74133.80	PASS	AC=232;AF=0.14112;AN=1644;DS;set=Intersection
22	31685371	.	G	A	498.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31685458	.	G	A	197482.17	PASS	AC=1335;AF=0.81204;AN=1644;DS;set=Intersection
22	31685636	.	C	T	622.72	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	31686994	.	G	A	348	PASS	AC=3;AF=0.00188;AN=1600;DS;set=Intersection
22	31687065	.	C	T	399.98	PASS	AC=5;AF=0.00318;AN=1574;set=Intersection
22	31687082	.	G	A	160.97	PASS	AC=4;AF=0.00261;AN=1530;set=Intersection
22	31687313	.	A	G	23009.72	PASS	AC=1433;AF=0.97483;AN=1470;set=Intersection
22	31688228	.	A	C	871.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31688242	.	G	T	658.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31688249	.	T	C	7356.47	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	31688288	.	G	A	6458.32	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	31688312	.	G	T	599.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31688345	.	T	C	829.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31722856	.	C	T	867.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31722857	.	G	A	2410.11	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	31722884	.	C	T	340.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31722886	.	T	G	86664.90	PASS	AC=234;AF=0.14234;AN=1644;DS;set=Intersection
22	31723042	.	C	T	8654.25	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31723054	.	G	A	907.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31723128	.	ACTT	A	1126.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31723292	.	CCTT	C	776.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31723299	.	C	T	366.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31723322	.	C	A	880.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31724942	.	G	A	928.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31737376	.	C	T	968.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31737384	.	G	A	406.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31737436	.	G	A	11219.02	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	31737559	.	A	G	632.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31737684	.	G	A	285.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31738840	.	C	T	1896.27	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	31738862	.	C	G	559.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31738928	.	T	C	954.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31740282	.	C	T	3228.29	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	31740307	.	C	T	644.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31740390	.	T	A	948.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31740449	.	C	T	7384.39	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	31740470	.	G	A	516.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31740500	.	G	T	844.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31740564	.	G	A	1533.89	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31740668	.	G	C	4983.28	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	31740676	.	T	A	95.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31740947	.	C	T	216.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31740957	.	T	C	346.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31740963	.	T	A	775.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31741023	.	A	G	773.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31741067	.	G	A	86485.92	PASS	AC=311;AF=0.18917;AN=1644;DS;set=Intersection
22	31741358	.	G	A	274.64	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	31741517	.	C	T	182.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31741556	.	C	A	74.89	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	31795645	.	T	G	1805.48	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31796559	.	G	A	1052.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31796563	.	C	T	49389.02	PASS	AC=124;AF=0.07543;AN=1644;DS;set=Intersection
22	31796632	.	C	G	266.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31806965	.	T	A	533.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31807042	.	A	G	1467.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31807115	.	G	T	593.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31816199	.	C	T	596.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31816217	.	C	T	1979.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31816256	.	A	C	935.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31816404	.	C	T	787.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31816421	.	G	A	1044.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31816430	.	A	G	1802.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31816439	.	G	A	15996.68	PASS	AC=71;AF=0.04319;AN=1644;DS;set=Intersection
22	31823094	.	G	A	861.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31823205	.	A	G	826.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31829975	.	A	G	209.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31829981	.	C	T	7891.35	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	31836042	.	C	T	535.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31836079	.	A	G	958.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31836151	.	A	G	182.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31836675	.	C	T	897.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31836799	.	G	A	2375.66	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31836842	.	G	A	212.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31837960	.	C	T	965.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31838014	.	G	A	1915.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31838070	.	G	A	2790.43	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31838085	.	G	A	151646.68	PASS	AC=495;AF=0.30109;AN=1644;DS;set=Intersection
22	31838138	.	A	T	815.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31839123	.	C	T	44.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31839124	.	G	A	697.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31840691	.	A	G	865.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31840693	.	TATC	T	3368.68	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31843489	.	A	C	2853.22	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	31843567	.	G	C	105817.56	PASS	AC=507;AF=0.30839;AN=1644;DS;set=Intersection
22	31845304	.	A	C	700.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31845490	.	G	A	962.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31850108	.	G	A	113.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31850116	.	T	C	2949.75	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31850238	.	G	A	17946.17	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	31850246	.	A	G	796.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31851110	.	A	G	733.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31851183	.	T	C	1350.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31851246	.	A	C	5862.15	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31851348	.	G	C	2654.37	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	31851821	.	A	G	829.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31854434	.	AT	A	213321.72	PASS	AC=1519;AF=0.92397;AN=1644;DS;set=Intersection
22	31854531	.	G	A	960.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31854566	.	C	T	918.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31854663	.	G	A	568.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31858975	.	C	T	268.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31859006	.	G	A	433.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31859135	.	A	G	1358.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31859637	.	TA	T,TAA	10726.41	PASS	AC=1031,426;AF=0.62713,0.25912;AN=1644;DS;set=Intersection
22	31859784	.	G	T	7438.02	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31859805	.	C	G	1998.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31859852	.	G	A	1006.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31859854	.	G	A	1641.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31859859	.	A	G	86247.19	PASS	AC=216;AF=0.13139;AN=1644;DS;set=Intersection
22	31859865	.	G	A	893.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31859880	.	G	A	621.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31864113	.	C	G	18743.82	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	31864116	.	GT	G	586.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	31864136	.	C	T	1078.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31864150	.	T	A	887.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	31867903	.	C	T	1335.31	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31867916	.	G	A	7115.79	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	31884693	.	TCTC	T	2582.48	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	31904262	.	CTT	C	27199.39	PASS	AC=50;AF=0.04288;AN=1166;DS;set=Intersection
22	31924798	.	G	A	13567.55	PASS	AC=11;AF=0.00912;AN=1206;DS;set=Intersection
22	31924843	.	G	T	891.98	PASS	AC=1;AF=0.00083;AN=1204;DS;set=Intersection
22	31942821	.	T	G	417.76	PASS	AC=1;AF=0.00087;AN=1150;DS;set=Intersection
22	31942829	.	A	AT	19734.20	PASS	AC=129;AF=0.11237;AN=1148;DS;set=Intersection
22	31942837	.	T	C	1350.03	PASS	AC=1;AF=0.00087;AN=1148;DS;set=Intersection
22	31942898	.	G	A	1947.49	PASS	AC=7;AF=0.00612;AN=1144;DS;set=Intersection
22	31942919	.	C	T	1957.57	PASS	AC=2;AF=0.00173;AN=1158;DS;set=Intersection
22	31942974	.	C	T	1662.39	PASS	AC=8;AF=0.00685;AN=1168;DS;set=Intersection
22	31946282	.	T	C	12439	PASS	AC=28;AF=0.02254;AN=1242;DS;set=Intersection
22	31946287	.	G	A	320.03	PASS	AC=1;AF=0.00080;AN=1246;DS;set=Intersection
22	31946300	.	G	A	780.59	PASS	AC=3;AF=0.00241;AN=1244;DS;set=Intersection
22	31946325	.	G	A	759.31	PASS	AC=1;AF=0.00080;AN=1256;DS;set=Intersection
22	31952937	.	A	G	855.97	PASS	AC=2;AF=0.00171;AN=1168;DS;set=Intersection
22	31957291	.	G	A	282.34	PASS	AC=1;AF=0.00071;AN=1402;DS;set=Intersection
22	31969137	.	C	T	939.40	PASS	AC=1;AF=0.00075;AN=1326;DS;set=Intersection
22	31969182	.	G	A	7869.14	PASS	AC=6;AF=0.00474;AN=1266;DS;set=Intersection
22	31969249	.	T	G	674.01	PASS	AC=1;AF=0.00081;AN=1236;DS;set=Intersection
22	31971172	.	A	ATCT	246272.02	PASS	AC=1200;AF=0.98684;AN=1216;DS;set=Intersection
22	31971174	.	C	CTTA	115512.96	PASS	AC=1151;AF=0.93577;AN=1230;DS;set=Intersection
22	31971184	.	G	A	1201.67	PASS	AC=5;AF=0.00401;AN=1248;DS;set=Intersection
22	31971186	.	G	T	405.52	PASS	AC=1;AF=0.00080;AN=1244;DS;set=Intersection
22	31971258	.	T	C	255015.64	PASS	AC=1229;AF=0.96166;AN=1278;DS;set=Intersection
22	31971276	.	CA	C	409.34	PASS	AC=1;AF=0.00079;AN=1272;DS;set=Intersection
22	31971282	.	T	C	29226.81	PASS	AC=102;AF=0.08293;AN=1230;DS;set=Intersection
22	31971332	.	G	A	965.11	PASS	AC=1;AF=0.00078;AN=1286;DS;set=Intersection
22	31971351	.	C	T	2677.80	PASS	AC=15;AF=0.01165;AN=1288;DS;set=Intersection
22	31971355	.	G	A	502.87	PASS	AC=1;AF=0.00078;AN=1280;DS;set=Intersection
22	31974397	.	C	A	1777	PASS	AC=3;AF=0.00233;AN=1290;DS;set=Intersection
22	31974435	.	G	A	450.52	PASS	AC=1;AF=0.00078;AN=1290;DS;set=Intersection
22	31974468	.	G	A	236.59	PASS	AC=1;AF=0.00079;AN=1258;DS;set=Intersection
22	31976235	.	A	G	24554.29	PASS	AC=104;AF=0.08176;AN=1272;DS;set=Intersection
22	31976283	.	A	G	369.46	PASS	AC=1;AF=0.00078;AN=1276;DS;set=Intersection
22	31976299	.	T	C	12850.60	PASS	AC=36;AF=0.02782;AN=1294;DS;set=Intersection
22	31976357	.	G	T	542.68	PASS	AC=1;AF=0.00078;AN=1288;DS;set=Intersection
22	31979911	.	G	T	1708.67	PASS	AC=7;AF=0.00507;AN=1382;DS;set=Intersection
22	31979937	.	A	T	685.44	PASS	AC=1;AF=0.00070;AN=1438;DS;set=Intersection
22	31981152	.	T	C	4053.78	PASS	AC=4;AF=0.00363;AN=1102;DS;set=Intersection
22	31985433	.	C	T	791.55	PASS	AC=1;AF=0.00078;AN=1276;DS;set=Intersection
22	31985498	.	G	T	544.38	PASS	AC=1;AF=0.00078;AN=1276;DS;set=Intersection
22	31985517	.	C	T	252.51	PASS	AC=1;AF=0.00079;AN=1268;DS;set=Intersection
22	31985522	.	C	A	931.95	PASS	AC=1;AF=0.00079;AN=1272;DS;set=Intersection
22	31985554	.	G	A	884.93	PASS	AC=1;AF=0.00079;AN=1268;DS;set=Intersection
22	31985612	.	ACT	A	889.67	PASS	AC=1;AF=0.00079;AN=1272;DS;set=Intersection
22	31998158	.	T	G	447.81	PASS	AC=1;AF=0.00085;AN=1180;DS;set=Intersection
22	31998159	.	G	T	2154.51	PASS	AC=6;AF=0.00511;AN=1174;DS;set=Intersection
22	31998172	.	G	A	257.78	PASS	AC=1;AF=0.00085;AN=1182;DS;set=Intersection
22	31998572	.	C	G	850.58	PASS	AC=1;AF=0.00071;AN=1402;DS;set=Intersection
22	31998612	.	G	A	136681.19	PASS	AC=498;AF=0.34345;AN=1450;DS;set=Intersection
22	31998699	.	CCCA	C	7663.34	PASS	AC=13;AF=0.00957;AN=1358;DS;set=Intersection
22	31998739	.	C	T	1592.50	PASS	AC=7;AF=0.00513;AN=1364;DS;set=Intersection
22	31998808	.	A	C	11503.76	PASS	AC=39;AF=0.03000;AN=1300;DS;set=Intersection
22	31999692	.	TG	T	142.93	PASS	AC=1;AF=0.00080;AN=1250;set=Intersection
22	31999846	.	G	C	2003.10	PASS	AC=27;AF=0.02049;AN=1318;DS;set=Intersection
22	32000271	.	A	G	48.56	PASS	AC=2;AF=0.00143;AN=1400;set=Intersection
22	32000307	.	C	T	93.78	PASS	AC=5;AF=0.00380;AN=1316;set=Intersection
22	32000366	.	G	C	387.09	PASS	AC=6;AF=0.00430;AN=1396;set=Intersection
22	32000872	.	G	A	3025.07	PASS	AC=13;AF=0.01057;AN=1230;DS;set=Intersection
22	32000930	.	C	T	1936.81	PASS	AC=25;AF=0.02049;AN=1220;DS;set=Intersection
22	32000938	.	C	T	146.18	PASS	AC=1;AF=0.00083;AN=1202;DS;set=Intersection
22	32000943	.	G	A	82.13	PASS	AC=1;AF=0.00084;AN=1188;DS;set=Intersection
22	32002294	.	T	C	256198.01	PASS	AC=1153;AF=0.85917;AN=1342;DS;set=Intersection
22	32002351	.	C	G	1802.50	PASS	AC=3;AF=0.00210;AN=1428;DS;set=Intersection
22	32003931	.	C	G	804.85	PASS	AC=3;AF=0.00215;AN=1398;DS;set=Intersection
22	32003939	.	G	A	840.39	PASS	AC=3;AF=0.00217;AN=1382;DS;set=Intersection
22	32007091	.	C	G	7266.36	PASS	AC=7;AF=0.00496;AN=1410;DS;set=Intersection
22	32007137	.	C	T	21202.81	PASS	AC=29;AF=0.02017;AN=1438;DS;set=Intersection
22	32007153	.	G	A	23006.61	PASS	AC=42;AF=0.02958;AN=1420;DS;set=Intersection
22	32007217	.	C	T	319.80	PASS	AC=1;AF=0.00075;AN=1334;DS;set=Intersection
22	32007264	.	A	T	4376.36	PASS	AC=9;AF=0.00696;AN=1294;DS;set=Intersection
22	32007810	.	G	A	1336.50	PASS	AC=4;AF=0.00303;AN=1320;DS;set=Intersection
22	32007863	.	C	T	12096.87	PASS	AC=97;AF=0.07111;AN=1364;DS;set=Intersection
22	32007867	.	A	G	4721.72	PASS	AC=17;AF=0.01241;AN=1370;DS;set=Intersection
22	32007869	.	C	T	345.77	PASS	AC=1;AF=0.00073;AN=1372;DS;set=Intersection
22	32009184	.	C	A	190.30	PASS	AC=1;AF=0.00072;AN=1398;DS;set=Intersection
22	32009308	.	G	C	146.67	PASS	AC=1;AF=0.00076;AN=1324;DS;set=Intersection
22	32009328	.	C	T	2431.45	PASS	AC=10;AF=0.00758;AN=1320;DS;set=Intersection
22	32009455	.	T	G	636.57	PASS	AC=4;AF=0.00340;AN=1176;DS;set=Intersection
22	32009521	.	G	A	282.56	PASS	AC=5;AF=0.00399;AN=1254;set=Intersection
22	32009869	.	C	T	302.50	PASS	AC=1;AF=0.00080;AN=1250;set=Intersection
22	32010772	.	C	T	215.13	PASS	AC=1;AF=0.00079;AN=1268;DS;set=Intersection
22	32011118	.	G	A	171.06	PASS	AC=1;AF=0.00078;AN=1278;DS;set=Intersection
22	32011225	.	T	C	32490.63	PASS	AC=483;AF=0.36814;AN=1312;set=Intersection
22	32011250	.	G	A	46.05	PASS	AC=1;AF=0.00076;AN=1308;set=Intersection
22	32012878	.	C	CCTGA	7567.54	PASS	AC=17;AF=0.01254;AN=1356;DS;set=Intersection
22	32014129	.	C	T	110.56	PASS	AC=2;AF=0.00161;AN=1242;set=Intersection
22	32014131	.	CA	C	121.73	PASS	AC=1;AF=0.00080;AN=1254;set=Intersection
22	32014160	.	C	T	165.69	PASS	AC=1;AF=0.00078;AN=1278;set=Intersection
22	32014161	.	G	A	3155.21	PASS	AC=51;AF=0.03972;AN=1284;set=Intersection
22	32014245	.	G	A	331.10	PASS	AC=3;AF=0.00250;AN=1202;set=Intersection
22	32014250	.	G	A	9469.77	PASS	AC=147;AF=0.12332;AN=1192;set=Intersection
22	32014255	.	G	A	1193.31	PASS	AC=10;AF=0.00831;AN=1204;set=Intersection
22	32014296	.	C	T	2938.82	PASS	AC=12;AF=0.00980;AN=1224;set=Intersection
22	32014359	.	C	T	212.89	PASS	AC=1;AF=0.00086;AN=1160;set=Intersection
22	32014365	.	C	T	239.82	PASS	AC=1;AF=0.00087;AN=1154;set=Intersection
22	32014366	.	G	A	442.03	PASS	AC=5;AF=0.00435;AN=1150;set=Intersection
22	32014410	.	T	G	47.32	PASS	AC=1;AF=0.00090;AN=1116;set=Intersection
22	32014411	.	C	T	187.53	PASS	AC=1;AF=0.00089;AN=1118;set=Intersection
22	32015616	.	T	C	584.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32015742	.	G	A	693.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32015765	.	C	T	957.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32015766	.	G	A	15279.84	PASS	AC=47;AF=0.02859;AN=1644;DS;set=Intersection
22	32015839	.	G	T	4565.26	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	32015870	.	C	T	40.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32016541	.	G	A,T	628.67	PASS	AC=1,1;AF=0.00061,0.00061;AN=1644;DS;set=Intersection
22	32016621	.	G	A	2941.95	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	32016719	.	C	T	490.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32016726	.	C	T	11970.04	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	32016729	.	C	T	794.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32016730	.	G	A	695.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32016964	.	C	T	213.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32016974	.	G	A	632.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32016996	.	C	T	868.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32017272	.	A	G	574.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32017296	.	A	G	36577.32	PASS	AC=86;AF=0.05231;AN=1644;DS;set=Intersection
22	32017301	.	C	A,G,T	2445.69	PASS	AC=0,3,1;AF=0.00000,0.00182,0.00061;AN=1644;DS;set=Intersection
22	32017587	.	G	A	8648.56	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	32017608	.	C	A	612.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32017615	.	A	G	278.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32017637	.	C	G	700.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32017655	.	C	T	979.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32017659	.	C	T	83.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32017716	.	C	T	468.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32017778	.	C	T	458.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32019630	.	G	A	124.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32019645	.	G	A	954.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32019696	.	G	A	10083.95	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	32019741	.	C	T	675.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32019772	.	G	A	379.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32019806	.	C	T	2193.14	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	32019824	.	G	C	738.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32021729	.	C	A,T	1904.99	PASS	AC=19,16;AF=0.01182,0.00995;AN=1608;DS;set=Intersection
22	32021836	.	C	T	24276.53	PASS	AC=239;AF=0.14882;AN=1606;DS;set=Intersection
22	32084131	.	T	G	5813.86	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	32084234	.	A	G	781.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32084246	.	TTCTC	T,TTC	1222.86	PASS	AC=21,0;AF=0.01279,0.00000;AN=1642;DS;set=Intersection
22	32084255	.	TC	T	865.79	PASS	AC=12;AF=0.00732;AN=1640;DS;set=Intersection
22	32084256	.	C	T	2463.92	PASS	AC=11;AF=0.00671;AN=1640;DS;set=Intersection
22	32097775	.	T	C	104376.88	PASS	AC=614;AF=0.37348;AN=1644;DS;set=Intersection
22	32099626	.	G	A	733.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32099737	.	G	C	862.17	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32100620	.	C	T	580.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32108185	.	C	T	652.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32150866	.	C	G	847.48	PASS	AC=1;AF=0.00083;AN=1208;DS;set=Intersection
22	32150997	.	A	T	1073.69	PASS	AC=1;AF=0.00077;AN=1292;DS;set=Intersection
22	32154482	.	G	C	6490.58	PASS	AC=6;AF=0.00461;AN=1302;DS;set=Intersection
22	32154502	.	T	C	2381.10	PASS	AC=5;AF=0.00384;AN=1302;DS;set=Intersection
22	32156608	.	G	A	2569.73	PASS	AC=8;AF=0.00660;AN=1212;DS;set=Intersection
22	32156625	.	G	A	460.83	PASS	AC=1;AF=0.00082;AN=1216;DS;set=Intersection
22	32161019	.	T	C	633.99	PASS	AC=1;AF=0.00085;AN=1176;DS;set=Intersection
22	32161029	.	A	G	455.38	PASS	AC=1;AF=0.00084;AN=1190;DS;set=Intersection
22	32161092	.	C	T	12965.46	PASS	AC=72;AF=0.06081;AN=1184;DS;set=Intersection
22	32164790	.	C	T	13470.74	PASS	AC=41;AF=0.03355;AN=1222;DS;set=Intersection
22	32164832	.	G	C	761.26	PASS	AC=1;AF=0.00082;AN=1214;DS;set=Intersection
22	32164876	.	T	C	1052.12	PASS	AC=1;AF=0.00082;AN=1222;DS;set=Intersection
22	32174058	.	T	C	1118.34	PASS	AC=1;AF=0.00082;AN=1218;DS;set=Intersection
22	32174198	.	A	G	19053.77	PASS	AC=52;AF=0.04305;AN=1208;DS;set=Intersection
22	32179850	.	G	C	340888.64	PASS	AC=1198;AF=0.98036;AN=1222;DS;set=Intersection
22	32179863	.	C	G	737.84	PASS	AC=1;AF=0.00083;AN=1208;DS;set=Intersection
22	32179926	.	A	C	1038.19	PASS	AC=1;AF=0.00083;AN=1202;DS;set=Intersection
22	32188774	.	C	G	1417.24	PASS	AC=1;AF=0.00084;AN=1184;DS;set=Intersection
22	32188784	.	T	G	956	PASS	AC=1;AF=0.00085;AN=1176;DS;set=Intersection
22	32193631	.	C	T	563.25	PASS	AC=1;AF=0.00083;AN=1210;DS;set=Intersection
22	32193715	.	G	A	1030.96	PASS	AC=2;AF=0.00154;AN=1298;DS;set=Intersection
22	32193717	.	G	A	7781.37	PASS	AC=11;AF=0.00850;AN=1294;DS;set=Intersection
22	32194530	.	A	G	606.01	PASS	AC=1;AF=0.00087;AN=1144;DS;set=Intersection
22	32194531	.	T	C	599.39	PASS	AC=1;AF=0.00087;AN=1150;DS;set=Intersection
22	32194581	.	A	G	10412.55	PASS	AC=42;AF=0.03590;AN=1170;DS;set=Intersection
22	32194666	.	G	A	187.67	PASS	AC=1;AF=0.00087;AN=1150;DS;set=Intersection
22	32194692	.	A	G	825.55	PASS	AC=1;AF=0.00087;AN=1150;DS;set=Intersection
22	32198857	.	A	G	1701.39	PASS	AC=2;AF=0.00147;AN=1362;DS;set=Intersection
22	32198862	.	C	T	35651.43	PASS	AC=114;AF=0.08395;AN=1358;DS;set=Intersection
22	32198868	.	C	A	2131.84	PASS	AC=3;AF=0.00222;AN=1350;DS;set=Intersection
22	32200112	.	C	G	574.50	PASS	AC=1;AF=0.00090;AN=1108;DS;set=Intersection
22	32200161	.	T	C	12238.38	PASS	AC=26;AF=0.02277;AN=1142;DS;set=Intersection
22	32200849	.	C	T	7771.39	PASS	AC=17;AF=0.01387;AN=1226;DS;set=Intersection
22	32202089	.	CTGTT	C	9904.45	PASS	AC=9;AF=0.00805;AN=1118;DS;set=Intersection
22	32205559	.	G	A	11793.09	PASS	AC=11;AF=0.00915;AN=1202;DS;set=Intersection
22	32205630	.	A	G	248.57	PASS	AC=1;AF=0.00082;AN=1226;DS;set=Intersection
22	32205632	.	A	C	36120.68	PASS	AC=116;AF=0.09462;AN=1226;DS;set=Intersection
22	32206512	.	G	A	1099.78	PASS	AC=1;AF=0.00080;AN=1248;DS;set=Intersection
22	32211004	.	G	C	38259.95	PASS	AC=42;AF=0.02996;AN=1402;DS;set=Intersection
22	32211098	.	C	T	858.03	PASS	AC=1;AF=0.00071;AN=1402;DS;set=Intersection
22	32217457	.	A	G	5236.53	PASS	AC=4;AF=0.00316;AN=1264;DS;set=Intersection
22	32217539	.	C	T	7813.88	PASS	AC=35;AF=0.02628;AN=1332;DS;set=Intersection
22	32217608	.	A	G	789.29	PASS	AC=1;AF=0.00073;AN=1368;DS;set=Intersection
22	32217655	.	C	T	1010.72	PASS	AC=1;AF=0.00073;AN=1364;DS;set=Intersection
22	32218692	.	C	T	291.12	PASS	AC=1;AF=0.00079;AN=1264;DS;set=Intersection
22	32218727	.	C	A	2483.65	PASS	AC=10;AF=0.00791;AN=1264;DS;set=Intersection
22	32218744	.	T	C	843.45	PASS	AC=2;AF=0.00159;AN=1260;DS;set=Intersection
22	32218747	.	C	T	930.39	PASS	AC=2;AF=0.00158;AN=1264;DS;set=Intersection
22	32229931	.	C	T	27747.69	PASS	AC=24;AF=0.01739;AN=1380;DS;set=Intersection
22	32229935	.	A	G	7686.84	PASS	AC=7;AF=0.00506;AN=1384;DS;set=Intersection
22	32229977	.	G	A	47409.97	PASS	AC=122;AF=0.08616;AN=1416;DS;set=Intersection
22	32232941	.	C	T	1179.80	PASS	AC=1;AF=0.00077;AN=1294;DS;set=Intersection
22	32232979	.	C	T	1130.51	PASS	AC=1;AF=0.00079;AN=1266;DS;set=Intersection
22	32233028	.	C	G	24805.14	PASS	AC=23;AF=0.01786;AN=1288;DS;set=Intersection
22	32233073	.	C	T	1138.87	PASS	AC=1;AF=0.00077;AN=1300;DS;set=Intersection
22	32233189	.	G	A	553.42	PASS	AC=1;AF=0.00080;AN=1248;DS;set=Intersection
22	32234728	.	C	T	947.80	PASS	AC=1;AF=0.00075;AN=1328;DS;set=Intersection
22	32234797	.	G	A	5190.21	PASS	AC=10;AF=0.00749;AN=1336;DS;set=Intersection
22	32234798	.	C	T	541.91	PASS	AC=1;AF=0.00075;AN=1328;DS;set=Intersection
22	32239103	.	T	G	910.56	PASS	AC=1;AF=0.00082;AN=1214;DS;set=Intersection
22	32239669	.	G	C	1625.44	PASS	AC=2;AF=0.00170;AN=1176;DS;set=Intersection
22	32239739	.	G	A	4744.87	PASS	AC=11;AF=0.00984;AN=1118;DS;set=Intersection
22	32240955	.	A	G	668.04	PASS	AC=2;AF=0.00140;AN=1430;DS;set=Intersection
22	32241046	.	G	C	830.33	PASS	AC=1;AF=0.00071;AN=1404;DS;set=Intersection
22	32241058	.	T	C	4428.34	PASS	AC=5;AF=0.00343;AN=1458;DS;set=Intersection
22	32241252	.	G	A	254.41	PASS	AC=1;AF=0.00074;AN=1356;DS;set=Intersection
22	32242806	.	C	T	724.15	PASS	AC=1;AF=0.00082;AN=1226;DS;set=Intersection
22	32242867	.	G	A	855.02	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	32253516	.	A	C	193.61	PASS	AC=1;AF=0.00072;AN=1386;set=Intersection
22	32266546	.	A	T	120205.10	PASS	AC=374;AF=0.30161;AN=1240;DS;set=Intersection
22	32266603	.	A	G	15599.10	PASS	AC=24;AF=0.01983;AN=1210;DS;set=Intersection
22	32270221	.	C	A	196.68	PASS	AC=1;AF=0.00076;AN=1324;set=Intersection
22	32270378	.	T	C	466.45	PASS	AC=2;AF=0.00153;AN=1308;set=Intersection
22	32270409	.	G	A	1907.12	PASS	AC=13;AF=0.01027;AN=1266;set=Intersection
22	32272130	.	A	G	1161.46	PASS	AC=1;AF=0.00084;AN=1184;DS;set=Intersection
22	32272191	.	C	T	645	PASS	AC=1;AF=0.00084;AN=1194;DS;set=Intersection
22	32272261	.	G	A	1211.87	PASS	AC=1;AF=0.00082;AN=1214;DS;set=Intersection
22	32272266	.	G	A	983.84	PASS	AC=1;AF=0.00083;AN=1208;DS;set=Intersection
22	32275515	.	C	T	717.17	PASS	AC=1;AF=0.00070;AN=1438;DS;set=Intersection
22	32275576	.	C	T	707.32	PASS	AC=1;AF=0.00072;AN=1384;DS;set=Intersection
22	32289659	.	T	C	437.26	PASS	AC=1;AF=0.00078;AN=1290;DS;set=Intersection
22	32289784	.	T	A	4480.13	PASS	AC=7;AF=0.00558;AN=1254;DS;set=Intersection
22	32297691	.	G	A	1320.95	PASS	AC=7;AF=0.00604;AN=1158;set=Intersection
22	32297743	.	C	T	106.26	PASS	AC=1;AF=0.00085;AN=1180;DS;set=Intersection
22	32297765	.	C	A	527.97	PASS	AC=1;AF=0.00084;AN=1192;DS;set=Intersection
22	32302045	.	C	T	2482.81	PASS	AC=11;AF=0.00814;AN=1352;DS;set=Intersection
22	32302065	.	G	A	680.21	PASS	AC=2;AF=0.00147;AN=1356;DS;set=Intersection
22	32302094	.	C	T	77.25	PASS	AC=1;AF=0.00076;AN=1308;DS;set=Intersection
22	32302487	.	C	CAGGCTGCACCAGGGTTAGA	20579.38	PASS	AC=10;AF=0.00672;AN=1488;DS;set=Intersection
22	32302512	.	G	A	991.71	PASS	AC=1;AF=0.00067;AN=1492;DS;set=Intersection
22	32330089	.	C	T	245.28	PASS	AC=2;AF=0.00136;AN=1476;DS;set=Intersection
22	32333967	.	T	G	1176.95	PASS	AC=1;AF=0.00071;AN=1414;DS;set=Intersection
22	32333988	.	G	C	1105.83	PASS	AC=1;AF=0.00074;AN=1348;DS;set=Intersection
22	32334021	.	T	A	142010.22	PASS	AC=276;AF=0.20505;AN=1346;DS;set=Intersection
22	32334058	.	T	C	31526.24	PASS	AC=32;AF=0.02399;AN=1334;DS;set=Intersection
22	32334059	.	G	A	1496.18	PASS	AC=1;AF=0.00075;AN=1332;DS;set=Intersection
22	32340837	.	CG	C	1429.64	PASS	AC=244;AF=0.4251;AN=574;set=Intersection
22	32352215	.	C	G	837.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32352698	.	G	A	2529.25	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	32352791	.	G	A	30477.52	PASS	AC=340;AF=0.20706;AN=1642;DS;set=Intersection
22	32439256	.	C	CA	515.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32439269	.	A	G	597.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32439274	.	C	T	8167.29	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	32439303	.	C	T	1010.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32439318	.	T	C	3212.65	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	32439365	.	G	A	859.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32445893	.	T	C	13248.51	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	32445900	.	C	T	961.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32445946	.	A	G	25439.47	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	32462909	.	T	A	789.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32462914	.	G	A	1187.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32463051	.	C	T	508.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32464041	.	C	T	2910.20	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32464460	.	G	C	671.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32477867	.	G	A	1079.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32479101	.	G	A	1690.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32479102	.	G	T	785.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32480376	.	T	C	623.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32480379	.	C	T	1067.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32480505	.	C	T	1518.96	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32480521	.	A	G	1032.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32480574	.	G	A	1035.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32480623	.	T	G	762.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32482200	.	T	C	1128.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32482251	.	G	A	758.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32482277	.	C	T	15859.46	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	32482310	.	C	T	2100.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32482321	.	T	G	307529.03	PASS	AC=635;AF=0.38625;AN=1644;DS;set=Intersection
22	32487555	.	C	T	13745.59	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	32487575	.	C	T	2403.99	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32487590	.	C	T	4859.26	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	32487639	.	CATG	C	1461.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32487651	.	G	A	591.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32487669	.	C	T	1831.20	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32487700	.	G	A	21436.05	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	32487744	.	C	T	15195.38	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	32495248	.	C	T	1138.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32498089	.	C	T	847.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32500727	.	G	A	317.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32500768	.	T	C	12943.01	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	32500870	.	T	C	600.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32505956	.	T	C	9074.35	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	32506041	.	A	G	23762	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	32506050	.	C	G	23406.02	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	32506104	.	G	A	23864.87	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	32506143	.	C	T	23392.80	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	32545720	.	C	G	3038.12	PASS	AC=6;AF=0.00367;AN=1636;DS;set=Intersection
22	32545762	.	C	T	12603.78	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	32545789	.	C	T	11326.81	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	32546289	.	A	G	54475.70	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	32546299	.	A	G	6249.73	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	32546312	.	C	T	702.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32546313	.	G	A	965.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32546319	.	A	G	953.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32546409	.	G	A	909.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32546959	.	G	T	15812.15	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	32546975	.	G	A	849.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32547484	.	G	A	4703.10	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32547523	.	A	T	5031.64	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	32548021	.	G	A	34837.62	PASS	AC=54;AF=0.03285;AN=1644;DS;set=Intersection
22	32548036	.	T	TA	871.42	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32548060	.	C	T	1433.60	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32548128	.	G	T	754.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32554956	.	C	T	2168.21	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32554985	.	A	G	284442.50	PASS	AC=848;AF=0.51582;AN=1644;DS;set=Intersection
22	32554996	.	C	T	42265.91	PASS	AC=96;AF=0.05839;AN=1644;DS;set=Intersection
22	32554997	.	G	A	9866.96	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	32555023	.	G	A	760.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32587251	.	C	A	72866.69	PASS	AC=69;AF=0.04197;AN=1644;DS;set=Intersection
22	32587273	.	A	C	1899.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32587286	.	C	T	31890.97	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	32587302	.	G	A	1797.99	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32587350	.	GA	G,GAA	22288.65	PASS	AC=38,0;AF=0.02311,0.00000;AN=1644;DS;set=Intersection
22	32588901	.	G	A	2323.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32588980	.	C	G	1237.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32589023	.	C	T	161576.65	PASS	AC=542;AF=0.32968;AN=1644;DS;set=Intersection
22	32589034	.	T	C	302954.86	PASS	AC=689;AF=0.41910;AN=1644;DS;set=Intersection
22	32614464	.	T	G	1052.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32614536	.	C	T	721.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32614694	.	C	T	912.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32614712	.	T	C	1872.28	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32614713	.	C	T	3154.69	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32616864	.	C	T	2399.81	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	32616870	.	G	A	73513.12	PASS	AC=138;AF=0.08394;AN=1644;DS;set=Intersection
22	32616967	.	G	A	821.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32616971	.	C	T	8423.69	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	32616985	.	G	A	1702.87	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32617002	.	C	T	2272.52	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	32620322	.	G	A	793.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32620349	.	C	T	1134.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32621619	.	C	T	250414.76	PASS	AC=643;AF=0.39112;AN=1644;DS;set=Intersection
22	32621730	.	T	C	839.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32621731	.	G	A	961.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32625151	.	G	A	1039.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32625163	.	G	T	1037.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32625208	.	G	A	1292.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32625210	.	C	T	47934.39	PASS	AC=103;AF=0.06265;AN=1644;DS;set=Intersection
22	32625260	.	C	T	907.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32625297	.	G	A	768.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32625347	.	G	A	1000.43	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32625352	.	A	G	917.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32626908	.	G	A	93742.80	PASS	AC=526;AF=0.31995;AN=1644;DS;set=Intersection
22	32627045	.	C	CCA	204.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32628870	.	C	T	934.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32628900	.	C	T	6850.97	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	32628961	.	T	A	1006.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32629008	.	C	T	1083.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32629026	.	C	T	5702.30	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	32629034	.	C	T	922.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32629046	.	A	T	456.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32630812	.	CACAG	C	3683.15	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	32630851	.	A	G	951.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32630883	.	A	G	1068.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32630898	.	T	C	1082.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32630946	.	G	A	1545.74	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32630990	.	C	T	8250.19	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	32631018	.	C	T	685.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32631081	.	C	T	1083.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32633317	.	G	A	984.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32634941	.	C	A	8152.11	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	32634951	.	C	T	2719.46	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32635113	.	G	A	1218.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32635119	.	G	T	539.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32643354	.	G	C	307.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32643357	.	C	G	780.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32643425	.	G	A	7948.18	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	32643447	.	AC	A	2504.12	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	32643460	.	C	A	3171.32	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	32643471	.	C	T	430.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32643537	.	C	T	1008.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32647763	.	T	A	1630.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32647802	.	C	T	1865.75	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	32647831	.	C	T	824.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32647832	.	G	A	811.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32647857	.	C	T	934.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32650106	.	C	T	1048.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32650107	.	C	T	1528.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32650182	.	G	A	611.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32650200	.	C	T	52893.55	PASS	AC=114;AF=0.06934;AN=1644;DS;set=Intersection
22	32651143	.	C	A	1181.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32651198	.	A	T	1023.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32651226	.	C	T	2101.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32651238	.	C	T	905.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32651262	.	A	G	41385.56	PASS	AC=109;AF=0.06630;AN=1644;DS;set=Intersection
22	32651295	.	T	A	12763.78	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	32651306	.	G	A	18841.57	PASS	AC=51;AF=0.03102;AN=1644;DS;set=Intersection
22	32651345	.	C	T	1867.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32754014	.	G	A	2096.83	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	32754286	.	G	A	15349.48	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	32754382	.	C	G	16996.22	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	32754386	.	C	A	66528.79	PASS	AC=135;AF=0.08212;AN=1644;DS;set=Intersection
22	32754419	.	C	T	1317.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32754453	.	C	A	1003.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32756241	.	G	A	25794.14	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	32756460	.	G	C	5025.04	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	32756830	.	CA	C	65721.75	PASS	AC=278;AF=0.16910;AN=1644;DS;set=Intersection
22	32783940	.	G	T	1117.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32783959	.	C	T	694.88	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32784051	.	T	C	96816.59	PASS	AC=304;AF=0.18491;AN=1644;DS;set=Intersection
22	32784127	.	AAC	A	1967.25	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	32788197	.	T	C	8694.42	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	32788248	.	T	A	48496.64	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	32788264	.	G	A	968.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32788393	.	A	G	493.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32790036	.	G	C	971.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32790972	.	G	A	16157.69	PASS	AC=65;AF=0.03954;AN=1644;DS;set=Intersection
22	32790981	.	C	G	74705.56	PASS	AC=150;AF=0.09124;AN=1644;DS;set=Intersection
22	32791003	.	A	C	276272.54	PASS	AC=978;AF=0.59489;AN=1644;DS;set=Intersection
22	32791057	.	G	A	796.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32791151	.	C	G	2209.73	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32791195	.	C	T	1069.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32792020	.	A	G	775.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32792029	.	G	A	1413.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32792056	.	T	C	2999.14	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32792065	.	C	T	888.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32792151	.	G	A	732.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32792223	.	A	G	21029.60	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	32792282	.	A	G	619.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32794043	.	A	C	1365.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32795578	.	A	G	958.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32795626	.	T	C	57152.99	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	32795641	.	C	T	248255.25	PASS	AC=719;AF=0.43735;AN=1644;DS;set=Intersection
22	32795708	.	G	A	902.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32795751	.	A	G	49394.54	PASS	AC=118;AF=0.07178;AN=1644;DS;set=Intersection
22	32795786	.	G	A	4942.40	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	32797744	.	T	C	992.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32797807	.	G	T	2578.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32797808	.	C	T	840.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32802603	.	C	G	17621.27	PASS	AC=65;AF=0.03954;AN=1644;DS;set=Intersection
22	32802631	.	T	G	1119	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32802680	.	A	G	50924.81	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	32802718	.	C	T	1039.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32802742	.	T	C	1226.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32802790	.	G	C	965.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32804122	.	T	C	27063.79	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	32804176	.	G	T	641.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32804782	.	T	C	435	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32804861	.	C	T	780.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32808005	.	C	T	476.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32808011	.	C	G	25735.74	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	32808012	.	G	T	1912	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	32808078	.	G	A	32793.12	PASS	AC=84;AF=0.05109;AN=1644;DS;set=Intersection
22	32808158	.	T	C	1756.96	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	32810346	.	C	T	657.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32810378	.	T	G	37953.75	PASS	AC=84;AF=0.05109;AN=1644;DS;set=Intersection
22	32811856	.	T	A	121.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32811884	.	T	C	15996.81	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	32811952	.	A	G	173743.52	PASS	AC=973;AF=0.59185;AN=1644;DS;set=Intersection
22	32811973	.	A	G	11729.54	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	32811998	.	G	A	19313.80	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	32812006	.	ATTGGGCACAAGCACAGAGG	A	19514.62	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	32813110	.	G	A	712.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32813176	.	CT	C	34793.41	PASS	AC=1044;AF=0.63504;AN=1644;DS;set=Intersection
22	32815398	.	G	A	27951.85	PASS	AC=51;AF=0.03102;AN=1644;DS;set=Intersection
22	32815441	.	T	C	773.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32827417	.	G	A	874.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32827423	.	A	AT	836.02	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	32828343	.	T	C	131600.13	PASS	AC=318;AF=0.19343;AN=1644;DS;set=Intersection
22	32828366	.	C	A	760.09	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32828375	.	G	A	1018.09	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32828429	.	G	A	864.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32828544	.	G	A	12813.06	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	32828556	.	A	C	837.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32829800	.	G	A	1626.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32831711	.	C	G	125869.45	PASS	AC=175;AF=0.10645;AN=1644;DS;set=Intersection
22	32831721	.	C	T	6016.58	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	32831769	.	G	A	699.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32831809	.	A	G	44703.29	PASS	AC=136;AF=0.08273;AN=1644;DS;set=Intersection
22	32831828	.	A	AG	3029.88	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	32831830	.	G	A	57741.29	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	32831837	.	C	T	1736.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32833717	.	G	A	478.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32833729	.	T	C	832.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32833754	.	T	C	958.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32838673	.	G	A	356.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32841928	.	T	C	1048.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32841950	.	G	A	1148.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32842003	.	G	A	2981.64	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32842010	.	A	C	855.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32843175	.	C	T	1856.78	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32843258	.	C	T	599.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32843259	.	G	A	2925.60	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32843312	.	G	A	45743.96	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	32843317	.	T	C	278.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32849352	.	G	A	214.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32849393	.	A	G	286.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32849470	.	T	A	23615.49	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	32849525	.	G	A	390.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32853229	.	T	C	1136.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32871011	.	C	T	114.22	PASS	AC=21;AF=0.0215;AN=976;set=Intersection
22	32871120	.	G	A	285.68	PASS	AC=4;AF=0.00299;AN=1340;set=Intersection
22	32871365	.	G	A	10528.99	PASS	AC=89;AF=0.07659;AN=1162;DS;set=Intersection
22	32871383	.	T	G	19327.46	PASS	AC=214;AF=0.18197;AN=1176;DS;set=Intersection
22	32874953	.	T	G	855.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32874958	.	T	G	2189.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32875050	.	G	A	866.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32875122	.	T	G	1263.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32875157	.	C	T	1104.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32875190	.	G	A	197751.45	PASS	AC=813;AF=0.49453;AN=1644;DS;set=Intersection
22	32875203	.	C	T	839.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32879841	.	A	T	278.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32879849	.	TTTAA	T	4746.24	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	32879974	.	C	T	771.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32880006	.	A	G	22292.04	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	32880067	.	G	A	1900.60	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32880130	.	A	T	575.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32880140	.	C	T	711.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32880143	.	A	G	24166.02	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	32881102	.	C	T	1016	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32881190	.	G	A	757.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32881225	.	G	A	921.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32881243	.	C	T	844.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32883747	.	A	G	677.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32883853	.	T	C	405.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32887150	.	C	T	192325.91	PASS	AC=814;AF=0.49513;AN=1644;DS;set=Intersection
22	32889065	.	C	G	38285.15	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	32889077	.	T	C	2750.92	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	32889078	.	T	G	25602.89	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	32889191	.	C	T	951.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32889249	.	A	G	1366.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32889265	.	C	T	988.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32889277	.	C	T	1161.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32889287	.	T	C	1495.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32889293	.	C	T	2698.82	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32891435	.	G	A	1036.16	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32891535	.	T	G	890.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32894169	.	G	A	866.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32894198	.	C	G	774.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32894219	.	T	A	819.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32894220	.	C	T	785.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32894453	.	A	G	1032.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32909637	.	C	T	482.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32909653	.	C	G	931.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32909751	.	T	A	737.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32909824	.	G	C	823.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32909831	.	G	A	726.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32913997	.	T	C	881.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32914067	.	C	G	1754.03	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	32914089	.	A	G	47725.66	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	32914231	.	C	T	73327.77	PASS	AC=83;AF=0.05049;AN=1644;DS;set=Intersection
22	32914233	.	C	T	99814.91	PASS	AC=122;AF=0.07421;AN=1644;DS;set=Intersection
22	32914312	.	C	T	2010.33	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	32914344	.	G	A	186.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32923890	.	C	A	716.65	PASS	AC=1;AF=0.00062;AN=1622;DS;set=Intersection
22	32923919	.	C	T	461.25	PASS	AC=1;AF=0.00063;AN=1600;DS;set=Intersection
22	32923920	.	G	T	886.94	PASS	AC=1;AF=0.00062;AN=1604;DS;set=Intersection
22	32923949	.	A	G	280.25	PASS	AC=1;AF=0.00063;AN=1596;DS;set=Intersection
22	32923979	.	T	C	1113.44	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	32924024	.	A	G	809.35	PASS	AC=2;AF=0.00124;AN=1618;DS;set=Intersection
22	32924840	.	C	T	1485.54	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	32924854	.	G	T	25230.46	PASS	AC=47;AF=0.02859;AN=1644;DS;set=Intersection
22	32929861	.	C	G	666.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32934139	.	C	T	32813.30	PASS	AC=92;AF=0.05596;AN=1644;DS;set=Intersection
22	32934145	.	T	G	745.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32937601	.	G	A	666.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32937633	.	C	T	361.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32937658	.	G	A	1044.91	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	32937720	.	G	GA	5654.72	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	32937740	.	T	C	158349.04	PASS	AC=1037;AF=0.63078;AN=1644;DS;set=Intersection
22	32992633	.	T	G	695.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32992675	.	G	A	334.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	32992729	.	G	A	808.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	33245404	.	T	G	83.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33253186	.	G	A	665	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33253280	.	T	C	309858.58	PASS	AC=1039;AF=0.63200;AN=1644;DS;set=Intersection
22	33253292	.	C	T	99894.68	PASS	AC=274;AF=0.16667;AN=1644;DS;set=Intersection
22	33253337	.	C	T	701.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33253986	.	T	C	774.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33254048	.	G	A	717.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33254112	.	G	A	1081.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33255124	.	C	A	444.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33255244	.	C	T	868.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33255274	.	C	T	1056.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33255284	.	C	T	785.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33255315	.	G	A	212.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33255403	.	G	A	1595.86	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	33260866	.	A	G	1032.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33260886	.	A	G	725.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33264982	.	C	T	1040.91	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	33327345	.	GA	G	479.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33327354	.	G	A	9144.65	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	33327390	.	C	T	754.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33327428	.	G	A	6844.87	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	33327478	.	A	G	1702.85	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	33376632	.	G	T	907.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33376709	.	C	T	13413.23	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	33376726	.	C	A	1103.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33402292	.	C	T	5749.05	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	33402504	.	C	A	4414.90	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	33402516	.	G	A	948.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33402579	.	C	T	871.21	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	33402580	.	G	A	5753.19	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	33402604	.	G	A	2246.10	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	33670584	.	G	A	17042.07	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	33673010	.	G	A	5299.57	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	33673104	.	C	T	1010.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33673118	.	G	A	939.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33673125	.	C	T	3121.80	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	33673170	.	C	T	20698.93	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	33673191	.	C	T	599.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33673252	.	C	A	620.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33679157	.	C	T	671.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33679238	.	T	C	15960.37	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	33679277	.	C	T	928.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33679319	.	C	T	906.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33679358	.	A	G	32525.29	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	33700270	.	T	C	874.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33700289	.	C	G	571.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33700346	.	G	A	1857.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	33700360	.	C	T	908.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33700367	.	G	A	576.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33700397	.	G	A	21333.61	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	33700521	.	G	A	10083.57	PASS	AC=53;AF=0.03244;AN=1634;DS;set=Intersection
22	33712033	.	G	A	5180.95	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	33733597	.	C	T	576.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33733609	.	G	T	119.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33733678	.	C	T	767.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33733797	.	A	G	556.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33777874	.	A	G	1038.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33777923	.	T	C	1003.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33778028	.	A	G	8401.26	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	33780167	.	T	C	822.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33780264	.	G	A	1091.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33780307	.	G	C	1266.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	33828097	.	G	A	4988.09	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	33828280	.	T	C	2874.92	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	33960913	.	C	T	560.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	33961043	.	GA	G	817.99	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	34000460	.	G	A	17787.95	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	34000484	.	C	T	8265.03	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	34022179	.	G	A	1274.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	34022219	.	T	C	747.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	34022284	.	G	A	129461.87	PASS	AC=751;AF=0.45681;AN=1644;DS;set=Intersection
22	34022302	.	G	A	743.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	34022349	.	C	G,T	8666.83	PASS	AC=10,1;AF=0.00608,0.00061;AN=1644;DS;set=Intersection
22	34046311	.	G	A	1246.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	34046345	.	C	T	270.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	34046410	.	G	A	486.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	34046452	.	G	A	22001.95	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	34046458	.	G	A	1033.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	34046550	.	C	T	745.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	34046551	.	G	A	676.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	34046582	.	C	T	76.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	34046596	.	C	G	4847.76	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	34046598	.	T	C	1668.17	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	34046643	.	C	G	1475.44	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	34046673	.	G	A	572.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	34157311	.	G	GTTCCCT	4833.66	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	34157494	.	C	T	13540.37	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	34157496	.	C	T	981.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35463058	.	CAG	C	314.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35463162	.	A	G	207516.48	PASS	AC=1252;AF=0.76156;AN=1644;DS;set=Intersection
22	35463167	.	G	A	1295.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35463179	.	T	C	199403.06	PASS	AC=1252;AF=0.76156;AN=1644;DS;set=Intersection
22	35463184	.	C	T	828.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35463215	.	T	C	6395.97	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	35463225	.	C	T	14521.80	PASS	AC=57;AF=0.03467;AN=1644;DS;set=Intersection
22	35463249	.	C	T	175243.19	PASS	AC=990;AF=0.60292;AN=1642;DS;set=Intersection
22	35463263	.	G	A	45.68	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	35463333	.	T	G	858.39	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	35478486	.	A	C	315053.72	PASS	AC=1029;AF=0.62591;AN=1644;DS;set=Intersection
22	35478518	.	G	A	817.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35478529	.	G	A	16303.88	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	35478592	.	C	T	899.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35478644	.	C	T	1014.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35478645	.	C	G	554.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35478688	.	C	T	115059.97	PASS	AC=580;AF=0.35280;AN=1644;DS;set=Intersection
22	35480400	.	A	T	1111.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35480407	.	G	A	646.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35480422	.	T	C	885.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35480467	.	C	T	48489.14	PASS	AC=103;AF=0.06265;AN=1644;DS;set=Intersection
22	35481455	.	G	A	1236.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35481461	.	A	C	474.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35481493	.	C	T	27001.36	PASS	AC=76;AF=0.04623;AN=1644;DS;set=Intersection
22	35481505	.	C	T	717.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35481661	.	G	T	31066.01	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	35481711	.	G	A	5616.89	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	35658379	.	C	T	4856.32	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	35659739	.	C	G	684.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35659741	.	G	T	807.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35659769	.	C	G	744.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35659770	.	A	G	1019.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35660605	.	C	A	36030.48	PASS	AC=80;AF=0.04866;AN=1644;DS;set=Intersection
22	35660648	.	G	A	2505.42	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	35660803	.	C	T	991.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35660875	.	G	T	210049.50	PASS	AC=819;AF=0.49818;AN=1644;DS;set=Intersection
22	35660888	.	G	A	992.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35660939	.	G	T	924.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35661087	.	C	T	1443.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35661127	.	G	A	940.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35661227	.	T	C	2083.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35661331	.	A	G	837.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35661373	.	A	G	637.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35661389	.	G	A	514.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35661486	.	G	A	443.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35661493	.	C	T	361.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35661560	.	A	G	671.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35679951	.	T	C	215394.83	PASS	AC=962;AF=0.58516;AN=1644;DS;set=Intersection
22	35680005	.	C	T	747.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35683463	.	C	T	694.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35683474	.	C	G	963	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35684217	.	T	C	924.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35684269	.	C	T	743.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35689156	.	T	C	475.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35689682	.	C	T	273.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35695894	.	G	A	1341.50	PASS	AC=14;AF=0.00892;AN=1570;DS;set=Intersection
22	35695905	.	C	T	731.55	PASS	AC=2;AF=0.00126;AN=1582;DS;set=Intersection
22	35696014	.	C	G	1985.23	PASS	AC=10;AF=0.00652;AN=1534;DS;set=Intersection
22	35713916	.	C	T	707.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35713931	.	C	T	16181.97	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	35713966	.	C	G	846.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35714004	.	C	T	6257.65	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	35717915	.	C	G	3161.76	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	35717937	.	T	C	1340.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35719010	.	C	T	850.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35719063	.	G	A	625.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35719515	.	G	A	681.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35719663	.	C	G	943.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35719725	.	C	T	715.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35719860	.	C	G	1576.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35719913	.	C	T	555.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35719954	.	A	G	1653.08	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	35723245	.	G	A	7542.54	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	35723320	.	G	A	7747.72	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	35723351	.	G	T	772.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35726354	.	G	A	592.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35726376	.	G	A	1108.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35726464	.	G	A	617.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35728953	.	C	T	804.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35729014	.	GTCT	G	1985	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35730403	.	G	A	331.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35730426	.	C	T	1028.38	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	35730489	.	C	T	371.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35734666	.	G	C	622.15	PASS	AC=1;AF=0.00064;AN=1568;DS;set=Intersection
22	35734736	.	C	T	119.48	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	35734737	.	G	A	1813.31	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	35741733	.	G	C	685.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35741765	.	G	A	1124.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35741816	.	A	G	1109.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35741820	.	G	A	98493.04	PASS	AC=406;AF=0.24696;AN=1644;DS;set=Intersection
22	35741823	.	G	T	3061.46	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	35742886	.	C	T	671.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35742925	.	T	G	229258.55	PASS	AC=499;AF=0.30353;AN=1644;DS;set=Intersection
22	35742933	.	C	T	2176.26	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	35743090	.	G	A	753.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35743124	.	G	C	176700.31	PASS	AC=474;AF=0.28832;AN=1644;DS;set=Intersection
22	35743151	.	G	A	664.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35743178	.	T	C	905.21	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	35743203	.	G	C	259.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35777149	.	G	T	75.92	PASS	AC=1;AF=0.00070;AN=1426;set=Intersection
22	35777185	.	G	C	1212.41	PASS	AC=63;AF=0.04315;AN=1460;set=Intersection
22	35779124	.	C	A	1908.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35779162	.	G	T	1886.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35779223	.	T	C	13941.83	PASS	AC=62;AF=0.03771;AN=1644;DS;set=Intersection
22	35779254	.	G	T	1552.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	35782659	.	C	T	7353.06	PASS	AC=62;AF=0.03771;AN=1644;DS;set=Intersection
22	35782755	.	C	T	711.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35782786	.	C	T	738.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35782911	.	C	T	1962.26	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	35782990	.	A	C	950.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35782991	.	A	T	906.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35782992	.	A	C	829.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35783085	.	C	T	184.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35783110	.	C	T	831.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35783136	.	A	G	6378.89	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	35783149	.	G	T	1580.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35783151	.	G	A	435.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35783154	.	C	T	277.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35785982	.	TC	T	3415.26	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	35786003	.	GGACTTGGCTGTCT	G	12000.82	PASS	AC=56;AF=0.03419;AN=1638;DS;set=Intersection
22	35789421	.	C	T	874.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35789464	.	C	G	1104.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35789560	.	C	T	587.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35789584	.	C	G	1124.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35789585	.	C	T	928.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35796398	.	G	C	448.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35796415	.	C	T	435.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35796437	.	G	A	45.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35796514	.	A	C	682.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35796578	.	G	T	126.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35796605	.	C	T	1415.51	PASS	AC=14;AF=0.00853;AN=1642;DS;set=Intersection
22	35796622	.	G	C	79.22	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	35799185	.	A	G	1294.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35799213	.	C	T	743	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35799299	.	C	T	1080.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35799345	.	C	A	1183.59	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	35799447	.	G	A	1554.28	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	35799487	.	G	C	585.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35799525	.	G	A	768.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35799542	.	C	T	135468.60	PASS	AC=825;AF=0.50182;AN=1644;DS;set=Intersection
22	35799584	.	C	G	2924.38	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	35802530	.	G	A	1073.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35802572	.	G	C	276.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35802592	.	C	T	866.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35802621	.	C	T	1232.14	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35802650	.	C	A	4419.67	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	35802659	.	C	G	940.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35802661	.	C	G	19345.58	PASS	AC=60;AF=0.03650;AN=1644;DS;set=Intersection
22	35802675	.	C	T	803.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35802686	.	C	T	4556.37	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	35802718	.	C	T	387.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35804479	.	G	T	497.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35804589	.	C	T	279.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35806700	.	C	T	5937.49	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	35806716	.	TC	T	1009.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35806720	.	C	T	999.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35806756	.	G	A	1762.81	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	35806815	.	T	C	90967.37	PASS	AC=155;AF=0.09428;AN=1644;DS;set=Intersection
22	35806821	.	C	T	573.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35808484	.	G	A	966.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35808550	.	C	T	1084.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35808708	.	C	T	27461.97	PASS	AC=144;AF=0.08759;AN=1644;DS;set=Intersection
22	35809819	.	C	T	114.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35809945	.	T	G	784.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35810001	.	T	C	1722.77	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	35810013	.	T	C	1936.46	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	35811830	.	G	C	1835.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35811852	.	G	A	894.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35811915	.	G	A	952.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35812004	.	G	A	39032.63	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	35812342	.	A	G	403.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35812389	.	A	G	1758.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35812408	.	C	T	737.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35812441	.	G	C	4808.04	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	35812781	.	G	T	371.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35812789	.	C	T	673.16	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35813718	.	T	C	1119.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35813766	.	C	T	1188.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35813767	.	G	A	858.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35813772	.	C	G	1565.03	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	35813809	.	G	A	663.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35815831	.	A	G	411.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35815852	.	C	T	2072.27	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	35815873	.	G	T	135.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35815880	.	G	A	69385.60	PASS	AC=176;AF=0.10706;AN=1644;DS;set=Intersection
22	35815954	.	G	A	187.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35815978	.	G	A	342.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35815980	.	C	T	367.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35816015	.	C	T	11032.24	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	35817329	.	G	T	781.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35817403	.	G	A	1551.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	35817471	.	C	A	4778.37	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	35819166	.	T	C	683.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35819180	.	G	A	35933.77	PASS	AC=52;AF=0.03163;AN=1644;DS;set=Intersection
22	35819186	.	C	T	816.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	35819193	.	C	T	305.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35819250	.	C	T	2130.19	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	35819284	.	A	G	345.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35819310	.	C	T	4554.93	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	35820152	.	C	A	230.67	PASS	AC=1;AF=0.00068;AN=1468;set=Intersection
22	35820175	.	T	C	75.26	PASS	AC=1;AF=0.00066;AN=1514;DS;set=Intersection
22	35820195	.	C	T	256.15	PASS	AC=1;AF=0.00065;AN=1530;DS;set=Intersection
22	35820254	.	G	A	1326.77	PASS	AC=41;AF=0.02793;AN=1468;DS;set=Intersection
22	35942878	.	G	A	2333.69	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	35947523	.	C	T	15011.94	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	35947576	.	C	T	747.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35947585	.	C	A	31431.38	PASS	AC=89;AF=0.05414;AN=1644;DS;set=Intersection
22	35947908	.	C	T	380.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35947974	.	G	A	526.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35948082	.	G	A	248.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	35948120	.	G	A	4673.10	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	36003390	.	C	T	795.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36003482	.	C	T	586.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36006922	.	T	TG	79228.92	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	36006923	.	G	GC	313497.55	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	36006924	.	C	CA	77759.52	PASS	AC=1621;AF=0.98601;AN=1644;DS;set=Intersection
22	36006952	.	C	T	360.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36007037	.	G	T	693.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36007045	.	G	A	214816.63	PASS	AC=907;AF=0.55170;AN=1644;DS;set=Intersection
22	36007075	.	C	T	199883.75	PASS	AC=857;AF=0.52129;AN=1644;DS;set=Intersection
22	36013290	.	G	A	855.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36013312	.	T	A	745.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36054612	.	T	G	3046.27	PASS	AC=11;AF=0.00670;AN=1642;set=Intersection
22	36054741	.	A	G	9409.65	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	36054806	.	C	T	712.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36054846	.	A	G	668.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36054862	.	C	T	1043.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36054874	.	C	G	423.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36054944	.	C	T	12121.55	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	36054945	.	G	A	427.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36054997	.	C	T	1093.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055005	.	C	T	1152.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055033	.	G	A	1111.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055036	.	C	T	933.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055077	.	G	A	779.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055130	.	T	A	16874.56	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	36055141	.	C	A	643.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055164	.	G	A	539.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055218	.	C	T	778.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055255	.	G	A	1104.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055265	.	G	A	271.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055281	.	G	A	978.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36055406	.	A	C	17931.17	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	36055415	.	G	A	1359.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36055428	.	G	A	599.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36113928	.	G	T	1032.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36116565	.	G	A	1288.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36116593	.	C	T	24604.25	PASS	AC=58;AF=0.03528;AN=1644;DS;set=Intersection
22	36116618	.	TG	T	613.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36116661	.	C	T	817.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36116694	.	T	G	233.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36116702	.	G	A	751.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36122265	.	C	T	777.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36122356	.	G	A	19807.45	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	36122365	.	C	T	776.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36122380	.	T	A	42461.53	PASS	AC=57;AF=0.03467;AN=1644;DS;set=Intersection
22	36122414	.	A	C	1261.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36122427	.	A	G	855.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36122433	.	T	C	51425.20	PASS	AC=61;AF=0.03710;AN=1644;DS;set=Intersection
22	36122501	.	C	A	1503.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36122517	.	T	C	118161.97	PASS	AC=378;AF=0.22993;AN=1644;DS;set=Intersection
22	36122724	.	C	A	5465.20	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36122751	.	T	G	860.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36122811	.	G	A	49860.45	PASS	AC=84;AF=0.05109;AN=1644;DS;set=Intersection
22	36122930	.	C	T	157673.59	PASS	AC=603;AF=0.36679;AN=1644;DS;set=Intersection
22	36123083	.	C	T	76687.87	PASS	AC=274;AF=0.16667;AN=1644;DS;set=Intersection
22	36123178	.	A	G	373.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36123215	.	G	A	733.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36123268	.	G	A	209.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36123276	.	G	A	1994.24	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36124810	.	G	T	526.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36124833	.	C	T	558.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36124860	.	C	G	153633.17	PASS	AC=584;AF=0.35523;AN=1644;DS;set=Intersection
22	36124889	.	GC	G	16629.58	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	36124988	.	C	A	283.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36140215	.	TG	T	255.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36141926	.	G	A	18115.77	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	36142076	.	A	G	15948.46	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	36155894	.	C	T	1761.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36155901	.	T	C	866.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36156071	.	A	C	1022.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36157224	.	T	C	1140.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36157319	.	C	T	1138.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36157348	.	G	T	797.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36164325	.	C	G	2167.79	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36164375	.	C	G	738.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36164434	.	C	T	24290.38	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	36174023	.	T	C	683.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36174157	.	T	C	938.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36177713	.	C	T	956.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36205806	.	TTCACC	T	6035.58	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36205818	.	T	A	771.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36205891	.	C	T	746.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36424247	.	C	G	645.90	PASS	AC=24;AF=0.0251;AN=958;set=Intersection
22	36424450	.	A	C	2090.04	PASS	AC=299;AF=0.9967;AN=300;set=Intersection
22	36537200	.	G	A	1295.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36537222	.	C	G	2365.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36537237	.	C	G	850.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36537292	.	G	A	1143.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36537327	.	C	T	1801.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36537500	.	A	T	132282.99	PASS	AC=595;AF=0.36192;AN=1644;DS;set=Intersection
22	36537587	.	G	T	961.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36537645	.	C	T	719.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36537646	.	G	A	909.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36537671	.	T	G	5761	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	36537725	.	G	A	40521.13	PASS	AC=139;AF=0.08455;AN=1644;DS;set=Intersection
22	36537736	.	C	T	1204.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36537740	.	G	A	1529.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36537763	.	C	T	18342.78	PASS	AC=63;AF=0.03832;AN=1644;DS;set=Intersection
22	36537775	.	C	T	1796.60	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36537798	.	G	A	11273.60	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	36537812	.	C	T	485.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36537832	.	C	T	751.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36537865	.	A	G	1115.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36537871	.	C	T	2001.65	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36537893	.	A	G	141133.88	PASS	AC=521;AF=0.31691;AN=1644;DS;set=Intersection
22	36538053	.	G	A	31107.71	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	36541511	.	C	T	979.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36541567	.	T	C	1778.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36556698	.	C	T	15321.14	PASS	AC=71;AF=0.04319;AN=1644;DS;set=Intersection
22	36556729	.	T	C	28082.24	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	36556768	.	G	A	89738.44	PASS	AC=82;AF=0.04988;AN=1644;DS;set=Intersection
22	36556780	.	C	T	612.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36556823	.	G	T	307523.06	PASS	AC=1336;AF=0.81265;AN=1644;DS;set=Intersection
22	36556836	.	C	A	1003.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36556864	.	T	C	1214.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36556964	.	C	T	125987.98	PASS	AC=801;AF=0.48723;AN=1644;DS;set=Intersection
22	36623415	.	G	A	999.21	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36623672	.	G	A	1178.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36623731	.	T	C	359665.42	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	36623902	.	C	T	1647.09	PASS	AC=3;AF=0.00185;AN=1624;DS;set=Intersection
22	36623920	.	G	A	91442.27	PASS	AC=190;AF=0.11700;AN=1624;DS;set=Intersection
22	36623931	.	C	T	461.46	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	36623956	.	C	T	131.39	PASS	AC=1;AF=0.00061;AN=1630;DS;set=Intersection
22	36623980	.	C	T	1477.24	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	36624123	.	G	A	804.86	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	36624231	.	C	T	2101.92	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	36624310	.	G	A	1077.62	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	36627349	.	C	T	4646.95	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36627380	.	G	A	40530.45	PASS	AC=43;AF=0.02616;AN=1644;DS;set=Intersection
22	36627504	.	T	C	1236.97	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36627521	.	AAAG	A	127088.32	PASS	AC=224;AF=0.13625;AN=1644;DS;set=Intersection
22	36629151	.	A	G	783.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36629223	.	G	C	682.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36649965	.	G	A	292.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36649966	.	C	T	35713.30	PASS	AC=151;AF=0.09185;AN=1644;DS;set=Intersection
22	36649967	.	G	A	754.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36649988	.	C	G	5491.42	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36650004	.	C	T	5028.14	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	36650951	.	A	C	1180.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36650956	.	G	A	54828.05	PASS	AC=166;AF=0.10097;AN=1644;DS;set=Intersection
22	36650962	.	A	G	906.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36650998	.	C	T	2333.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36651066	.	T	A	621.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36651089	.	G	A	642.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36653091	.	GC	G	3058.61	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36653143	.	T	C	1175.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36657596	.	A	G	254816.74	PASS	AC=1385;AF=0.84246;AN=1644;DS;set=Intersection
22	36657628	.	T	G	312224.24	PASS	AC=1382;AF=0.84063;AN=1644;DS;set=Intersection
22	36657740	.	G	A	16237.12	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	36657789	.	T	C	206371.09	PASS	AC=1105;AF=0.67214;AN=1644;DS;set=Intersection
22	36657806	.	C	CTA	1719.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36657814	.	C	T	4495.30	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	36661148	.	C	T	623.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36661149	.	A	G	225140.06	PASS	AC=1383;AF=0.84124;AN=1644;DS;set=Intersection
22	36661152	.	G	A	260772.10	PASS	AC=1383;AF=0.84124;AN=1644;DS;set=Intersection
22	36661190	.	T	C	1061.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36661200	.	T	C	1689.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36661222	.	G	A	801.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36661330	.	G	A	315309.91	PASS	AC=1173;AF=0.71350;AN=1644;DS;set=Intersection
22	36661354	.	C	T	854.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36661409	.	A	G	12824.14	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	36661455	.	C	T	4839.23	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36661536	.	C	A	371274.87	PASS	AC=1381;AF=0.84002;AN=1644;DS;set=Intersection
22	36661566	.	G	A	362430.02	PASS	AC=1381;AF=0.84002;AN=1644;DS;set=Intersection
22	36661646	.	G	A	363442.39	PASS	AC=1383;AF=0.84124;AN=1644;DS;set=Intersection
22	36661649	.	A	G	867.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36661674	.	C	A	10034.61	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	36661691	.	G	A	2527.92	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36661733	.	G	A	2408.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36661744	.	C	A	1961.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36661791	.	C	T	2685.60	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36661842	.	G	A	355290.19	PASS	AC=1370;AF=0.83333;AN=1644;DS;set=Intersection
22	36661891	.	G	A	32283.55	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	36661906	.	A	G	96277.24	PASS	AC=86;AF=0.05231;AN=1644;DS;set=Intersection
22	36661998	.	G	A	7238.84	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	36662041	.	AATAATT	A	35261.23	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	36662063	.	C	A,G,T	326.62	PASS	AC=0,1,1;AF=0.00000,0.00061,0.00061;AN=1644;DS;set=Intersection
22	36662064	.	G	A	2027.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36662068	.	C	T	249.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36678704	.	G	A	440.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36678706	.	G	A	1677.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36678779	.	C	T	656.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36678782	.	C	T	2637.10	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36678816	.	C	A	19133.40	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	36678833	.	TG	T	8528.95	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	36680124	.	G	A	598.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36680130	.	G	A	1677.95	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36680162	.	G	A	1007.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36680258	.	G	A	254.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36680325	.	C	A	493.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36680340	.	C	G	392.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36680358	.	G	A	710.83	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	36680470	.	G	A	515.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36681145	.	G	A	189.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36681163	.	G	C	7021.09	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	36681327	.	T	C	876.48	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36681373	.	G	A	826.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36681384	.	GA	G	959.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36681660	.	T	C	687.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36681797	.	C	T	1644.39	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36681878	.	T	C	306.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36681918	.	C	T	721.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36681988	.	G	A	244.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36682724	.	G	A	1829.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36682734	.	G	A	76540.56	PASS	AC=71;AF=0.04319;AN=1644;DS;set=Intersection
22	36682776	.	G	T	826.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36682815	.	C	T	994.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36682873	.	A	G	692.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36684331	.	C	T	45281.17	PASS	AC=148;AF=0.09002;AN=1644;DS;set=Intersection
22	36684354	.	T	C	142000.16	PASS	AC=493;AF=0.29988;AN=1644;DS;set=Intersection
22	36684358	.	C	A	148407.32	PASS	AC=492;AF=0.29927;AN=1644;DS;set=Intersection
22	36684412	.	C	T	701.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36684430	.	G	A	1666.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36684817	.	G	A	716.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36684961	.	G	T	1141.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36684980	.	G	A	28943.28	PASS	AC=60;AF=0.03650;AN=1644;DS;set=Intersection
22	36685018	.	G	C	850.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36685177	.	G	A	1371.66	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36685292	.	G	A	622.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36685297	.	C	T	461.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36685329	.	C	T	352.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36685365	.	TGAG	T	230.61	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	36688022	.	G	A	570.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36688157	.	C	T	484.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36688178	.	G	A	1592.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36688226	.	C	G	868.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36688248	.	A	G	446.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36688253	.	C	G	1000.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36688257	.	C	T	951.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36688296	.	G	T	673.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36689832	.	C	T	428.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36689833	.	G	A	228.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36689895	.	G	A	105.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36689917	.	G	A	5700.43	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	36689921	.	G	A	4365.03	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	36690101	.	C	T	2736.15	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36690113	.	G	A	152742.16	PASS	AC=856;AF=0.52068;AN=1644;DS;set=Intersection
22	36690120	.	T	C	62215.40	PASS	AC=106;AF=0.06448;AN=1644;DS;set=Intersection
22	36690189	.	G	T	906.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36690282	.	G	A	1017.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36691016	.	C	T	675.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36691054	.	G	C	576.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36691153	.	C	G	2791.61	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	36691502	.	C	A	169.91	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	36691533	.	C	G	1645.50	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36691607	.	A	C	239851.66	PASS	AC=1614;AF=0.98175;AN=1644;DS;set=Intersection
22	36691691	.	T	C	12527	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	36692854	.	C	G	233.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36692915	.	C	T	169.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36692980	.	T	A	854.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36693002	.	C	A	504.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36693082	.	C	G	269.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36694924	.	G	A	753.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36694929	.	C	T	3190.28	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36694954	.	C	G	33757.02	PASS	AC=87;AF=0.05292;AN=1644;DS;set=Intersection
22	36694958	.	C	T	839.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36695098	.	G	A	1090.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36695123	.	G	C	25998.24	PASS	AC=87;AF=0.05292;AN=1644;DS;set=Intersection
22	36696148	.	G	A	1175.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36696236	.	C	T	644.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36696330	.	C	T	695.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36696353	.	G	T	683.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36696354	.	C	T	624.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36696862	.	G	A	1080.94	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36696927	.	C	T	546.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36697014	.	G	A	5533.86	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36697077	.	C	T	517.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36697100	.	T	G	851.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36697537	.	A	G	390.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36697620	.	G	A	1845.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36697731	.	T	A	732.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36697758	.	C	T	1208.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36700087	.	C	T	394.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36700136	.	G	A	1977.45	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36700175	.	A	G	23445.96	PASS	AC=80;AF=0.04866;AN=1644;DS;set=Intersection
22	36701066	.	C	A	1877.71	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36701185	.	T	A	1168.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36701937	.	G	T	11297.89	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	36702032	.	G	C	375.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36702074	.	G	A	4733.88	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36702102	.	A	G	8223.75	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	36702134	.	G	A	449.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36702456	.	G	GCAC	1575.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36702505	.	C	T	337.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36702517	.	C	T	888.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36702640	.	G	A	487.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36705447	.	G	A	4308.56	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	36705462	.	G	A	855.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36708049	.	CTCCTGTGA	C	325021.79	PASS	AC=491;AF=0.29903;AN=1642;DS;set=Intersection
22	36708084	.	C	T	292638.82	PASS	AC=1356;AF=0.82482;AN=1644;DS;set=Intersection
22	36708136	.	C	T	1166.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36708196	.	G	A	10085.85	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	36708244	.	G	C	538.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36708256	.	C	T	334.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36708279	.	G	A	3182.04	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36708317	.	C	A	106.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36710169	.	C	CAAA	1772.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36710183	.	T	C	186061.62	PASS	AC=751;AF=0.45681;AN=1644;DS;set=Intersection
22	36710394	.	C	T	369.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36712549	.	G	A	870.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36712598	.	G	A	845.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36714229	.	T	G	892.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36714303	.	C	T	854.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36714312	.	G	A	742.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36714321	.	G	A	993.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36714406	.	G	A	628.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36715547	.	C	T	1141.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36715566	.	G	A	18317.51	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	36715576	.	G	A	9271.01	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	36715595	.	G	A	184.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36715610	.	G	A	4619.61	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	36716349	.	T	C	1571.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36716433	.	G	A	643.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36716814	.	C	T	105.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36716984	.	A	G	290.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36717765	.	G	A	815.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36717773	.	G	T	1484.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36717788	.	G	A	1160.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36717851	.	T	C	1249.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36717858	.	G	A	911.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36718451	.	C	T	950.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36718457	.	G	A	836.69	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36718460	.	G	A	1044.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36718462	.	C	T	646.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36718564	.	G	A	250.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36718598	.	G	A	150.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36722634	.	C	T	869.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36722682	.	C	T	1359.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36723483	.	T	C	1656.18	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36744925	.	C	A,T	722.11	PASS	AC=4,3;AF=0.00243,0.00182;AN=1644;DS;set=Intersection
22	36744964	.	G	A	318.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36745117	.	G	A	988.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36745146	.	G	A	2778.94	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36745261	.	A	G	706.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36745264	.	G	A	5862.06	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	36745275	.	G	C	756.98	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36863817	.	C	T	409.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36872750	.	T	G	315446.99	PASS	AC=1038;AF=0.63139;AN=1644;DS;set=Intersection
22	36872755	.	G	A	1286.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36872818	.	C	T	2191.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36872873	.	C	T	7681.66	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	36876622	.	T	C	1057.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36876729	.	T	C	4654.18	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36876852	.	C	T	595.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36886078	.	C	T	862.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36886112	.	G	A	850.82	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36886178	.	A	G	21593.77	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	36886199	.	C	G	1279.63	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36886226	.	G	A	1915	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36886288	.	G	A	715.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36886332	.	G	A	352.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36889645	.	C	T	162.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36889665	.	G	A	756.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36889710	.	A	G	815.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36889753	.	C	T	986.35	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36889816	.	G	A	2302.77	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	36892102	.	AAAG	A	1018.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36892103	.	A	C	2843.05	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36892134	.	T	A	737.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36892168	.	G	A	1545.52	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36892240	.	A	C	1909.93	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36892273	.	C	T	523.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36892300	.	A	G	1548.58	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36893993	.	G	A	527.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36894054	.	C	A	712.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36894133	.	G	C	6051.33	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	36894162	.	C	T	1396.27	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36894232	.	G	A	894.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36894235	.	G	T	863.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36894236	.	C	T	734.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36897261	.	C	G	17243.88	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	36897304	.	G	A	5592.22	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36897341	.	G	A	1116.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36897383	.	T	C	16801.98	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	36897410	.	G	A	1172.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36897427	.	T	C	18761.97	PASS	AC=86;AF=0.05231;AN=1644;DS;set=Intersection
22	36900186	.	G	C	701.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36900271	.	T	C	320168.19	PASS	AC=1076;AF=0.65450;AN=1644;DS;set=Intersection
22	36900342	.	C	T	6552.43	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	36900429	.	A	G	456.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36900550	.	G	A	5599.28	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	36900555	.	G	C	447.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36900679	.	C	T	2376.86	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36900695	.	C	T	865.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36900732	.	G	A	2924.32	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36900774	.	C	A	5683.79	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36900806	.	A	G	150871.07	PASS	AC=827;AF=0.50304;AN=1644;DS;set=Intersection
22	36900812	.	C	T	10566.41	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	36901985	.	T	C	1136.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36902031	.	C	G	764.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36902101	.	G	A	879.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36902161	.	G	A	5770.78	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	36902259	.	G	A	18693.53	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	36907001	.	T	C	20093.43	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	36907031	.	G	A	359.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36907095	.	T	G	850.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36907665	.	G	A	8224.72	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	36907716	.	G	T	979.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36907872	.	GCA	G	790.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36908479	.	G	A	5312.67	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	36908587	.	C	T	7160.21	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	36908658	.	G	A	447.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36908665	.	G	A	399.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36908667	.	T	C	710.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36912623	.	C	G	1194.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36912630	.	A	G	52743.15	PASS	AC=101;AF=0.06144;AN=1644;DS;set=Intersection
22	36912724	.	C	T	119704.18	PASS	AC=342;AF=0.20803;AN=1644;DS;set=Intersection
22	36912769	.	G	T	632.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36913495	.	T	C	6889.87	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	36913505	.	C	G	1207	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36914967	.	G	A	27586.52	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	36914990	.	G	C	894.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36915445	.	C	T	31926.91	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	36915464	.	A	G	459.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36915503	.	G	C	997.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36916648	.	A	C	978.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36916753	.	T	C	33871.79	PASS	AC=87;AF=0.05292;AN=1644;DS;set=Intersection
22	36919242	.	T	A	3140.93	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	36919343	.	A	G	50127.46	PASS	AC=100;AF=0.06083;AN=1644;DS;set=Intersection
22	36919358	.	A	G	6358.03	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	36919375	.	G	C	12757.97	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	36919928	.	G	A	949.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36920062	.	T	C	79542.51	PASS	AC=183;AF=0.11131;AN=1644;DS;set=Intersection
22	36920064	.	G	A	9181.69	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	36920598	.	A	T	7876.99	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36920652	.	T	C	1875.89	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	36920691	.	C	T	765.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36920692	.	G	A	1005.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36920806	.	T	C	51482.69	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	36920815	.	C	T	1005.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36921733	.	T	C	7874.26	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36921761	.	G	A	22500.39	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	36922035	.	C	G	544.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36922052	.	T	C	46985.91	PASS	AC=100;AF=0.06083;AN=1644;DS;set=Intersection
22	36922067	.	G	A	46733.40	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	36922205	.	C	T	19681.94	PASS	AC=76;AF=0.04623;AN=1644;DS;set=Intersection
22	36960419	.	G	A	654.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36960589	.	T	G	427.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36960611	.	G	T	840.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36960725	.	C	T	989.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36960758	.	C	A	854.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36960957	.	T	A	1090.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36962353	.	C	G	258120.36	PASS	AC=845;AF=0.51399;AN=1644;DS;set=Intersection
22	36962391	.	G	A	5377.83	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36962571	.	G	C	694.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36983483	.	G	A	2085.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	36983500	.	G	A	826.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36983540	.	G	A	734.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36983582	.	A	G	952.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36983607	.	G	T	1738.21	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	36983627	.	ACAT	A	834.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	36983645	.	C	T	539.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37098386	.	G	C	1393.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37098406	.	A	T	915.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37154326	.	G	A	843.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37154339	.	G	A	832.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37158898	.	C	T	61.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37158985	.	G	A	6528.38	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37158995	.	G	A	9777.58	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	37159036	.	G	A	721.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37159101	.	C	G	24946.02	PASS	AC=52;AF=0.03163;AN=1644;DS;set=Intersection
22	37159993	.	G	A	791.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37160049	.	T	C	756.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37160111	.	C	T	588.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37163329	.	C	T	244867.66	PASS	AC=1330;AF=0.80900;AN=1644;DS;set=Intersection
22	37163433	.	T	C	271.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37163864	.	C	T	923.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37163909	.	G	A	703.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37171689	.	C	A	6096.41	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37171694	.	T	C	917.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37171725	.	G	A	235.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37171757	.	C	T	1493.46	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37196905	.	G	C	335.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37196971	.	C	A	171015.58	PASS	AC=836;AF=0.50852;AN=1644;DS;set=Intersection
22	37196986	.	A	G	16988.28	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	37196999	.	C	T	358.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37209762	.	G	A	2612.24	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37209823	.	C	T	859.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37209829	.	G	A	953.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37211105	.	G	C	174.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37211141	.	G	C	412.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37211148	.	C	T	2310.30	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37211155	.	A	G	129.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37211219	.	G	A	5310.34	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37211284	.	G	A	246.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37211286	.	G	C	620.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37211287	.	G	T	691.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37211289	.	G	A,T	1727.39	PASS	AC=1,4;AF=0.00061,0.00243;AN=1644;DS;set=Intersection
22	37211324	.	T	C	897.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37212945	.	G	T	2575.89	PASS	AC=34;AF=0.02109;AN=1612;set=Intersection
22	37212950	.	C	G	106.16	PASS	AC=1;AF=0.00062;AN=1606;DS;set=Intersection
22	37213062	.	T	C	713.21	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	37257177	.	G	A	588.55	PASS	AC=38;AF=0.03079;AN=1234;set=Intersection
22	37260081	.	G	A	811.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37260123	.	G	A	77081.30	PASS	AC=133;AF=0.08090;AN=1644;DS;set=Intersection
22	37260144	.	G	A	1025.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37260180	.	G	A	1018.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37260197	.	CCAA	C	4810.54	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	37261015	.	C	T	1136.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37261021	.	C	T	1111.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37261083	.	T	C	6046.99	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37261097	.	C	A	615.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37263533	.	G	A	2486.27	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	37266425	.	A	G	259.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37266453	.	A	G	1132.73	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37266504	.	G	A	1039.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37266572	.	G	A	1621.36	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37266604	.	G	C	22631.68	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	37267767	.	A	G	82515.87	PASS	AC=1024;AF=0.64403;AN=1590;DS;set=Intersection
22	37267768	.	C	A	5658.37	PASS	AC=23;AF=0.01454;AN=1582;DS;set=Intersection
22	37267769	.	G	C	10259.61	PASS	AC=70;AF=0.04430;AN=1580;DS;set=Intersection
22	37268501	.	A	G	186402.85	PASS	AC=1081;AF=0.65754;AN=1644;DS;set=Intersection
22	37271672	.	G	A	2713.90	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37271681	.	C	A	2217.79	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	37271715	.	G	A	821.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37271772	.	C	T	350.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37271802	.	C	T	78481.34	PASS	AC=175;AF=0.10645;AN=1644;DS;set=Intersection
22	37271882	.	T	C	314329.38	PASS	AC=1336;AF=0.81265;AN=1644;DS;set=Intersection
22	37271906	.	G	C	783.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37272023	.	C	T	849.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37272141	.	G	A	102.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37272173	.	T	C	134.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37272186	.	G	A	7195.48	PASS	AC=24;AF=0.01462;AN=1642;DS;set=Intersection
22	37273630	.	C	T	906.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37273724	.	T	A	796.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37273742	.	G	A	59682.35	PASS	AC=177;AF=0.10766;AN=1644;DS;set=Intersection
22	37273757	.	G	A	244.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37273779	.	G	T	2110	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37273805	.	C	T	26309.15	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	37273856	.	G	A	11802.11	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	37318306	.	C	T	50.54	PASS	AC=1;AF=0.00062;AN=1624;set=Intersection
22	37318309	.	C	A	307.62	PASS	AC=2;AF=0.00123;AN=1628;set=Intersection
22	37318318	.	G	A	1411.87	PASS	AC=9;AF=0.00550;AN=1636;set=Intersection
22	37319256	.	G	A	670.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37319293	.	C	T	2092.03	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37319326	.	C	T	338.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37319397	.	G	T	622.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37319425	.	G	T	88808.34	PASS	AC=831;AF=0.50547;AN=1644;DS;set=Intersection
22	37319436	.	C	G	4927.04	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	37322012	.	G	A	1940.78	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	37322074	.	C	G	313.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37322095	.	C	T	875.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37322101	.	C	T	6878.84	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	37322192	.	C	T	413.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37322200	.	C	T	371.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37325396	.	C	G	1007.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37325400	.	C	A	408.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37325405	.	G	A	17855.80	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	37325703	.	A	G	864.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37325704	.	C	T	4446.74	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	37325818	.	G	A	347.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37325833	.	C	T	13499.79	PASS	AC=56;AF=0.03406;AN=1644;DS;set=Intersection
22	37325887	.	G	A	412.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37326387	.	G	A	808.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37326443	.	G	C	85579.90	PASS	AC=113;AF=0.06873;AN=1644;DS;set=Intersection
22	37326669	.	C	T	193.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37326678	.	T	G	11830.01	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	37326685	.	C	A	442.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37326749	.	C	G	352.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37326794	.	G	A	7996.28	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	37326899	.	G	A	900.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37328777	.	T	C	997.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37328890	.	G	A	551.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37328901	.	C	G	904.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37328913	.	G	A	1818.81	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37328940	.	G	A	930.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37328953	.	G	T	562.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37328966	.	G	C	195734.25	PASS	AC=900;AF=0.54745;AN=1644;DS;set=Intersection
22	37328968	.	G	C	60041.68	PASS	AC=276;AF=0.16788;AN=1644;DS;set=Intersection
22	37329861	.	T	C	4517.98	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	37329900	.	C	T	913.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37329915	.	C	T	757.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37329999	.	C	T	41039.33	PASS	AC=262;AF=0.15937;AN=1644;DS;set=Intersection
22	37330000	.	G	A	659.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37330074	.	C	T	4776.37	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	37330080	.	C	G	274.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37330082	.	T	C	86779.45	PASS	AC=856;AF=0.52068;AN=1644;DS;set=Intersection
22	37331346	.	T	C	1266.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37331351	.	G	A	426.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37331368	.	C	G	2842.52	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37331455	.	C	G	1224.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37331648	.	T	C	746.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37331657	.	C	T	917.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37331658	.	G	A	896.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37331663	.	G	A	717.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37331746	.	A	T	869.77	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37331752	.	G	C	122.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37332543	.	C	T	186.05	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	37332546	.	C	T	337.40	PASS	AC=2;AF=0.00122;AN=1644;set=Intersection
22	37332547	.	G	A	125.97	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	37332557	.	A	T	69.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37332560	.	C	T	8163.48	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	37332629	.	G	A	1183.94	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37332649	.	C	A	953.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37332723	.	C	T	1029.75	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37333406	.	T	G	50624.33	PASS	AC=90;AF=0.05474;AN=1644;DS;set=Intersection
22	37333414	.	C	T	7783.80	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	37333443	.	C	G	284.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37333446	.	C	T	6617.20	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37333606	.	A	G	159.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37333657	.	C	A	1486.07	PASS	AC=22;AF=0.01358;AN=1620;DS;set=Intersection
22	37333676	.	C	T	160.34	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	37333794	.	A	G	64901.29	PASS	AC=1329;AF=0.81334;AN=1634;set=Intersection
22	37333804	.	G	A	12683.51	PASS	AC=78;AF=0.04774;AN=1634;set=Intersection
22	37333828	.	CA	C	1011.93	PASS	AC=3;AF=0.00183;AN=1640;set=Intersection
22	37333900	.	G	C	304.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37333936	.	C	T	34809.58	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	37334211	.	T	C	1238.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37334250	.	G	A	7429.82	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	37334280	.	C	A	10425.36	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	37334352	.	G	T	903.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37334375	.	C	T	1728.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37334376	.	G	A	1959.82	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37334383	.	G	A	654.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37334550	.	C	T	965.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37387226	.	C	G	873.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37387244	.	G	A	544.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37387257	.	T	C	58197.30	PASS	AC=180;AF=0.10949;AN=1644;DS;set=Intersection
22	37387283	.	G	A	534.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37387475	.	G	A	1183.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37387505	.	C	A	132425.17	PASS	AC=375;AF=0.22810;AN=1644;DS;set=Intersection
22	37387532	.	C	T	943.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37387589	.	T	C	762.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37387646	.	T	A	1012.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37395853	.	C	T	962.89	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37395935	.	C	T	429.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37395975	.	T	C	1604.59	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37395999	.	G	A	2379.76	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37396024	.	G	C	1544.09	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37396053	.	A	G	7163.23	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	37396054	.	G	A	1611.95	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37397859	.	C	T	865.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37397876	.	A	G	646.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37397896	.	C	T	2275.76	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	37397934	.	T	C	245.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37397942	.	A	C	436.35	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37397996	.	C	T	145.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37398011	.	G	A	197.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37398040	.	C	T	343.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37398041	.	G	A	244.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37398062	.	G	A	321.05	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37398102	.	G	A	116.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37398140	.	G	A	338.78	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37407020	.	G	C	614.15	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	37407064	.	C	T	12392.58	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	37407084	.	T	C	855.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37407100	.	G	A	743.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37407109	.	G	C	8364.11	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	37407131	.	G	A	947.16	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37407170	.	G	A	2367.44	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37407194	.	G	A	13740.76	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	37407216	.	C	T	730.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37407344	.	A	G	674.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37407346	.	G	A	589.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37414298	.	C	T	429.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37414326	.	G	A	638.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37414468	.	T	G	20776.47	PASS	AC=47;AF=0.02859;AN=1644;DS;set=Intersection
22	37414528	.	G	A	1702.49	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	37414801	.	C	T	1901.29	PASS	AC=30;AF=0.01863;AN=1610;set=Intersection
22	37415963	.	C	T	256.02	PASS	AC=16;AF=0.0210;AN=762;set=Intersection
22	37420504	.	C	T	276.13	PASS	AC=7;AF=0.00451;AN=1552;set=Intersection
22	37420713	.	G	A	70.12	PASS	AC=2;AF=0.00122;AN=1638;set=Intersection
22	37420890	.	C	T	26033.67	PASS	AC=180;AF=0.11139;AN=1616;set=Intersection
22	37425508	.	G	A	188.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37425564	.	A	G	657.87	PASS	AC=3;AF=0.00182;AN=1644;set=Intersection
22	37425590	.	C	T	72.76	PASS	AC=1;AF=0.00061;AN=1638;set=Intersection
22	37425591	.	G	A	5972.65	PASS	AC=31;AF=0.01893;AN=1638;set=Intersection
22	37448020	.	C	T	122.42	PASS	AC=6;AF=0.00592;AN=1014;set=Intersection
22	37452397	.	G	A	478.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37452457	.	G	A	880.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37452475	.	C	T	541.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37453452	.	C	T	234937.37	PASS	AC=1435;AF=0.87287;AN=1644;DS;set=Intersection
22	37453488	.	C	T	223.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37453538	.	G	A	450.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37455303	.	C	T	14798.67	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	37455365	.	G	A	970.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37455506	.	C	T	1099.80	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37455512	.	A	G	706.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37457531	.	C	T	229.64	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	37457535	.	C	A,G	133.70	PASS	AC=1,1;AF=0.00061,0.00061;AN=1642;DS;set=Intersection
22	37457536	.	C	A	181.69	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	37457585	.	G	A	2147.44	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37458586	.	C	T	10892.85	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	37458644	.	T	C	2736.07	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37458668	.	G	A	163.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37462096	.	C	T	431.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37462106	.	AG	A	478.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37462173	.	C	T	1773.62	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37462210	.	G	A	5872.69	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	37462309	.	C	T	217.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37462926	.	G	A	103785.21	PASS	AC=599;AF=0.36436;AN=1644;DS;set=Intersection
22	37462936	.	A	G	205329.64	PASS	AC=958;AF=0.58273;AN=1644;DS;set=Intersection
22	37462989	.	G	A	7113.17	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	37462998	.	G	A	777.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37465094	.	G	A	2863.48	PASS	AC=73;AF=0.04986;AN=1464;set=Intersection
22	37465102	.	C	T	145.91	PASS	AC=1;AF=0.00067;AN=1490;set=Intersection
22	37465114	.	G	A	1747.95	PASS	AC=48;AF=0.03230;AN=1486;set=Intersection
22	37465121	.	C	A	274.91	PASS	AC=9;AF=0.00599;AN=1502;set=Intersection
22	37465141	.	A	C	145.78	PASS	AC=1;AF=0.00064;AN=1562;set=Intersection
22	37465152	.	G	A	113.81	PASS	AC=3;AF=0.00190;AN=1576;set=Intersection
22	37465222	.	C	T	42.07	PASS	AC=1;AF=0.00063;AN=1590;set=Intersection
22	37465385	.	CTGGGG	C	5583.17	PASS	AC=732;AF=0.46624;AN=1570;DS;set=Intersection
22	37466493	.	A	G	2423.93	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37466565	.	G	A	4747.44	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	37466602	.	C	T	568.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37466637	.	C	T	461.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37466930	.	G	A	17749.24	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	37466936	.	G	A	494.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37466947	.	A	G	645.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37466962	.	G	A	397.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37466978	.	G	A	100.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37466992	.	G	A	2932.62	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	37467001	.	C	T	2218.19	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37467103	.	G	A	159.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37467106	.	G	A	471.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37469555	.	G	A	644.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37469591	.	G	A	238304.43	PASS	AC=875;AF=0.53224;AN=1644;DS;set=Intersection
22	37470604	.	G	A	114267.76	PASS	AC=873;AF=0.53102;AN=1644;DS;set=Intersection
22	37470623	.	G	A	502.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37470635	.	G	A	11764.08	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	37470638	.	C	T	24446.14	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	37470640	.	G	A	5392.41	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	37470665	.	C	G	1232.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37471153	.	T	A	345.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37471208	.	G	A	8463.68	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	37471289	.	C	T	1094.35	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37471290	.	G	A	22491.32	PASS	AC=126;AF=0.07664;AN=1644;DS;set=Intersection
22	37471300	.	A	G	349.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37471311	.	G	A	442.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37471338	.	C	A	1229.54	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	37480291	.	G	C	5075.07	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	37480294	.	G	T	494.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37480797	.	C	T	66142.28	PASS	AC=532;AF=0.32678;AN=1628;DS;set=Intersection
22	37480815	.	G	T	51.12	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	37480818	.	C	T	54.93	PASS	AC=1;AF=0.00062;AN=1620;DS;set=Intersection
22	37480832	.	C	T	876.28	PASS	AC=1;AF=0.00062;AN=1612;DS;set=Intersection
22	37480833	.	G	A	503.21	PASS	AC=1;AF=0.00062;AN=1610;DS;set=Intersection
22	37480861	.	G	A	1871.76	PASS	AC=2;AF=0.00125;AN=1602;DS;set=Intersection
22	37482289	.	C	T	6756.88	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	37482333	.	C	T	230.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37482336	.	C	T	2686.17	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37482353	.	C	T	298.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37482376	.	AG	A	702.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37482458	.	C	A	322.96	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	37485595	.	T	C	99937.92	PASS	AC=1038;AF=0.63293;AN=1640;DS;set=Intersection
22	37485618	.	G	A	6308.02	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	37485647	.	G	A	91.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37485714	.	A	T	364.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37485724	.	T	C	54236.84	PASS	AC=640;AF=0.38977;AN=1642;DS;set=Intersection
22	37485821	.	A	G	245.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37491545	.	T	C	160796.03	PASS	AC=694;AF=0.42214;AN=1644;DS;set=Intersection
22	37491546	.	G	A	1296.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37491573	.	GA	G,GAA	607.75	PASS	AC=12,0;AF=0.00730,0.00000;AN=1644;DS;set=Intersection
22	37491655	.	CAAAT	C	3106.81	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37491924	.	C	T	582.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37491956	.	T	G	16698.03	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	37491989	.	G	A	359.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37491998	.	G	A	1732.05	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37492005	.	G	A	892.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37492013	.	G	A	3012.92	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37492031	.	C	T	2010.17	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37492058	.	G	A	374.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37492078	.	G	A	947.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37492129	.	C	T	1026.80	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37492137	.	C	T	283.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37492159	.	G	A	681.41	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37492702	.	G	A	58.04	PASS	AC=2;AF=0.00122;AN=1636;DS;set=Intersection
22	37492787	.	C	T	1192.87	PASS	AC=15;AF=0.00926;AN=1620;DS;set=Intersection
22	37494420	.	T	C	76347.51	PASS	AC=272;AF=0.16545;AN=1644;DS;set=Intersection
22	37494422	.	T	C	4426.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37494485	.	G	A	2726.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37494542	.	G	A	731.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37494580	.	G	A	556.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37494630	.	G	A	2527.73	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37499235	.	CA	C	480.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37499239	.	C	T	2332.21	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37499275	.	C	T	839.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37499386	.	C	T	62084.67	PASS	AC=273;AF=0.16606;AN=1644;DS;set=Intersection
22	37499401	.	G	A	146.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37499413	.	G	A	1011.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37499454	.	GC	G	985.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37499471	.	C	T	451.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37499524	.	C	T	9011.55	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37499525	.	G	A	9501.92	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37499565	.	G	A	13895.01	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	37499566	.	A	T	964.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37524092	.	G	A	2739.83	PASS	AC=17;AF=0.01035;AN=1642;set=Intersection
22	37524245	.	G	A	153.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37524286	.	G	A	327.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37524364	.	G	C	606.60	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37524365	.	G	A	581.45	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37524387	.	G	A	620.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37524388	.	G	A	4958.86	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	37524433	.	C	A	152.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37524483	.	C	T	1459.03	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	37524496	.	G	A	430.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37524544	.	G	A	464.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37524559	.	C	G	556.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37524600	.	C	T	298.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37524619	.	G	T	56643.78	PASS	AC=328;AF=0.19951;AN=1644;DS;set=Intersection
22	37524640	.	G	A	639.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37524683	.	G	A	4405.81	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	37524843	.	C	T	523.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37528548	.	G	T	22048.62	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	37531321	.	C	T	4243.47	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37531375	.	C	T	8776.91	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	37531376	.	G	A	4880.04	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37531379	.	G	A	918.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37531430	.	G	A	1011.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37531436	.	G	A	104135.86	PASS	AC=687;AF=0.41788;AN=1644;DS;set=Intersection
22	37531521	.	G	C	28144.38	PASS	AC=118;AF=0.07178;AN=1644;DS;set=Intersection
22	37532221	.	G	A	769.12	PASS	AC=6;AF=0.00367;AN=1636;DS;set=Intersection
22	37532255	.	C	T	14067.66	PASS	AC=52;AF=0.03163;AN=1644;DS;set=Intersection
22	37532381	.	G	A	594.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37532441	.	G	A	18573.14	PASS	AC=264;AF=0.16058;AN=1644;DS;set=Intersection
22	37532445	.	A	T	127.16	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	37533607	.	G	A	841.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37533705	.	T	G	2540.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37533763	.	G	A	385.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37533783	.	C	T	62.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37533786	.	C	G	118095.18	PASS	AC=817;AF=0.49696;AN=1644;DS;set=Intersection
22	37533792	.	G	A	249.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37533795	.	G	C	77521.01	PASS	AC=809;AF=0.49209;AN=1644;DS;set=Intersection
22	37533823	.	C	T	363.21	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	37535130	.	C	T	11897.54	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	37535236	.	G	A	938.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37535248	.	G	A	849.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37538508	.	G	A	17881.75	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	37538521	.	C	T	2709.46	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37538522	.	G	A	431.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37538531	.	C	G	791.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37538551	.	G	C	586.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37538565	.	A	G	548.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37539638	.	G	A	1724.28	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37539644	.	C	T	5688.17	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	37539709	.	T	A	169	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37539713	.	T	C	60446.61	PASS	AC=433;AF=0.26338;AN=1644;DS;set=Intersection
22	37540101	.	C	T	418.35	PASS	AC=9;AF=0.00573;AN=1572;DS;set=Intersection
22	37540122	.	C	T	7625.85	PASS	AC=46;AF=0.02915;AN=1578;DS;set=Intersection
22	37540185	.	G	C	1860.50	PASS	AC=7;AF=0.00461;AN=1520;DS;set=Intersection
22	37540187	.	C	T	46.22	PASS	AC=1;AF=0.00067;AN=1494;DS;set=Intersection
22	37540233	.	G	A	7511.89	PASS	AC=24;AF=0.01521;AN=1578;DS;set=Intersection
22	37578180	.	C	T	830.98	PASS	AC=3;AF=0.00182;AN=1644;set=Intersection
22	37578207	.	G	A	122.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37578214	.	T	C	49692.48	PASS	AC=492;AF=0.29927;AN=1644;DS;set=Intersection
22	37578337	.	C	T	973.74	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37578345	.	G	A	102.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37578388	.	C	T	2725.15	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	37578403	.	G	A	631.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37578419	.	C	A	689.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37578447	.	G	A	695.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37578471	.	G	T	157.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37578488	.	A	C	275.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37578502	.	C	T	722.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37578570	.	G	A	138.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37578579	.	C	T	150552.59	PASS	AC=722;AF=0.43917;AN=1644;DS;set=Intersection
22	37578633	.	G	A	524.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37578652	.	G	A	38117.31	PASS	AC=168;AF=0.10219;AN=1644;DS;set=Intersection
22	37578681	.	G	A	117.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37578807	.	G	A	28243.45	PASS	AC=555;AF=0.34049;AN=1630;DS;set=Intersection
22	37581243	.	C	T	645.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37581271	.	G	A	730.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37581353	.	G	C	131.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37581383	.	C	T	29860.87	PASS	AC=168;AF=0.10219;AN=1644;DS;set=Intersection
22	37581420	.	T	C	217.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37581422	.	G	C	44232.82	PASS	AC=273;AF=0.16606;AN=1644;DS;set=Intersection
22	37581455	.	G	A	379.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37581457	.	T	C	1178.12	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37581477	.	C	T	775.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37581478	.	G	A	776.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37581485	.	C	A	102307.75	PASS	AC=801;AF=0.48723;AN=1644;DS;set=Intersection
22	37581538	.	A	G	208.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37584228	.	G	A	964.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37602543	.	G	A	251.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37602581	.	A	AG	45744.38	PASS	AC=1595;AF=0.97019;AN=1644;DS;set=Intersection
22	37602583	.	G	GC	270640.82	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	37602584	.	C	CA,CT	40787	PASS	AC=812,650;AF=0.49392,0.39538;AN=1644;DS;set=Intersection
22	37602585	.	C	CA	38874.59	PASS	AC=1400;AF=0.85158;AN=1644;DS;set=Intersection
22	37602586	.	C	CA	33073.53	PASS	AC=1303;AF=0.79258;AN=1644;DS;set=Intersection
22	37602602	.	C	T	8074.81	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	37602611	.	C	G	44763.36	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	37602682	.	C	T	437.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37602754	.	C	T	453.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37602779	.	T	C	295.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37602809	.	G	A	594.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37602822	.	T	C	285.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37602837	.	G	A	2065.27	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37602850	.	G	C	635.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37602984	.	C	T	650.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37602985	.	G	A	2515.82	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37603021	.	G	A	110139.41	PASS	AC=586;AF=0.35645;AN=1644;DS;set=Intersection
22	37603051	.	C	T	87398.05	PASS	AC=674;AF=0.40998;AN=1644;DS;set=Intersection
22	37603073	.	C	T	307.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37603112	.	G	A	333.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37603127	.	C	T	1164.39	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37603213	.	C	T	94.80	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	37603311	.	C	T	207.29	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	37603326	.	C	T	179.03	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	37603327	.	G	A	392.36	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	37603351	.	G	A	465.89	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37603358	.	G	A	223.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37603372	.	A	G	206.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37603390	.	C	T	99542.36	PASS	AC=674;AF=0.40998;AN=1644;DS;set=Intersection
22	37603391	.	G	A	729.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37603414	.	C	T	161.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37603531	.	G	A	398.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37603603	.	G	A	441.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37603654	.	C	T	482.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37603733	.	G	A	2778.27	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37603744	.	C	T	99955.13	PASS	AC=698;AF=0.42457;AN=1644;DS;set=Intersection
22	37622731	.	G	A	271.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37622791	.	G	A	5426.70	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	37622815	.	A	G	73717.70	PASS	AC=389;AF=0.23662;AN=1644;DS;set=Intersection
22	37622861	.	C	A	994.19	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37622880	.	G	GT	37569.02	PASS	AC=386;AF=0.23479;AN=1644;DS;set=Intersection
22	37622881	.	T	TTG	33287.55	PASS	AC=385;AF=0.23418;AN=1644;DS;set=Intersection
22	37622883	.	GC	G	25221.66	PASS	AC=382;AF=0.23236;AN=1644;DS;set=Intersection
22	37622884	.	CG	C	232.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37622888	.	G	GT	15596.63	PASS	AC=275;AF=0.16727;AN=1644;DS;set=Intersection
22	37627234	.	T	C	115273.54	PASS	AC=637;AF=0.38747;AN=1644;DS;set=Intersection
22	37627246	.	G	C	126301.29	PASS	AC=633;AF=0.38504;AN=1644;DS;set=Intersection
22	37627480	.	G	A	595.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37627978	.	G	A	823.01	PASS	AC=1;AF=0.00064;AN=1556;DS;set=Intersection
22	37628008	.	G	A	705.47	PASS	AC=18;AF=0.01155;AN=1558;DS;set=Intersection
22	37628050	.	G	A	703.24	PASS	AC=1;AF=0.00067;AN=1498;DS;set=Intersection
22	37628053	.	A	AG	64609.55	PASS	AC=595;AF=0.39300;AN=1514;DS;set=Intersection
22	37628054	.	G	GT	11652.57	PASS	AC=482;AF=0.31963;AN=1508;DS;set=Intersection
22	37628055	.	G	GT	11218.92	PASS	AC=502;AF=0.33333;AN=1506;DS;set=Intersection
22	37628993	.	T	G	47154.68	PASS	AC=262;AF=0.15937;AN=1644;DS;set=Intersection
22	37629002	.	C	T	344.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37637578	.	GA	G	2480.72	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	37637581	.	G	A	4922.99	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37637607	.	A	G	66635.71	PASS	AC=82;AF=0.04988;AN=1644;DS;set=Intersection
22	37637653	.	G	C	54757.45	PASS	AC=273;AF=0.16606;AN=1644;DS;set=Intersection
22	37637743	.	C	T	945.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37640138	.	C	T	1592.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37640232	.	C	T	230.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37678565	.	G	A	102375.73	PASS	AC=578;AF=0.35158;AN=1644;DS;set=Intersection
22	37678572	.	G	C	4644.96	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	37678575	.	A	T	1873.63	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37678588	.	A	G	225.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37678661	.	C	A	4813.63	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	37688646	.	G	A	987.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37688753	.	A	G	161.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37688758	.	C	T	761.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37688770	.	C	T	285.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37690683	.	G	T	2500.04	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37690757	.	G	A	1135.32	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37690807	.	G	A	421.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37690808	.	C	T	440.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37692024	.	G	A	557.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37692092	.	A	G	10128.41	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	37692120	.	G	A	493.85	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37693632	.	C	T	5441.43	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37693646	.	C	T	510.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37693689	.	A	C	5803.44	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37693732	.	G	A	890.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37693760	.	A	C	1169.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37693761	.	A	C	21643.02	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	37695256	.	T	C	92475.21	PASS	AC=1028;AF=0.62530;AN=1644;DS;set=Intersection
22	37696906	.	G	A	4914.68	PASS	AC=23;AF=0.01406;AN=1636;DS;set=Intersection
22	37696927	.	G	A	839.68	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37696934	.	C	T	11548.67	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	37696978	.	C	T	905.05	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37697110	.	C	T	541.38	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	37699262	.	G	C	10637.69	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	37699279	.	G	A	252.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37699323	.	C	T	581.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37699377	.	T	C	207625.90	PASS	AC=1144;AF=0.69586;AN=1644;DS;set=Intersection
22	37699476	.	C	T	1555.04	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	37705228	.	C	T	462.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37705409	.	C	T	263.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37707024	.	C	T	377.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37707072	.	C	T	22901.19	PASS	AC=51;AF=0.03102;AN=1644;DS;set=Intersection
22	37707122	.	T	C	2274.02	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37707138	.	C	T	790.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37707140	.	C	T	16844.14	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	37707145	.	C	T	644.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37707458	.	C	T	1260	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37707488	.	T	C	215.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37709438	.	C	T	2046.61	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37709536	.	T	C	6224	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37709572	.	G	A	1198.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37769130	.	G	A	329.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37769205	.	G	A	614.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37769211	.	G	A	951.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37769298	.	G	A	798.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37769342	.	G	A	90.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37769393	.	C	T	377.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37769662	.	T	C	42.02	PASS	AC=1;AF=0.00061;AN=1638;set=Intersection
22	37769685	.	G	A	141.48	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	37769686	.	C	T	51.33	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	37769712	.	G	A	2480.49	PASS	AC=10;AF=0.00609;AN=1642;set=Intersection
22	37769786	.	C	G	268.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37769816	.	C	A	1189.71	PASS	AC=6;AF=0.00369;AN=1626;DS;set=Intersection
22	37769880	.	G	A	415.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37770023	.	C	T	644.69	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37770044	.	C	T	247.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37770048	.	G	A	1200.47	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37770066	.	G	T	157688.34	PASS	AC=685;AF=0.41667;AN=1644;DS;set=Intersection
22	37770108	.	G	A	4559.24	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37770210	.	G	A	6644.27	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	37770357	.	A	G	200305.10	PASS	AC=754;AF=0.45864;AN=1644;DS;set=Intersection
22	37770426	.	G	A	1330.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37770517	.	G	A	510.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37770582	.	G	A	650.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37770630	.	G	A	99880.64	PASS	AC=486;AF=0.29562;AN=1644;DS;set=Intersection
22	37770765	.	G	A	666.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37770783	.	G	A	1205.88	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	37770790	.	G	T	9789.96	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	37770812	.	C	A,T	2184.64	PASS	AC=6,1;AF=0.00365,0.00061;AN=1644;DS;set=Intersection
22	37770960	.	G	A	523.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37771002	.	G	A	709.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37771158	.	G	A	173053.39	PASS	AC=744;AF=0.45255;AN=1644;DS;set=Intersection
22	37771348	.	T	C	557.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37771437	.	G	A	360.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37771491	.	C	T	148.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37771594	.	G	A	65.91	PASS	AC=1;AF=0.00069;AN=1456;set=Intersection
22	37866035	.	T	C	485.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37866063	.	G	A	4574.29	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37866071	.	CAG	C	894.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37866075	.	G	A	684.12	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	37866101	.	C	A	631.98	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	37868509	.	G	A	975.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37870534	.	C	T	108.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37870613	.	G	A	903.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37870631	.	G	A	1189.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37870707	.	C	T	536.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37872942	.	C	T	325.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37872974	.	T	C	153.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37873022	.	G	A	456.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37875446	.	A	G	9429.15	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	37875447	.	T	C	353.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37875569	.	T	TG	586.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37876195	.	C	A	1470.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37876221	.	C	A	586.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37876289	.	G	A	1171.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37876365	.	C	T	467.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37876376	.	T	TC	751.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37876729	.	C	A	538.36	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	37876747	.	G	A	167.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37876748	.	G	A	428.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37881962	.	T	C	529.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37882057	.	T	G	231.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37882061	.	T	C	561.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37882149	.	A	C	782.89	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37882171	.	G	A	306.32	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37882177	.	G	A	65.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37882197	.	G	C	176.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37882204	.	C	A	477.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37882226	.	TG	T	98.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37882252	.	A	C	122.45	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	37887387	.	C	T	45.06	PASS	AC=1;AF=0.00068;AN=1468;set=Intersection
22	37887478	.	G	A	43.43	PASS	AC=1;AF=0.00066;AN=1518;set=Intersection
22	37887726	.	G	A	123.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37887806	.	G	A	1828.70	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37887847	.	G	A	804.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37888488	.	G	A	346.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37888589	.	G	T	212.48	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37888594	.	A	C	532.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37888636	.	G	A	352.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37888779	.	A	G	236.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37888784	.	G	A	1168.71	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37888840	.	A	G	478.20	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	37888852	.	G	T	159.99	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	37890131	.	C	T	327.56	PASS	AC=3;AF=0.00193;AN=1552;set=Intersection
22	37891540	.	C	T	1021.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37891718	.	G	A	345.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37891957	.	C	T	381.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37892049	.	G	C	1134.07	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37892482	.	G	A	1005.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37892550	.	A	G	305.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37893047	.	G	A	772.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37898744	.	G	A	10293.04	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	37899242	.	A	G	1828.31	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	37900200	.	G	C	595.08	PASS	AC=1;AF=0.00062;AN=1604;DS;set=Intersection
22	37900243	.	G	A	11835.89	PASS	AC=76;AF=0.04703;AN=1616;DS;set=Intersection
22	37900276	.	A	G	46600.32	PASS	AC=251;AF=0.15513;AN=1618;DS;set=Intersection
22	37900286	.	T	C	1469.76	PASS	AC=9;AF=0.00554;AN=1624;DS;set=Intersection
22	37900607	.	G	A	67255.58	PASS	AC=260;AF=0.15815;AN=1644;DS;set=Intersection
22	37900643	.	G	A	2292.59	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37900762	.	G	A	76308.20	PASS	AC=261;AF=0.15876;AN=1644;DS;set=Intersection
22	37900771	.	A	G	21967.01	PASS	AC=125;AF=0.07603;AN=1644;DS;set=Intersection
22	37900782	.	A	C	6987.64	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	37902157	.	C	T	201.20	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	37902177	.	T	C	38561.31	PASS	AC=318;AF=0.23838;AN=1334;DS;set=Intersection
22	37902183	.	A	G	185.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37902193	.	G	C	160.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37902223	.	C	T	400.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37902235	.	A	C	26047.39	PASS	AC=72;AF=0.04380;AN=1644;DS;set=Intersection
22	37902274	.	C	T	769	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	37902275	.	G	A	706.42	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	37902322	.	G	T	1085.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37902377	.	C	T	163.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37902421	.	A	G	366.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37903878	.	A	G	27885.20	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	37903883	.	C	T	20606.82	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	37903936	.	C	T	474.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37903937	.	G	A	705.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37903975	.	G	A	1799.42	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37904528	.	C	A	649.21	PASS	AC=17;AF=0.01046;AN=1626;set=Intersection
22	37904552	.	G	A	547.81	PASS	AC=5;AF=0.00306;AN=1636;set=Intersection
22	37904656	.	G	A	126.01	PASS	AC=1;AF=0.00062;AN=1624;set=Intersection
22	37904659	.	C	G	78.21	PASS	AC=1;AF=0.00062;AN=1614;set=Intersection
22	37904676	.	G	A	108.05	PASS	AC=2;AF=0.00123;AN=1626;set=Intersection
22	37904695	.	G	A	839.13	PASS	AC=38;AF=0.02381;AN=1596;set=Intersection
22	37906277	.	C	T	135.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37906308	.	GCTCCTT	G	62650.30	PASS	AC=528;AF=0.32117;AN=1644;DS;set=Intersection
22	37906386	.	A	T	1008.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37906417	.	G	A	2710.58	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37906426	.	C	T	738.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37912053	.	A	T	187.41	PASS	AC=2;AF=0.00122;AN=1642;set=Intersection
22	37912152	.	C	T	86.36	PASS	AC=1;AF=0.00062;AN=1622;set=Intersection
22	37912254	.	C	T	240.48	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	37913936	.	A	C	45524.37	PASS	AC=151;AF=0.09185;AN=1644;DS;set=Intersection
22	37913942	.	G	T	229.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37913945	.	C	G	770.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37915100	.	A	G	9358.52	PASS	AC=161;AF=0.10113;AN=1592;set=Intersection
22	37915145	.	C	T	2605.21	PASS	AC=92;AF=0.06166;AN=1492;set=Intersection
22	37915200	.	C	G	38.51	PASS	AC=1;AF=0.00073;AN=1374;set=Intersection
22	37962383	.	C	T	86.26	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	37962541	.	C	A	190.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37962557	.	C	T	7542.78	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	37962583	.	G	A	4848.72	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	37962642	.	C	T	328.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37962643	.	C	T	402.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37962646	.	G	A	2157.75	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	37962710	.	C	T	557.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37962740	.	C	T	4677.49	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	37962777	.	G	C	171.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37964076	.	G	T	948.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	37964098	.	G	T	26496.17	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	37964154	.	G	A	846.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37964203	.	G	A	5170.57	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37964214	.	G	A	3207.82	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	37964231	.	T	C	31072.80	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	37964299	.	C	G	111277.28	PASS	AC=744;AF=0.45255;AN=1644;DS;set=Intersection
22	37964383	.	C	T	10998.04	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	37964408	.	CCAGCGCCTGCTGCAAACCCCT	C	80718.99	PASS	AC=629;AF=0.38494;AN=1634;DS;set=Intersection
22	37964413	.	GCCTGCTGCAAACCCCTCAGCA	G	56738.71	PASS	AC=591;AF=0.36302;AN=1628;DS;set=Intersection
22	37964575	.	T	C	6542.05	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	37964580	.	G	A	399.45	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	37964632	.	C	T	680.55	PASS	AC=7;AF=0.00428;AN=1636;set=Intersection
22	37964682	.	T	C	214.70	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	37964756	.	G	A	128.41	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	37964767	.	A	G	608.31	PASS	AC=3;AF=0.00182;AN=1644;set=Intersection
22	37964795	.	G	A	107.46	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	37964857	.	C	G	159.25	PASS	AC=4;AF=0.00244;AN=1638;set=Intersection
22	37966258	.	G	A	395	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37966314	.	C	T	56997.01	PASS	AC=83;AF=0.05049;AN=1644;DS;set=Intersection
22	37966366	.	G	A	972.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37966409	.	G	A	38240.74	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	37966427	.	G	A	1500.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37966572	.	T	C	850.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37966623	.	CGTT	C	925.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37966634	.	C	T	5356.17	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	37966648	.	C	T	1968.68	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37966649	.	G	A	8459.90	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	37966655	.	T	A	1017.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37966686	.	C	T	9096.01	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	37966689	.	G	A	2202.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	37966787	.	G	A	1028.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37967817	.	C	T	964.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37967856	.	C	A	1036.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	37967904	.	G	A	891.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38010291	.	C	T	2267.14	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38012892	.	G	A	142.81	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38012897	.	G	A	248.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38012938	.	C	T	574.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38014442	.	C	G	601.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38014443	.	C	G	2015.30	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38016355	.	G	C	897.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38016386	.	T	TG	594.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38016825	.	G	A	6050.51	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	38016833	.	C	T	2091.58	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38017682	.	C	T	517.23	PASS	AC=3;AF=0.00188;AN=1598;DS;set=Intersection
22	38019448	.	G	C	788.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38019458	.	G	A	2329.86	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38019493	.	C	T	451.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38019499	.	C	T	508.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38019526	.	C	T	359.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38019542	.	C	T	426.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38019677	.	C	A,G,T	233.42	PASS	AC=0,2,1;AF=0.00000,0.00123,0.00062;AN=1624;DS;set=Intersection
22	38021036	.	T	C	1132.18	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38021070	.	C	T	272.89	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38021761	.	C	CGT	1489.32	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38021777	.	T	A	1182.47	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38021796	.	C	T	440.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38021882	.	G	A	714.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38021889	.	C	T	667.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38025497	.	C	T	923.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38025556	.	T	C	30472.44	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	38026059	.	G	A	5710.75	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	38026075	.	C	T	511.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38026077	.	C	G	1462.51	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38026109	.	C	T	1231.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38026215	.	C	T	486.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38026965	.	A	G	451.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38027012	.	C	T	2131.96	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38027013	.	G	A	796.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38028016	.	C	T	833.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38028046	.	C	T	1788.43	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	38028073	.	A	G	6145.64	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	38028076	.	G	T	2103.65	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38028094	.	G	A	309.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38028441	.	G	A	1510.47	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38028456	.	A	G	48049.74	PASS	AC=54;AF=0.03285;AN=1644;DS;set=Intersection
22	38028471	.	C	T	18959.83	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	38028558	.	CG	C	1298.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38028566	.	TCTC	T	1393.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38028582	.	C	T	705.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38028618	.	G	A	358.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38028644	.	A	G	328.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38035777	.	C	T	155.90	PASS	AC=3;AF=0.00213;AN=1408;set=Intersection
22	38035851	.	A	G	5497.36	PASS	AC=244;AF=0.16354;AN=1492;set=Intersection
22	38037109	.	C	A	103.63	PASS	AC=1;AF=0.00087;AN=1156;set=Intersection
22	38037113	.	C	G	179.54	PASS	AC=2;AF=0.00173;AN=1156;set=Intersection
22	38037117	.	CCA	C	805.13	PASS	AC=315;AF=0.25240;AN=1248;set=Intersection
22	38037118	.	CA	C	1246.86	PASS	AC=356;AF=0.28571;AN=1246;set=Intersection
22	38037158	.	G	A	173.38	PASS	AC=3;AF=0.00204;AN=1468;set=Intersection
22	38037361	.	C	T	49.41	PASS	AC=1;AF=0.00068;AN=1470;set=Intersection
22	38037374	.	T	C	2236.87	PASS	AC=30;AF=0.02016;AN=1488;set=Intersection
22	38037401	.	G	A	924.07	PASS	AC=5;AF=0.00388;AN=1288;set=Intersection
22	38038513	.	G	A	102.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38038605	.	C	T	753.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38038644	.	C	T	2283.74	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	38038871	.	C	T	183.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38039089	.	C	A	1029.89	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38039128	.	A	G	18245.10	PASS	AC=108;AF=0.06569;AN=1644;DS;set=Intersection
22	38039197	.	G	A	493.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38039198	.	C	T	250.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38039211	.	T	C	479.57	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38039618	.	C	T	508.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38039625	.	C	T	20417	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	38039634	.	C	G	18392.61	PASS	AC=69;AF=0.04197;AN=1644;DS;set=Intersection
22	38039708	.	T	C	43700.30	PASS	AC=109;AF=0.06630;AN=1644;DS;set=Intersection
22	38039746	.	C	T	1765.39	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38039747	.	G	T	655.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38040711	.	G	A	825.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38040842	.	C	T	44744.76	PASS	AC=108;AF=0.06569;AN=1644;DS;set=Intersection
22	38040850	.	G	A	709.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38040911	.	CA	C	569.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38040957	.	C	T	290.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38040958	.	G	A	110.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38040997	.	C	T	446.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38041015	.	C	T	4493.86	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	38041328	.	G	A	42290.22	PASS	AC=124;AF=0.07543;AN=1644;DS;set=Intersection
22	38041375	.	A	G	1272.69	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38041544	.	A	G	400.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38042828	.	C	A	131.37	PASS	AC=1;AF=0.00062;AN=1622;DS;set=Intersection
22	38042887	.	G	A	879.01	PASS	AC=2;AF=0.00123;AN=1628;DS;set=Intersection
22	38042948	.	G	A	521.37	PASS	AC=3;AF=0.00189;AN=1584;DS;set=Intersection
22	38042969	.	TG	T	174.50	PASS	AC=2;AF=0.00125;AN=1606;DS;set=Intersection
22	38042971	.	G	C	174.21	PASS	AC=1;AF=0.00063;AN=1596;DS;set=Intersection
22	38042972	.	G	C	2364.54	PASS	AC=20;AF=0.01255;AN=1594;DS;set=Intersection
22	38042982	.	G	A	4274.28	PASS	AC=70;AF=0.04397;AN=1592;DS;set=Intersection
22	38043372	.	A	C	1770.78	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38043385	.	G	A	10002.75	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	38043416	.	G	A	1434.63	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38043439	.	C	A	419.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38043443	.	C	A,G,T	1061.70	PASS	AC=1,5,0;AF=0.00061,0.00304,0.00000;AN=1644;DS;set=Intersection
22	38043444	.	C	A	83893.49	PASS	AC=612;AF=0.37226;AN=1644;DS;set=Intersection
22	38043526	.	C	A	799.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38043548	.	C	A	4735.24	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	38043568	.	G	C	1149.91	PASS	AC=5;AF=0.00305;AN=1640;set=Intersection
22	38044289	.	C	T	42.59	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	38044298	.	C	A	4243.43	PASS	AC=5;AF=0.00305;AN=1638;DS;set=Intersection
22	38044341	.	C	T	2716.29	PASS	AC=21;AF=0.01280;AN=1640;DS;set=Intersection
22	38046109	.	G	T	1397.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38046173	.	T	G	306.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38046235	.	G	A,T	1358.97	PASS	AC=5,1;AF=0.00304,0.00061;AN=1644;DS;set=Intersection
22	38046262	.	G	A	5687.24	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	38046511	.	C	T	967.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38046512	.	G	A	213.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38046531	.	C	T	346.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38046666	.	C	T	32617.28	PASS	AC=60;AF=0.03650;AN=1644;DS;set=Intersection
22	38046672	.	C	T	1731.18	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38046678	.	C	T	457.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38046695	.	C	A	57012.78	PASS	AC=240;AF=0.14599;AN=1644;DS;set=Intersection
22	38046718	.	A	G	79925.19	PASS	AC=186;AF=0.11314;AN=1644;DS;set=Intersection
22	38049816	.	C	T	10728.93	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	38049843	.	G	A	3188.69	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38049878	.	G	A	504.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38049922	.	C	T	555.78	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	38051291	.	C	T	113.03	PASS	AC=1;AF=0.00062;AN=1606;DS;set=Intersection
22	38051328	.	C	T	1351.86	PASS	AC=25;AF=0.01576;AN=1586;DS;set=Intersection
22	38051329	.	G	A	1058.27	PASS	AC=17;AF=0.01075;AN=1582;DS;set=Intersection
22	38051355	.	G	A	6095.24	PASS	AC=293;AF=0.19327;AN=1516;set=Intersection
22	38051451	.	G	A	1410.13	PASS	AC=40;AF=0.03115;AN=1284;set=Intersection
22	38051460	.	C	T	3208.96	PASS	AC=66;AF=0.04832;AN=1366;set=Intersection
22	38051493	.	G	T	400.31	PASS	AC=22;AF=0.01391;AN=1582;set=Intersection
22	38051508	.	C	T	348.53	PASS	AC=1;AF=0.00062;AN=1604;set=Intersection
22	38051511	.	C	A	1369.56	PASS	AC=12;AF=0.00748;AN=1604;set=Intersection
22	38051571	.	G	A	145.81	PASS	AC=1;AF=0.00063;AN=1590;set=Intersection
22	38051628	.	C	A	8452.11	PASS	AC=74;AF=0.04574;AN=1618;set=Intersection
22	38051632	.	A	T	44.20	PASS	AC=1;AF=0.00062;AN=1614;set=Intersection
22	38061514	.	C	T	205.86	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	38061520	.	C	G	25498.76	PASS	AC=464;AF=0.28258;AN=1642;set=Intersection
22	38061544	.	G	A	5003.02	PASS	AC=14;AF=0.00852;AN=1644;set=Intersection
22	38061576	.	G	T	388.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38061602	.	A	G	950.89	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38061637	.	A	T	1857.40	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	38061785	.	G	A	936.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38061816	.	G	A	4276.18	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	38071707	.	A	G	7606.45	PASS	AC=58;AF=0.03737;AN=1552;DS;set=Intersection
22	38071731	.	A	AC	5390.43	PASS	AC=156;AF=0.10263;AN=1520;DS;set=Intersection
22	38071738	.	C	A	2302.19	PASS	AC=7;AF=0.00467;AN=1500;DS;set=Intersection
22	38071739	.	C	A	640.76	PASS	AC=1;AF=0.00067;AN=1494;DS;set=Intersection
22	38071763	.	A	G	571.30	PASS	AC=1;AF=0.00072;AN=1392;DS;set=Intersection
22	38072958	.	C	T	1028.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38072978	.	G	A	548.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38072983	.	G	T	2617.81	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38074477	.	C	T	1179.57	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38074598	.	C	T	543.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38074613	.	C	T	385.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38074614	.	G	A	706.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38074682	.	G	A	1090.84	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38075660	.	A	T	1634.94	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38075683	.	G	A	919.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38075720	.	C	T	799.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38082372	.	G	C	2941.20	PASS	AC=12;AF=0.00732;AN=1640;DS;set=Intersection
22	38082421	.	A	C	141.07	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38082442	.	C	T	752.05	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38082479	.	G	T	62.94	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38083908	.	T	G	64.34	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	38083979	.	T	C	92.55	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38084029	.	A	G	1423.07	PASS	AC=4;AF=0.00245;AN=1630;DS;set=Intersection
22	38084040	.	G	T	76.41	PASS	AC=1;AF=0.00061;AN=1628;DS;set=Intersection
22	38084404	.	G	A	55074.39	PASS	AC=86;AF=0.05231;AN=1644;DS;set=Intersection
22	38084817	.	G	A	1100.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38084896	.	C	T	741.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38084910	.	T	C	25786.75	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	38085033	.	C	T	6896.63	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	38086725	.	G	A	1066.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38086736	.	G	A	821.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38086744	.	C	T	983.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38086745	.	G	A	1942.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38086785	.	C	T	554.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38086823	.	C	G	842.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38086826	.	C	T	7362.29	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	38086835	.	C	G	853.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38087144	.	A	G	1003.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38087237	.	A	G	1091.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38087309	.	G	C	2281.25	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38087359	.	G	A	636.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38087378	.	C	T	560.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38087382	.	G	A	534.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38097359	.	C	G	17295.40	PASS	AC=224;AF=0.16350;AN=1370;set=Intersection
22	38097492	.	C	T	58.75	PASS	AC=1;AF=0.00067;AN=1490;DS;set=Intersection
22	38097502	.	A	G	4563.47	PASS	AC=14;AF=0.00937;AN=1494;DS;set=Intersection
22	38097529	.	G	C	316.67	PASS	AC=1;AF=0.00065;AN=1532;DS;set=Intersection
22	38106399	.	C	T	681.30	PASS	AC=7;AF=0.00555;AN=1262;DS;set=Intersection
22	38106403	.	G	A	283.50	PASS	AC=1;AF=0.00079;AN=1266;DS;set=Intersection
22	38106473	.	G	A	142.98	PASS	AC=1;AF=0.00082;AN=1226;DS;set=Intersection
22	38106514	.	C	T	138.33	PASS	AC=1;AF=0.00082;AN=1226;DS;set=Intersection
22	38109206	.	T	C	515.71	PASS	AC=1;AF=0.00074;AN=1348;DS;set=Intersection
22	38109227	.	C	G	994.02	PASS	AC=2;AF=0.00149;AN=1342;DS;set=Intersection
22	38109327	.	T	C	527.92	PASS	AC=1;AF=0.00069;AN=1448;DS;set=Intersection
22	38109343	.	C	T	712.54	PASS	AC=1;AF=0.00071;AN=1416;DS;set=Intersection
22	38109353	.	G	A	2397.33	PASS	AC=4;AF=0.00280;AN=1430;DS;set=Intersection
22	38109371	.	A	G	663.46	PASS	AC=1;AF=0.00069;AN=1454;DS;set=Intersection
22	38111789	.	G	A	148.63	PASS	AC=1;AF=0.00083;AN=1208;DS;set=Intersection
22	38111790	.	G	T	403.43	PASS	AC=1;AF=0.00083;AN=1204;DS;set=Intersection
22	38111817	.	C	A	3071.24	PASS	AC=7;AF=0.00590;AN=1186;DS;set=Intersection
22	38111897	.	C	T	1007.01	PASS	AC=4;AF=0.00342;AN=1170;DS;set=Intersection
22	38119166	.	C	T	1167.94	PASS	AC=12;AF=0.00871;AN=1378;DS;set=Intersection
22	38119213	.	G	A	78565.34	PASS	AC=725;AF=0.55769;AN=1300;DS;set=Intersection
22	38119214	.	C	T	1577.18	PASS	AC=7;AF=0.00547;AN=1280;DS;set=Intersection
22	38119239	.	C	T	354.83	PASS	AC=1;AF=0.00077;AN=1292;DS;set=Intersection
22	38119272	.	C	T	175.87	PASS	AC=1;AF=0.00070;AN=1420;DS;set=Intersection
22	38119330	.	C	T	801.42	PASS	AC=1;AF=0.00067;AN=1500;DS;set=Intersection
22	38119378	.	C	A	870.41	PASS	AC=1;AF=0.00065;AN=1538;DS;set=Intersection
22	38119476	.	A	C	1129.64	PASS	AC=1;AF=0.00065;AN=1546;DS;set=Intersection
22	38119514	.	G	T	2848.65	PASS	AC=3;AF=0.00196;AN=1534;DS;set=Intersection
22	38119527	.	G	T	848.55	PASS	AC=1;AF=0.00067;AN=1494;DS;set=Intersection
22	38119545	.	G	A	825.78	PASS	AC=1;AF=0.00066;AN=1518;DS;set=Intersection
22	38119695	.	C	T	685.41	PASS	AC=2;AF=0.00136;AN=1472;DS;set=Intersection
22	38119721	.	C	T	1842.83	PASS	AC=7;AF=0.00475;AN=1474;DS;set=Intersection
22	38119753	.	CTCA	C	29995.05	PASS	AC=518;AF=0.35479;AN=1460;DS;set=Intersection
22	38119754	.	TCAA	T	103300.64	PASS	AC=546;AF=0.37397;AN=1460;DS;set=Intersection
22	38120175	.	GCCT	G	31674.41	PASS	AC=379;AF=0.24547;AN=1544;DS;set=Intersection
22	38120542	.	C	T	16977.20	PASS	AC=47;AF=0.03084;AN=1524;DS;set=Intersection
22	38120688	.	T	G	49.14	PASS	AC=1;AF=0.00065;AN=1546;DS;set=Intersection
22	38120712	.	C	G	807.33	PASS	AC=1;AF=0.00065;AN=1536;DS;set=Intersection
22	38120740	.	G	A	863.48	PASS	AC=3;AF=0.00199;AN=1506;DS;set=Intersection
22	38120797	.	G	A	3152.59	PASS	AC=7;AF=0.00462;AN=1514;DS;set=Intersection
22	38120834	.	C	G	1520.42	PASS	AC=2;AF=0.00132;AN=1516;DS;set=Intersection
22	38120955	.	C	T	10771.41	PASS	AC=10;AF=0.00644;AN=1552;DS;set=Intersection
22	38120956	.	G	A	1003.44	PASS	AC=1;AF=0.00064;AN=1554;DS;set=Intersection
22	38120995	.	A	G	767.77	PASS	AC=1;AF=0.00063;AN=1596;DS;set=Intersection
22	38121013	.	C	G	30923.29	PASS	AC=57;AF=0.03621;AN=1574;DS;set=Intersection
22	38121017	.	T	C	1049.06	PASS	AC=3;AF=0.00191;AN=1572;DS;set=Intersection
22	38121040	.	C	T	6135.51	PASS	AC=13;AF=0.00829;AN=1568;DS;set=Intersection
22	38121152	.	C	A	109462.63	PASS	AC=589;AF=0.38446;AN=1532;DS;set=Intersection
22	38121173	.	A	G	12014.88	PASS	AC=10;AF=0.00653;AN=1532;DS;set=Intersection
22	38121227	.	A	G	6519.94	PASS	AC=11;AF=0.00716;AN=1536;DS;set=Intersection
22	38121258	.	C	G	1034.16	PASS	AC=1;AF=0.00067;AN=1502;DS;set=Intersection
22	38121287	.	G	A	2230.11	PASS	AC=4;AF=0.00265;AN=1512;DS;set=Intersection
22	38121374	.	C	T	1047.34	PASS	AC=1;AF=0.00064;AN=1554;DS;set=Intersection
22	38121486	.	C	T	620.65	PASS	AC=1;AF=0.00063;AN=1584;DS;set=Intersection
22	38121502	.	C	T	578.23	PASS	AC=1;AF=0.00063;AN=1578;DS;set=Intersection
22	38121555	.	G	A	730.04	PASS	AC=1;AF=0.00065;AN=1532;DS;set=Intersection
22	38121631	.	C	T	1375.52	PASS	AC=2;AF=0.00138;AN=1454;DS;set=Intersection
22	38121652	.	C	G	1877.68	PASS	AC=5;AF=0.00340;AN=1470;DS;set=Intersection
22	38121696	.	C	T	2096.35	PASS	AC=2;AF=0.00145;AN=1380;DS;set=Intersection
22	38121725	.	C	T	821.97	PASS	AC=1;AF=0.00072;AN=1382;DS;set=Intersection
22	38121795	.	C	T	1270.29	PASS	AC=2;AF=0.00161;AN=1240;DS;set=Intersection
22	38121806	.	A	G	631.70	PASS	AC=1;AF=0.00076;AN=1324;DS;set=Intersection
22	38121932	.	C	T	1904.05	PASS	AC=3;AF=0.00220;AN=1366;DS;set=Intersection
22	38122028	.	C	T	1066.78	PASS	AC=1;AF=0.00077;AN=1292;DS;set=Intersection
22	38122122	.	T	C	95291.17	PASS	AC=480;AF=0.37094;AN=1294;DS;set=Intersection
22	38122170	.	A	G	707.90	PASS	AC=1;AF=0.00078;AN=1276;DS;set=Intersection
22	38122198	.	T	A	691.67	PASS	AC=1;AF=0.00080;AN=1252;DS;set=Intersection
22	38122252	.	C	T	534.82	PASS	AC=1;AF=0.00081;AN=1232;DS;set=Intersection
22	38122362	.	C	A	314.98	PASS	AC=2;AF=0.00166;AN=1204;DS;set=Intersection
22	38122448	.	C	T	12009.29	PASS	AC=431;AF=0.36464;AN=1182;set=Intersection
22	38122462	.	A	G	20170.17	PASS	AC=755;AF=0.63127;AN=1196;set=Intersection
22	38129332	.	G	A	3023.70	PASS	AC=462;AF=0.42385;AN=1090;set=Intersection
22	38130375	.	A	C	16195.96	PASS	AC=63;AF=0.04709;AN=1338;set=Intersection
22	38130385	.	A	C	54009.88	PASS	AC=732;AF=0.54142;AN=1352;set=Intersection
22	38130420	.	T	C	1297.75	PASS	AC=5;AF=0.00355;AN=1410;DS;set=Intersection
22	38130442	.	C	T	411.39	PASS	AC=1;AF=0.00071;AN=1408;DS;set=Intersection
22	38130446	.	G	A	101.24	PASS	AC=1;AF=0.00071;AN=1408;DS;set=Intersection
22	38130459	.	G	T	27821.98	PASS	AC=387;AF=0.27682;AN=1398;DS;set=Intersection
22	38130472	.	T	C	123545.89	PASS	AC=1350;AF=0.97968;AN=1378;DS;set=Intersection
22	38130508	.	C	A	702.43	PASS	AC=3;AF=0.00235;AN=1276;DS;set=Intersection
22	38130521	.	C	T	1561.51	PASS	AC=7;AF=0.00553;AN=1266;DS;set=Intersection
22	38130597	.	A	G	110.47	PASS	AC=1;AF=0.00076;AN=1320;set=Intersection
22	38130642	.	G	A	409.48	PASS	AC=1;AF=0.00078;AN=1290;set=Intersection
22	38130676	.	A	G	437.92	PASS	AC=2;AF=0.00153;AN=1310;set=Intersection
22	38130827	.	A	T	412.80	PASS	AC=3;AF=0.00238;AN=1260;DS;set=Intersection
22	38130910	.	G	A	1381.92	PASS	AC=2;AF=0.00164;AN=1220;DS;set=Intersection
22	38130986	.	C	T	3148.90	PASS	AC=5;AF=0.00409;AN=1222;DS;set=Intersection
22	38131043	.	G	A	722.07	PASS	AC=1;AF=0.00084;AN=1188;DS;set=Intersection
22	38131071	.	T	C	264.05	PASS	AC=1;AF=0.00084;AN=1184;DS;set=Intersection
22	38131275	.	C	T	451.48	PASS	AC=1;AF=0.00069;AN=1446;DS;set=Intersection
22	38131373	.	C	T	319.80	PASS	AC=1;AF=0.00069;AN=1456;DS;set=Intersection
22	38131395	.	G	T	1031.46	PASS	AC=12;AF=0.00847;AN=1416;DS;set=Intersection
22	38131401	.	C	G	370.30	PASS	AC=2;AF=0.00141;AN=1422;DS;set=Intersection
22	38136941	.	C	T	135.31	PASS	AC=1;AF=0.00081;AN=1234;set=Intersection
22	38137087	.	G	A	298.51	PASS	AC=8;AF=0.00620;AN=1290;set=Intersection
22	38142199	.	G	T	317.93	PASS	AC=15;AF=0.0250;AN=600;set=Intersection
22	38142222	.	GA	G,GAAA,GAAAA	1899.70	PASS	AC=203,231,321;AF=0.2063,0.2348,0.3262;AN=984;set=Intersection
22	38142235	.	A	AAAG	184.14	PASS	AC=9;AF=0.00829;AN=1086;set=Intersection
22	38142468	.	A	G	2830.29	PASS	AC=407;AF=0.7949;AN=512;set=Intersection
22	38147805	.	A	T	697.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38150836	.	A	G	19795.74	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	38150870	.	C	T	1755.37	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38150871	.	A	G	630.48	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38150875	.	T	A	372.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38150908	.	A	T	1668.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38151000	.	A	G	16398.96	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	38151100	.	TG	T	13697.21	PASS	AC=84;AF=0.05109;AN=1644;DS;set=Intersection
22	38151170	.	G	A	10979.93	PASS	AC=84;AF=0.05109;AN=1644;DS;set=Intersection
22	38151516	.	G	A	9103.60	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	38151567	.	C	T	916.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38151606	.	G	A	1916.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38153607	.	G	C	117.27	PASS	AC=1;AF=0.00062;AN=1626;set=Intersection
22	38153696	.	C	T	872.27	PASS	AC=5;AF=0.00307;AN=1630;set=Intersection
22	38153699	.	G	A	70.92	PASS	AC=1;AF=0.00061;AN=1628;set=Intersection
22	38153701	.	G	A	96.15	PASS	AC=1;AF=0.00061;AN=1630;set=Intersection
22	38153835	.	G	A	35.69	PASS	AC=1;AF=0.00063;AN=1576;set=Intersection
22	38154067	.	C	T	469.81	PASS	AC=4;AF=0.00243;AN=1644;set=Intersection
22	38154189	.	G	A	121.30	PASS	AC=5;AF=0.00311;AN=1606;DS;set=Intersection
22	38154193	.	C	T	43.54	PASS	AC=1;AF=0.00062;AN=1620;DS;set=Intersection
22	38155195	.	G	A	202.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38155217	.	G	A	70.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38155219	.	G	C	7314.98	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	38155255	.	C	T	1070.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38155279	.	C	T	874.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38155317	.	C	G	370776.51	PASS	AC=1609;AF=0.97871;AN=1644;DS;set=Intersection
22	38155398	.	C	T	762.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38155462	.	G	A	1768.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38155497	.	A	G	113160.53	PASS	AC=133;AF=0.08090;AN=1644;DS;set=Intersection
22	38161834	.	C	T	250.97	PASS	AC=3;AF=0.00254;AN=1182;set=Intersection
22	38161835	.	T	TG	15980.25	PASS	AC=774;AF=0.63547;AN=1218;set=Intersection
22	38161838	.	G	T	304.86	PASS	AC=3;AF=0.00248;AN=1210;set=Intersection
22	38161839	.	G	GA	611.83	PASS	AC=65;AF=0.05328;AN=1220;set=Intersection
22	38161857	.	G	A	735.40	PASS	AC=8;AF=0.00672;AN=1190;set=Intersection
22	38164106	.	C	T	32983.94	PASS	AC=376;AF=0.27770;AN=1354;DS;set=Intersection
22	38164164	.	G	A	146.15	PASS	AC=1;AF=0.00076;AN=1312;DS;set=Intersection
22	38164179	.	C	T	1035.51	PASS	AC=3;AF=0.00233;AN=1286;DS;set=Intersection
22	38165091	.	A	T	908.05	PASS	AC=1;AF=0.00064;AN=1574;DS;set=Intersection
22	38165151	.	G	A	254.95	PASS	AC=1;AF=0.00076;AN=1324;DS;set=Intersection
22	38165153	.	C	T	171.10	PASS	AC=1;AF=0.00073;AN=1366;DS;set=Intersection
22	38165223	.	CG	C	15399.74	PASS	AC=385;AF=0.28392;AN=1356;set=Intersection
22	38165269	.	G	A	789.98	PASS	AC=5;AF=0.00383;AN=1304;set=Intersection
22	38165302	.	C	G	224.11	PASS	AC=1;AF=0.00078;AN=1282;set=Intersection
22	38165304	.	G	A	64.14	PASS	AC=2;AF=0.00156;AN=1278;set=Intersection
22	38165339	.	A	G	350.20	PASS	AC=3;AF=0.00247;AN=1216;set=Intersection
22	38167607	.	G	T	494.65	PASS	AC=3;AF=0.00245;AN=1224;DS;set=Intersection
22	38167662	.	G	T	515.97	PASS	AC=1;AF=0.00081;AN=1234;DS;set=Intersection
22	38167669	.	G	A	1242.47	PASS	AC=2;AF=0.00163;AN=1228;DS;set=Intersection
22	38167706	.	T	C	5174.99	PASS	AC=7;AF=0.00554;AN=1264;DS;set=Intersection
22	38168567	.	G	A	1228.80	PASS	AC=5;AF=0.00373;AN=1340;DS;set=Intersection
22	38168578	.	A	G	685.53	PASS	AC=1;AF=0.00074;AN=1348;DS;set=Intersection
22	38168645	.	A	G	845.96	PASS	AC=1;AF=0.00072;AN=1398;DS;set=Intersection
22	38168703	.	G	A	2632.28	PASS	AC=3;AF=0.00217;AN=1382;DS;set=Intersection
22	38201542	.	A	G	1909.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38201546	.	G	A	841.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38201761	.	G	A	792.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38201860	.	G	A	820.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38202015	.	A	G	837.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38203942	.	G	C	52.77	PASS	AC=1;AF=0.00082;AN=1220;set=Intersection
22	38203958	.	C	T	76.69	PASS	AC=2;AF=0.00166;AN=1206;set=Intersection
22	38203979	.	G	A	37.12	PASS	AC=2;AF=0.00151;AN=1324;set=Intersection
22	38204029	.	C	T	162.96	PASS	AC=4;AF=0.00268;AN=1494;set=Intersection
22	38204033	.	C	T	119.51	PASS	AC=1;AF=0.00067;AN=1492;set=Intersection
22	38204089	.	C	T	95741.45	PASS	AC=974;AF=0.61959;AN=1572;DS;set=Intersection
22	38204130	.	C	T	83.97	PASS	AC=1;AF=0.00063;AN=1578;DS;set=Intersection
22	38204180	.	C	A,G,T	2353.57	PASS	AC=0,21,1;AF=0.00000,0.01353,0.00064;AN=1552;DS;set=Intersection
22	38204209	.	C	T	103.59	PASS	AC=1;AF=0.00065;AN=1534;DS;set=Intersection
22	38205989	.	T	C	76326.28	PASS	AC=469;AF=0.28528;AN=1644;DS;set=Intersection
22	38206081	.	C	T	703.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38206124	.	G	T	2419.45	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38208872	.	G	C	764.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38208984	.	G	C	696.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38209502	.	G	A	65.64	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	38209527	.	A	T	219.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38209586	.	C	T	4851.03	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	38209618	.	T	C	52.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38209623	.	C	T	292.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38209627	.	G	A	2310.05	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	38209649	.	C	T	5683.87	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	38209650	.	G	A	2448.63	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	38209651	.	C	T	686	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38211106	.	C	T	601.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38211117	.	C	G	5751.18	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	38211281	.	C	G	409.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38211445	.	G	A	360.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38211521	.	T	C	58.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38211649	.	C	G	349.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38211659	.	C	T	422.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38211711	.	C	T	8202.97	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	38211728	.	A	G	44687.56	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	38211729	.	T	TA	389.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38211743	.	C	T	483.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212158	.	G	A	633.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212243	.	C	G	403.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212254	.	G	A	710.18	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38212289	.	C	T	5487.52	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	38212302	.	G	C	752.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212315	.	C	T	600.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212337	.	G	C	652.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212540	.	G	C	563.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212551	.	G	A	1889.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38212588	.	G	A	1876.91	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38212624	.	C	T	6115.46	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	38212638	.	G	A	973.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212654	.	A	C	547.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212660	.	G	GA	1059.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38212673	.	G	A	948.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38212762	.	A	G	101420.32	PASS	AC=1201;AF=0.73054;AN=1644;DS;set=Intersection
22	38219401	.	G	A	509.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38219421	.	A	C	541.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38219452	.	G	A	17512.25	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	38219455	.	T	A,C,G	2401.47	PASS	AC=2,3,0;AF=0.00122,0.00182,0.00000;AN=1644;DS;set=Intersection
22	38219465	.	G	A,T	1111.10	PASS	AC=1,1;AF=0.00061,0.00061;AN=1644;DS;set=Intersection
22	38219551	.	C	T	2460.39	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	38219570	.	C	G	940.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38219622	.	G	A,C,T	698.12	PASS	AC=1,1,0;AF=0.00061,0.00061,0.00000;AN=1644;DS;set=Intersection
22	38219639	.	G	C	542.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38219664	.	C	T	746.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38219690	.	C	G	483.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38219776	.	C	T	500.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38219787	.	G	C	103.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38220948	.	A	C	282.59	PASS	AC=2;AF=0.0020;AN=996;set=Intersection
22	38220964	.	T	C	8828.39	PASS	AC=663;AF=0.7254;AN=914;set=Intersection
22	38221072	.	G	A	121.01	PASS	AC=14;AF=0.0153;AN=918;set=Intersection
22	38221117	.	T	C	32.33	PASS	AC=1;AF=0.00075;AN=1332;set=Intersection
22	38221122	.	A	C	253.43	PASS	AC=1;AF=0.00073;AN=1368;set=Intersection
22	38221141	.	C	T	2130.95	PASS	AC=18;AF=0.01271;AN=1416;set=Intersection
22	38221408	.	T	G	97.45	PASS	AC=19;AF=0.0341;AN=558;set=Intersection
22	38221461	.	C	G,T	217.74	PASS	AC=30,19;AF=0.0405,0.0257;AN=740;set=Intersection
22	38227917	.	G	C	341.20	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38228634	.	TGC	T	753.27	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38228644	.	C	T	1674.88	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38228673	.	G	A	544.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38228925	.	T	A	622.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38228981	.	C	T	390.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38229019	.	G	C	714.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38229057	.	G	A	286.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38229061	.	A	G	1265.53	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38229083	.	C	T	480	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38229191	.	A	G	957.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38229752	.	G	A	715	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38234573	.	A	G	180.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38234580	.	C	A	4473.34	PASS	AC=9;AF=0.00548;AN=1642;DS;set=Intersection
22	38234648	.	G	A	538.09	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38236214	.	T	C	804.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38236258	.	G	A	2240.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38240267	.	T	G	166.62	PASS	AC=5;AF=0.00325;AN=1538;set=Intersection
22	38240289	.	G	T	489.55	PASS	AC=7;AF=0.00434;AN=1614;set=Intersection
22	38245412	.	C	T	525.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38245441	.	C	T	693.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38245456	.	C	T	571.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38246007	.	T	A	2251.78	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38246048	.	C	T	1659.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38246097	.	G	A	2558.95	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38251629	.	C	G	24020.03	PASS	AC=92;AF=0.05596;AN=1644;DS;set=Intersection
22	38251686	.	T	C	176620.37	PASS	AC=1266;AF=0.77007;AN=1644;DS;set=Intersection
22	38251687	.	G	A	1743.59	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38254764	.	C	T	803.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38254768	.	GT	G	2174.05	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38254769	.	T	G	2799.24	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38266150	.	C	G	1031.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38266350	.	C	T	5864.50	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	38266371	.	G	A	858.75	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38266376	.	C	G	22876.13	PASS	AC=67;AF=0.04075;AN=1644;DS;set=Intersection
22	38266378	.	G	A	6560.99	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	38270331	.	C	T	933.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38270459	.	C	T	979.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38270498	.	C	T	458.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38270541	.	A	G	891.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38270568	.	C	T	11350.29	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	38270578	.	A	G	601.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38271907	.	A	G	658.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38271937	.	C	T	562.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38272062	.	G	A	5563.24	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38273675	.	C	A	644.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38273676	.	C	T	746.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38273710	.	G	A	598.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38273749	.	T	C	196750.89	PASS	AC=656;AF=0.39903;AN=1644;DS;set=Intersection
22	38274005	.	A	AC	969.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38274208	.	G	A	245.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38282873	.	G	A	1150.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38282897	.	C	T	50448.41	PASS	AC=148;AF=0.09002;AN=1644;DS;set=Intersection
22	38284477	.	T	C	998.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38302469	.	C	T	65.27	PASS	AC=6;AF=0.0113;AN=532;set=Intersection
22	38302599	.	C	G	168.33	PASS	AC=11;AF=0.0251;AN=438;set=Intersection
22	38307909	.	T	C	156895.71	PASS	AC=590;AF=0.35888;AN=1644;DS;set=Intersection
22	38307970	.	C	T	1056.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38307992	.	C	G	2383.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38308044	.	GTGTA	G	21460.66	PASS	AC=456;AF=0.27737;AN=1644;DS;set=Intersection
22	38308048	.	ATGTG	A	88246.13	PASS	AC=595;AF=0.36192;AN=1644;DS;set=Intersection
22	38308394	.	G	A	730.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38313724	.	G	A	800.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38313787	.	A	T	6412.70	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	38313848	.	C	T	1513.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38315015	.	C	A	169.26	PASS	AC=4;AF=0.00265;AN=1512;set=Intersection
22	38315018	.	A	G	199.11	PASS	AC=1;AF=0.00066;AN=1520;set=Intersection
22	38315032	.	G	A	434.12	PASS	AC=9;AF=0.00594;AN=1516;set=Intersection
22	38317930	.	C	T	361.76	PASS	AC=2;AF=0.00123;AN=1632;DS;set=Intersection
22	38317938	.	A	G	21829.71	PASS	AC=70;AF=0.04268;AN=1640;DS;set=Intersection
22	38318029	.	C	T	2837.03	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	38318039	.	C	T	95.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38318144	.	C	T	358.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38318176	.	G	A	745.04	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38318238	.	C	T	45.87	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	38318262	.	C	T	73.43	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	38318268	.	C	T	37.64	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	38318367	.	C	T	68.24	PASS	AC=1;AF=0.00078;AN=1286;set=Intersection
22	38318465	.	C	T	625.17	PASS	AC=29;AF=0.02433;AN=1192;set=Intersection
22	38320658	.	C	T	357.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38320673	.	T	G	672.02	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38320732	.	G	T	851.21	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38320753	.	C	T	148.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38321653	.	TC	T	49.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38321704	.	G	A	160.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38321806	.	C	T	5549.55	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	38321977	.	C	T	498.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38322014	.	C	T	1033.23	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38322090	.	C	T	80.48	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	38323458	.	G	A	695.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38323475	.	C	T	149.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38323483	.	G	A	2074.48	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38323507	.	G	T	79182.19	PASS	AC=301;AF=0.18309;AN=1644;DS;set=Intersection
22	38323554	.	C	T	1128.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38323611	.	C	T	10917.95	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	38323700	.	C	T	42528.84	PASS	AC=82;AF=0.04988;AN=1644;DS;set=Intersection
22	38323784	.	G	A	555.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38323847	.	C	T	760.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38327867	.	A	C	618.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38327893	.	G	C	1115.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38327894	.	T	C	757.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38327929	.	A	C	1888.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38327978	.	G	A	1187.26	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38328575	.	T	C	240.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38328597	.	A	G	13216.33	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	38328618	.	A	G	1287.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38328676	.	C	T	513.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38329072	.	G	A	487.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38333103	.	G	A	745.66	PASS	AC=5;AF=0.00347;AN=1440;DS;set=Intersection
22	38333177	.	A	G	1866.43	PASS	AC=2;AF=0.00137;AN=1456;DS;set=Intersection
22	38336713	.	C	T	1118.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38336720	.	C	A	1171.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38336794	.	A	G	596.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38336854	.	T	C	639.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38336868	.	C	G	945.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38340134	.	G	A	878.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38340167	.	G	A	15359.94	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	38340186	.	G	A	824.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38340452	.	C	T	287.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38340454	.	G	A	737.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38340508	.	CT	C	1134.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38340541	.	G	A	34009.96	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	38340573	.	G	A	644.14	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38341017	.	C	G	739.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38341038	.	C	G	1105.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38341124	.	T	G	51544.15	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	38341134	.	T	C	353948.05	PASS	AC=1244;AF=0.75669;AN=1644;DS;set=Intersection
22	38341225	.	C	A	1159.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38347490	.	C	A	2929.95	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	38347491	.	G	A	1363.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38349030	.	G	A	36344.11	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	38349068	.	C	G	601.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38349099	.	G	C	848.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38349162	.	G	T	666.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38352789	.	C	T	7987.77	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	38355317	.	C	T	871.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38355343	.	T	C	55693.23	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	38355403	.	C	T	1019.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38355531	.	A	G	1926.15	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38363096	.	A	G	8979.24	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	38363660	.	C	T	375.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38363671	.	A	G	935.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38369610	.	C	T	315.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38369658	.	C	T	142.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38369976	.	A	G	191558.24	PASS	AC=1154;AF=0.70195;AN=1644;DS;set=Intersection
22	38370078	.	G	A	558.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38370081	.	G	A	797.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38370156	.	C	T	856.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38370246	.	AGCAGGTTAGAG	A	5894.38	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	38373967	.	C	T	191.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38373997	.	C	T	331.67	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38374064	.	C	T	1125.51	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38379354	.	G	C	930.36	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	38379444	.	C	T	204	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38379543	.	G	A	10837.78	PASS	AC=46;AF=0.02805;AN=1640;DS;set=Intersection
22	38379585	.	G	A	269.16	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38379670	.	C	A	244.70	PASS	AC=3;AF=0.00192;AN=1560;DS;set=Intersection
22	38379774	.	G	A	230.24	PASS	AC=31;AF=0.1062;AN=292;set=Intersection
22	38455203	.	C	A	1086.66	PASS	AC=1;AF=0.00061;AN=1628;DS;set=Intersection
22	38460984	.	C	T	6511.52	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	38461038	.	C	T	925.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38461077	.	T	C	912.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38461153	.	G	A	1098.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38465026	.	TG	T	2491.36	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	38465029	.	C	T	2948.56	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	38465033	.	C	G	130.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38465034	.	G	A	366.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38465089	.	C	T	67.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38465116	.	C	T	790.17	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38466805	.	C	T	453.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38466882	.	C	T	377.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38466917	.	C	T	416.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38467655	.	G	A	920.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38467666	.	G	T	2263.55	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38467759	.	C	T	657.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38467784	.	G	C	219887.12	PASS	AC=1159;AF=0.70499;AN=1644;DS;set=Intersection
22	38468504	.	G	A	604.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38468578	.	C	T	1467.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38468617	.	G	A	922.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38468632	.	G	A	109910.99	PASS	AC=179;AF=0.10888;AN=1644;DS;set=Intersection
22	38468643	.	T	G	1906.71	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38468644	.	C	T	947.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38469048	.	G	A	1037.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38469081	.	C	T	462.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38470272	.	G	T	65.74	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38470427	.	G	C	203.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38470464	.	C	T	6540.36	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	38470467	.	C	T	260.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38470837	.	C	G	12602.12	PASS	AC=59;AF=0.03589;AN=1644;DS;set=Intersection
22	38470909	.	A	T	1150.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38470938	.	C	T	13362.89	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	38471068	.	G	A	978.98	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38471149	.	G	A	116.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38474359	.	CAA	C	4745.90	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	38474389	.	CCT	C	295.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38474406	.	C	T	2091.62	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38474450	.	TCGCCCCGGGCG	T	8590.37	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38474578	.	G	A	617.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38474662	.	G	A	700.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38474695	.	C	T	267.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38474696	.	A	G	234278.82	PASS	AC=1345;AF=0.81813;AN=1644;DS;set=Intersection
22	38474746	.	GTCCTGTGGGGTCC	G	597.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38474761	.	C	G	83.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38476827	.	C	G	244.34	PASS	AC=16;AF=0.01148;AN=1394;set=Intersection
22	38476946	.	C	T	49.79	PASS	AC=1;AF=0.00065;AN=1536;set=Intersection
22	38476989	.	G	C	838.19	PASS	AC=17;AF=0.01088;AN=1562;set=Intersection
22	38477070	.	C	T	563.84	PASS	AC=9;AF=0.00591;AN=1524;set=Intersection
22	38477106	.	C	T	1357.77	PASS	AC=18;AF=0.01306;AN=1378;set=Intersection
22	38477137	.	C	A	242.56	PASS	AC=7;AF=0.00503;AN=1392;set=Intersection
22	38477156	.	A	C	55.56	PASS	AC=1;AF=0.00070;AN=1420;set=Intersection
22	38477188	.	G	C	49.77	PASS	AC=1;AF=0.00069;AN=1442;set=Intersection
22	38477275	.	G	A	1088.04	PASS	AC=66;AF=0.04388;AN=1504;set=Intersection
22	38477342	.	T	A	7242.32	PASS	AC=632;AF=0.45599;AN=1386;set=Intersection
22	38477371	.	G	C	125.90	PASS	AC=7;AF=0.00622;AN=1126;set=Intersection
22	38477558	.	G	A	100.83	PASS	AC=7;AF=0.0100;AN=700;set=Intersection
22	38477589	.	G	T	253.45	PASS	AC=44;AF=0.0558;AN=788;set=Intersection
22	38477930	.	G	A	47253.38	PASS	AC=736;AF=0.45098;AN=1632;DS;set=Intersection
22	38477937	.	G	T	829	PASS	AC=5;AF=0.00308;AN=1626;DS;set=Intersection
22	38478071	.	C	T	46.85	PASS	AC=1;AF=0.00061;AN=1628;DS;set=Intersection
22	38478089	.	T	C	94.04	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	38478666	.	C	G	214.46	PASS	AC=5;AF=0.00321;AN=1556;set=Intersection
22	38478679	.	G	A	324.79	PASS	AC=6;AF=0.00383;AN=1566;set=Intersection
22	38478776	.	G	GA	371.41	PASS	AC=152;AF=0.09806;AN=1550;set=Intersection
22	38478875	.	G	T	216.94	PASS	AC=6;AF=0.00476;AN=1260;set=Intersection
22	38481287	.	G	A	2864.55	PASS	AC=37;AF=0.02510;AN=1474;DS;set=Intersection
22	38481291	.	G	A	992.48	PASS	AC=6;AF=0.00404;AN=1486;DS;set=Intersection
22	38481297	.	G	A	357.07	PASS	AC=2;AF=0.00133;AN=1500;DS;set=Intersection
22	38481303	.	C	T	378.13	PASS	AC=2;AF=0.00133;AN=1506;DS;set=Intersection
22	38481304	.	G	A	379.41	PASS	AC=4;AF=0.00264;AN=1514;DS;set=Intersection
22	38481311	.	C	A	528.11	PASS	AC=4;AF=0.00261;AN=1530;DS;set=Intersection
22	38481347	.	G	C	141.28	PASS	AC=1;AF=0.00065;AN=1532;DS;set=Intersection
22	38481387	.	A	G	867.95	PASS	AC=5;AF=0.00330;AN=1516;DS;set=Intersection
22	38481643	.	G	A	22649.83	PASS	AC=43;AF=0.03402;AN=1264;DS;set=Intersection
22	38481645	.	C	T	887.84	PASS	AC=1;AF=0.00078;AN=1290;DS;set=Intersection
22	38482214	.	C	T	178.79	PASS	AC=1;AF=0.00076;AN=1308;set=Intersection
22	38482255	.	G	A	1761.84	PASS	AC=9;AF=0.00669;AN=1346;set=Intersection
22	38482352	.	GTGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	G	10124.13	PASS	AC=105;AF=0.08550;AN=1228;set=Intersection
22	38482355	.	C	G	62.03	PASS	AC=12;AF=0.0123;AN=978;set=Intersection
22	38482409	.	C	T	193.13	PASS	AC=2;AF=0.00156;AN=1286;set=Intersection
22	38482426	.	G	A	210.10	PASS	AC=3;AF=0.00228;AN=1316;set=Intersection
22	38482449	.	G	T	76.31	PASS	AC=1;AF=0.00082;AN=1224;set=Intersection
22	38482491	.	T	C	298.42	PASS	AC=11;AF=0.00932;AN=1180;set=Intersection
22	38483155	.	T	TTCATGGGTG	53257.96	PASS	AC=395;AF=0.30573;AN=1292;set=Intersection
22	38483156	.	T	TCATGGGTGT	85245.55	PASS	AC=418;AF=0.31908;AN=1310;set=Intersection
22	38483171	.	G	A	2385.29	PASS	AC=33;AF=0.02515;AN=1312;DS;set=Intersection
22	38483174	.	A	ACATGGAGGT	6655.91	PASS	AC=119;AF=0.09029;AN=1318;DS;set=Intersection
22	38483189	.	A	AGGTCATGGG	7318.33	PASS	AC=55;AF=0.04179;AN=1316;DS;set=Intersection
22	38483195	.	T	TGGGGGTCAC	3698.10	PASS	AC=41;AF=0.03092;AN=1326;DS;set=Intersection
22	38483215	.	G	T	1272.20	PASS	AC=5;AF=0.00381;AN=1314;DS;set=Intersection
22	38483220	.	C	G	532.21	PASS	AC=1;AF=0.00076;AN=1310;DS;set=Intersection
22	38483222	.	C	T	401.90	PASS	AC=1;AF=0.00077;AN=1298;DS;set=Intersection
22	38483247	.	G	A	5381.32	PASS	AC=13;AF=0.00982;AN=1324;DS;set=Intersection
22	38484755	.	G	A	314.58	PASS	AC=2;AF=0.00177;AN=1128;set=Intersection
22	38485064	.	C	G	2030.52	PASS	AC=221;AF=0.3671;AN=602;set=Intersection
22	38485540	.	A	G	285.80	PASS	AC=50;AF=0.3521;AN=142;set=Intersection
22	38493026	.	C	A	151.01	PASS	AC=1;AF=0.00076;AN=1322;set=Intersection
22	38493078	.	G	C	52.55	PASS	AC=1;AF=0.00075;AN=1326;DS;set=Intersection
22	38493150	.	G	T	389.65	PASS	AC=1;AF=0.00072;AN=1388;DS;set=Intersection
22	38493187	.	TG	T	7758.60	PASS	AC=62;AF=0.04634;AN=1338;DS;set=Intersection
22	38493196	.	A	T	254.14	PASS	AC=1;AF=0.00077;AN=1302;DS;set=Intersection
22	38494032	.	G	A	183.21	PASS	AC=1;AF=0.00079;AN=1266;DS;set=Intersection
22	38494040	.	T	A	376.10	PASS	AC=1;AF=0.00077;AN=1292;DS;set=Intersection
22	38494394	.	G	T	1447.19	PASS	AC=5;AF=0.00383;AN=1304;DS;set=Intersection
22	38503847	.	C	T	274196	PASS	AC=1009;AF=0.79574;AN=1268;DS;set=Intersection
22	38503967	.	C	T	3204.78	PASS	AC=5;AF=0.00408;AN=1224;DS;set=Intersection
22	38503968	.	C	T	67107.96	PASS	AC=273;AF=0.22414;AN=1218;DS;set=Intersection
22	38504372	.	T	C	44367.13	PASS	AC=1074;AF=0.81241;AN=1322;DS;set=Intersection
22	38505100	.	G	A	7650.38	PASS	AC=26;AF=0.01743;AN=1492;DS;set=Intersection
22	38506509	.	A	G	99248.77	PASS	AC=1410;AF=1.00000;AN=1410;DS;set=Intersection
22	38506553	.	G	A	92.85	PASS	AC=1;AF=0.00069;AN=1442;DS;set=Intersection
22	38508172	.	G	C	2454.93	PASS	AC=8;AF=0.00488;AN=1640;DS;set=Intersection
22	38508249	.	G	A	5888.33	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	38508468	.	C	A,G,T	2510.86	PASS	AC=0,2,31;AF=0.00000,0.00123,0.01909;AN=1624;set=Intersection
22	38508625	.	C	G	405.83	PASS	AC=14;AF=0.01006;AN=1392;set=Intersection
22	38509647	.	C	G	1067.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38509668	.	G	A	474.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38511525	.	G	A	725.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38511570	.	G	A	234.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38511591	.	G	A	656.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38511690	.	TA	T	270.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38511696	.	C	T	91.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38512244	.	G	A	40500.51	PASS	AC=161;AF=0.09793;AN=1644;DS;set=Intersection
22	38516743	.	G	A	1813.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38516753	.	C	A	1503.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38516754	.	G	A	791.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38516783	.	C	T	940.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38516893	.	C	T	726.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38516900	.	G	A	783.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38516952	.	C	T	1059.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38519094	.	G	A	79.71	PASS	AC=1;AF=0.00065;AN=1540;DS;set=Intersection
22	38522344	.	T	C	528.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38522389	.	G	A	335.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38522424	.	G	A	966.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38524228	.	G	A	337.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38524260	.	G	A	350.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38524337	.	C	T	639.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38524338	.	G	A	84.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38524445	.	T	C	809.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38525561	.	G	A	58166.02	PASS	AC=72;AF=0.04380;AN=1644;DS;set=Intersection
22	38528888	.	C	T	313.01	PASS	AC=8;AF=0.00508;AN=1576;DS;set=Intersection
22	38528913	.	T	C	382.64	PASS	AC=1;AF=0.00063;AN=1596;DS;set=Intersection
22	38528943	.	C	T	554.78	PASS	AC=2;AF=0.00125;AN=1602;DS;set=Intersection
22	38528958	.	C	T	12778.14	PASS	AC=69;AF=0.04307;AN=1602;DS;set=Intersection
22	38530948	.	C	T	6478.06	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	38530955	.	C	T	1790.12	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	38530956	.	G	A	28425.20	PASS	AC=154;AF=0.09379;AN=1642;DS;set=Intersection
22	38530970	.	C	T	149.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38531036	.	G	A	316.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38535943	.	G	A	387.41	PASS	AC=1;AF=0.00061;AN=1630;DS;set=Intersection
22	38535946	.	G	A	26020.38	PASS	AC=444;AF=0.27239;AN=1630;DS;set=Intersection
22	38535954	.	G	A	15498.73	PASS	AC=71;AF=0.04345;AN=1634;DS;set=Intersection
22	38536013	.	G	A	247.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38539084	.	C	A	78006.96	PASS	AC=72;AF=0.04380;AN=1644;DS;set=Intersection
22	38539157	.	G	A	2220.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38541409	.	C	T	896.29	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	38541463	.	T	C	357.85	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38541545	.	G	C	784.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38541604	.	G	T	738.56	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38541681	.	A	G	261.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38541691	.	G	A	154.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38565209	.	G	A	46511.21	PASS	AC=123;AF=0.07482;AN=1644;DS;set=Intersection
22	38565215	.	C	CA	927.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38565247	.	T	C	1871.24	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38565262	.	C	T	12409.31	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	38565263	.	G	A	1287.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38565343	.	C	T	202.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38565347	.	C	T	44809.45	PASS	AC=112;AF=0.06813;AN=1644;DS;set=Intersection
22	38565395	.	G	A	735.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38565453	.	G	T	2225.31	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38565475	.	C	T	638.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38609876	.	C	G	7860.57	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	38609892	.	T	C	600.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38609901	.	G	A	412.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38617497	.	G	A	805.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38617522	.	C	T	689.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38617563	.	G	A	313.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38617570	.	C	T	1392.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38617704	.	G	C	12424.26	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	38617723	.	G	A	38999.96	PASS	AC=79;AF=0.04805;AN=1644;DS;set=Intersection
22	38620771	.	G	A	329.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38620846	.	G	A	222.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38620907	.	G	T	12372.71	PASS	AC=60;AF=0.03650;AN=1644;DS;set=Intersection
22	38620922	.	C	T	673.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38620930	.	G	A	153.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38621003	.	G	A	7015.82	PASS	AC=29;AF=0.01768;AN=1640;DS;set=Intersection
22	38621004	.	G	C	93.30	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	38621456	.	G	A	18181.26	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	38622871	.	G	A	2630.49	PASS	AC=10;AF=0.00610;AN=1640;DS;set=Intersection
22	38622905	.	TGGA	T	18193.25	PASS	AC=91;AF=0.05576;AN=1632;DS;set=Intersection
22	38626766	.	A	T	182.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38627306	.	A	G	1133.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38627339	.	G	A	8892.24	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	38627348	.	G	A	818.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38627384	.	T	A	939.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38641897	.	C	A	231.07	PASS	AC=2;AF=0.00132;AN=1520;DS;set=Intersection
22	38641898	.	C	A	230.23	PASS	AC=2;AF=0.00131;AN=1530;DS;set=Intersection
22	38641909	.	G	A	107.41	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	38641959	.	C	T	742.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38642038	.	G	A	8995.21	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	38642122	.	T	G	6074.07	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	38643800	.	C	T	8301.70	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	38643809	.	G	A	288.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38643992	.	T	C	32.17	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	38689279	.	A	G	1926.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38689281	.	T	C	1544.27	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38689284	.	G	A	771.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38689321	.	C	T	11411.07	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	38689336	.	TGGGGAGGGAGAGAG	T	688.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38690076	.	G	A	35.81	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	38690262	.	G	T	119.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38690281	.	CA	C	1445.32	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38690301	.	C	T	104.42	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	38694884	.	G	A	687.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38694909	.	C	T	1181.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38694966	.	A	G	917.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38694972	.	C	T	2884.53	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	38694980	.	C	G	294.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38695852	.	A	G	1069.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38695873	.	C	T	996.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38695931	.	C	T	2388.37	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38696113	.	T	C	2098.01	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38696696	.	G	A	890.36	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38696874	.	C	T	658.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38696901	.	G	A	26508.59	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	38696975	.	C	T	749.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38698820	.	T	C	861.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38698822	.	G	T	1288.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38698855	.	C	T	705.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38698856	.	G	A	1881.52	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38699050	.	GAGGC	G	90418.94	PASS	AC=1456;AF=0.88564;AN=1644;DS;set=Intersection
22	38699102	.	G	A	475.91	PASS	AC=5;AF=0.00305;AN=1642;DS;set=Intersection
22	38699120	.	G	A	7451.93	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	38710074	.	T	A	585.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38710112	.	G	A	19079.18	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	38822894	.	C	T	189.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38822905	.	C	T	45259.65	PASS	AC=71;AF=0.04319;AN=1644;DS;set=Intersection
22	38822923	.	C	T	962.22	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38822953	.	GGCC	G	152.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38822957	.	G	A	627.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38823019	.	G	A	136.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38823118	.	G	A	202.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38823136	.	T	C	147028.51	PASS	AC=1223;AF=0.74392;AN=1644;DS;set=Intersection
22	38823235	.	G	A	19273.32	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	38823436	.	G	A	308.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38823550	.	G	A	610	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38823592	.	C	T	859.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38823676	.	C	G	1418.85	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38823828	.	C	T	556.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38823838	.	C	T	2510.21	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	38823895	.	G	A	40061.38	PASS	AC=72;AF=0.04380;AN=1644;DS;set=Intersection
22	38823919	.	G	A	692.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38823948	.	C	T	835.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38824051	.	G	A	1089.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38864300	.	G	A	686.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38870580	.	C	G	805.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38875549	.	C	T	355962.07	PASS	AC=1528;AF=0.92944;AN=1644;DS;set=Intersection
22	38875632	.	A	G	971.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38875653	.	G	T	504.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38875664	.	G	A	971.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38875729	.	T	C	659.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38875735	.	C	A	1047.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38875736	.	TAC	T	1153.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38875806	.	C	G	1066.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38877179	.	G	A	1260.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38877184	.	G	T	1227.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38877231	.	C	A	817.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38877251	.	T	G	1254.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38877304	.	A	G	1999.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38877461	.	T	G	106930.95	PASS	AC=465;AF=0.28285;AN=1644;DS;set=Intersection
22	38881951	.	A	G	879.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38881979	.	G	A	6645.56	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	38882027	.	C	T	26787.31	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	38882187	.	C	G	594.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38882277	.	C	T	510.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38882330	.	T	C	719.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38883834	.	G	A	777.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38883854	.	T	C	844.68	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38883900	.	T	G	942.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38884017	.	G	T	960.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38888027	.	T	C	1105.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38888154	.	G	A	142.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38888166	.	A	G	556.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38889672	.	A	AG	520.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38890175	.	GTTA	G	1379.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38891022	.	G	A	168.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38891038	.	G	A	1531.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38891767	.	AAACT	A	1561.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38891981	.	G	GT	187.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38894182	.	C	T	1974.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38894186	.	C	T	7145.12	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	38895386	.	T	C	6178.41	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	38895460	.	C	T	2235.93	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38895521	.	AAAG	A	135300.49	PASS	AC=466;AF=0.28345;AN=1644;DS;set=Intersection
22	38897156	.	C	T	367.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38897319	.	T	C	861.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38902052	.	C	G	56.79	PASS	AC=1;AF=0.00063;AN=1584;set=Intersection
22	38902067	.	G	A	912.11	PASS	AC=9;AF=0.00566;AN=1590;set=Intersection
22	38902217	.	A	G	127.75	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	38915986	.	C	T	6444.18	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	38916076	.	A	G	943.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38916130	.	G	A	820.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38917703	.	A	G	1156.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	38934299	.	C	T	511.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38934334	.	G	T	973.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38934409	.	G	A	980.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38934461	.	G	A	5810.72	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38934497	.	ATAT	A	1113.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38934499	.	A	G	33370.20	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	38934515	.	C	G	73343.20	PASS	AC=114;AF=0.06934;AN=1644;DS;set=Intersection
22	38934606	.	T	C	60238.69	PASS	AC=51;AF=0.03102;AN=1644;DS;set=Intersection
22	38935297	.	C	T	1022.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38935313	.	A	G	1007.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38935406	.	C	T	697.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38935427	.	GCC	G	1229.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38945896	.	C	G	2469.07	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	38945898	.	A	G	840.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38945975	.	C	T	1593.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38948761	.	ATT	A	1385.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38951313	.	G	A	631.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38958260	.	G	A	58124.36	PASS	AC=114;AF=0.06934;AN=1644;DS;set=Intersection
22	38962551	.	A	C	18936.04	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	38962628	.	T	C	5428.55	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	38962767	.	A	G	678.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38963603	.	T	C	1078.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	38964167	.	G	A	326.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	38964181	.	T	C	851.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39066851	.	G	A	69391.21	PASS	AC=136;AF=0.08273;AN=1644;DS;set=Intersection
22	39066862	.	A	C	1111.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39066934	.	T	G	1273.36	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39067078	.	CAG	C	892.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39067083	.	G	A	753.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39067128	.	C	T	1161.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39067130	.	G	A	1883.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39067223	.	AG	A	1003.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39069181	.	T	C	105673.65	PASS	AC=501;AF=0.30474;AN=1644;DS;set=Intersection
22	39077967	.	C	T	377.85	PASS	AC=5;AF=0.00304;AN=1644;set=Intersection
22	39078022	.	C	T	85.61	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	39078330	.	A	G	1015.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39078421	.	C	T	1329.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39078948	.	T	G	282.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39079018	.	G	A	922.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39084930	.	T	G	841.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39084951	.	C	G	1021.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39085170	.	C	G	1210.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39085262	.	C	T	469.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39085276	.	T	C	1082.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39085285	.	G	A	1160.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39085434	.	C	A	2741.99	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39095769	.	A	T	1458.14	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39095776	.	G	C	736.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39095780	.	C	G	2343.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39095849	.	G	C	37329.21	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	39095873	.	G	A	1066.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39095882	.	G	C	882.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39095987	.	A	G	67398.28	PASS	AC=137;AF=0.08333;AN=1644;DS;set=Intersection
22	39104807	.	C	T	963.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39104896	.	G	C	955.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39112062	.	G	A	610.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39112138	.	G	T	1568.86	PASS	AC=5;AF=0.00308;AN=1624;DS;set=Intersection
22	39112834	.	A	T	846.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39112921	.	C	T	571.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39112996	.	C	T	8770.79	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39113021	.	C	T	310.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39113030	.	G	A	11500	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	39117881	.	C	T	7790.09	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	39120291	.	C	T	9977.84	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	39122038	.	C	T	71640.44	PASS	AC=137;AF=0.08333;AN=1644;DS;set=Intersection
22	39122197	.	A	G	417.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39123391	.	G	A	788.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39124185	.	T	C	3141.22	PASS	AC=7;AF=0.00429;AN=1630;DS;set=Intersection
22	39124191	.	G	A	2949.70	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39125428	.	C	T	778	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39125529	.	G	A	32719.03	PASS	AC=137;AF=0.08333;AN=1644;DS;set=Intersection
22	39125549	.	C	T	3036.49	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	39125559	.	C	T	356.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39125573	.	C	T	100.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39125692	.	C	T	62.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39125693	.	G	A	220.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39126748	.	C	G	287.94	PASS	AC=2;AF=0.00122;AN=1634;DS;set=Intersection
22	39132280	.	C	T	598.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39132281	.	G	A	421.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39132369	.	G	A	366.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39132412	.	G	T	158.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39134207	.	C	T	49248.19	PASS	AC=184;AF=0.11192;AN=1644;DS;set=Intersection
22	39134217	.	G	A	6551.75	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39134262	.	G	A	963.48	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39134279	.	A	G	647.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39134320	.	C	A	185.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39134551	.	C	T	367.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39134558	.	G	T	958.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39134699	.	G	T	433.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39134715	.	T	C	159320.50	PASS	AC=635;AF=0.38625;AN=1644;DS;set=Intersection
22	39134956	.	G	A	3202.73	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	39135019	.	G	A	1750.27	PASS	AC=9;AF=0.00548;AN=1642;DS;set=Intersection
22	39135307	.	G	C	246.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39135363	.	G	A	849.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39135454	.	C	T	9272.88	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	39135699	.	T	C	9750.28	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	39135783	.	C	T	509.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39135888	.	C	T	502.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39135933	.	G	A	3001.68	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39136272	.	G	A	1170.53	PASS	AC=11;AF=0.00671;AN=1640;set=Intersection
22	39136274	.	C	T	432.25	PASS	AC=3;AF=0.00183;AN=1640;set=Intersection
22	39136283	.	C	T	237.67	PASS	AC=5;AF=0.00305;AN=1640;set=Intersection
22	39136423	.	G	A	220.10	PASS	AC=2;AF=0.00123;AN=1624;set=Intersection
22	39137043	.	G	T	817.66	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	39137076	.	A	G	182.05	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	39137478	.	G	A	704.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39137484	.	C	T	856.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39137513	.	C	T	2186.16	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39137617	.	G	A	736.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39138331	.	C	T	1922.52	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39138332	.	G	A	35774.22	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	39138376	.	T	C	496.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39138389	.	G	T	136.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39138399	.	G	A	840.80	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39141641	.	A	G	1268.32	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39141668	.	C	T	528.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39141702	.	G	A	1065.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39141729	.	T	C	2295.69	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39141766	.	C	T	949.21	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39141778	.	G	A	76.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39144747	.	G	A	11979.14	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39144768	.	G	A	695.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39144787	.	G	T	922.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39144807	.	C	T	1481.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39145721	.	C	T	1656.86	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	39145749	.	G	A	77.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39145750	.	C	T	79.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39145765	.	G	A	763.01	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39145816	.	C	T	629.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39145900	.	G	A	60.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39146265	.	G	A	2284.60	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39146275	.	C	T	539.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39146279	.	G	A	1226.04	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39146283	.	C	T	530.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39146314	.	C	T	271.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39146330	.	G	A	189.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39146886	.	G	A	4494.80	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39146907	.	G	A	468.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39146965	.	C	T	829.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39147166	.	G	A	343.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39147192	.	G	A	549.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39147197	.	G	A	776.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39147225	.	G	A	883.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39147235	.	A	C	28124.40	PASS	AC=89;AF=0.05414;AN=1644;DS;set=Intersection
22	39147346	.	C	T	2782.03	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39148475	.	G	A	9385.03	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39148483	.	G	A	114733.52	PASS	AC=557;AF=0.33881;AN=1644;DS;set=Intersection
22	39148537	.	T	C	30258.96	PASS	AC=85;AF=0.05170;AN=1644;DS;set=Intersection
22	39148588	.	C	T	146.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39148589	.	G	A	411.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39148606	.	G	A	324.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39148608	.	G	A	151.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39175438	.	G	C	298.80	PASS	AC=4;AF=0.00248;AN=1614;DS;set=Intersection
22	39176886	.	G	A	15268.39	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	39176911	.	G	A	175.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39176976	.	C	A	1645.04	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39178637	.	G	A	2630.69	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39178701	.	A	G	206655.76	PASS	AC=663;AF=0.40328;AN=1644;DS;set=Intersection
22	39218572	.	C	T	72.91	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	39218662	.	A	G	2393.52	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39218763	.	C	T	842.86	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39218764	.	G	A	5054.89	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	39218819	.	A	G	294.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39219069	.	A	G	5386.30	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	39219172	.	G	A	4366.87	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39219213	.	C	T	92.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39222502	.	T	C	518.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39222512	.	T	C	455.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39222589	.	G	A	7605.88	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	39222598	.	G	A	7775.23	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	39222627	.	G	A	891.44	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39222635	.	A	G	595.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39222652	.	G	A	163179.40	PASS	AC=780;AF=0.47445;AN=1644;DS;set=Intersection
22	39222661	.	G	T	900.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39222771	.	G	C	5469.40	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	39222796	.	G	A	528.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39224248	.	T	C	241541.64	PASS	AC=1123;AF=0.68309;AN=1644;DS;set=Intersection
22	39224312	.	C	T	657.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39224357	.	C	T	1167.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39224383	.	A	G	5274.36	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39224453	.	C	T	396.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39224491	.	G	A	367.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39262225	.	C	G	266.60	PASS	AC=3;AF=0.00183;AN=1642;set=Intersection
22	39262240	.	C	T	430.51	PASS	AC=3;AF=0.00183;AN=1642;set=Intersection
22	39262378	.	G	A	215.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39262411	.	C	T	411.97	PASS	AC=4;AF=0.00245;AN=1632;DS;set=Intersection
22	39262466	.	C	A	4996.65	PASS	AC=25;AF=0.01559;AN=1604;DS;set=Intersection
22	39262577	.	G	A	795.07	PASS	AC=4;AF=0.00255;AN=1570;set=Intersection
22	39262730	.	G	C	234.66	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	39262739	.	C	T	35.08	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	39262740	.	G	C	34.68	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	39262793	.	C	T	42.10	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	39262800	.	C	T	188.62	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	39262852	.	T	C	140.53	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	39263032	.	C	G	78.76	PASS	AC=1;AF=0.00062;AN=1614;set=Intersection
22	39263050	.	G	C	473.91	PASS	AC=4;AF=0.00248;AN=1616;set=Intersection
22	39263162	.	G	A	110.71	PASS	AC=1;AF=0.00064;AN=1560;set=Intersection
22	39267453	.	A	T	580.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39267515	.	C	T	2491.10	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39267653	.	G	A	80.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39267670	.	C	A	4143.88	PASS	AC=8;AF=0.00487;AN=1642;DS;set=Intersection
22	39267688	.	A	G	97.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39267876	.	C	G	92.23	PASS	AC=1;AF=0.00063;AN=1586;set=Intersection
22	39353680	.	C	G	12633.07	PASS	AC=31;AF=0.01888;AN=1642;DS;set=Intersection
22	39353743	.	G	A	507.11	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	39353754	.	C	T	198.06	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	39355501	.	C	T	754.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39355572	.	A	G	39910.56	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	39355631	.	G	A	6205.15	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39355632	.	C	T	796.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39355717	.	G	A	248639.76	PASS	AC=1282;AF=0.77981;AN=1644;DS;set=Intersection
22	39358069	.	G	A	734.46	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39378441	.	G	A	786.17	PASS	AC=1;AF=0.00063;AN=1588;DS;set=Intersection
22	39378446	.	T	TAA	9889.72	PASS	AC=8;AF=0.00504;AN=1588;DS;set=Intersection
22	39378459	.	A	G	526.69	PASS	AC=1;AF=0.00063;AN=1588;DS;set=Intersection
22	39378523	.	CT	C	669.91	PASS	AC=2;AF=0.00126;AN=1582;DS;set=Intersection
22	39380066	.	TC	T	2745.70	PASS	AC=3;AF=0.00189;AN=1586;DS;set=Intersection
22	39380218	.	AG	A	1254.33	PASS	AC=1;AF=0.00063;AN=1584;DS;set=Intersection
22	39382079	.	C	A	296211.51	PASS	AC=1499;AF=0.95114;AN=1576;DS;set=Intersection
22	39382081	.	A	G	7712.68	PASS	AC=7;AF=0.00444;AN=1576;DS;set=Intersection
22	39382255	.	G	A	8010.57	PASS	AC=7;AF=0.00443;AN=1580;DS;set=Intersection
22	39382348	.	A	C	1954.87	PASS	AC=2;AF=0.00126;AN=1586;DS;set=Intersection
22	39382376	.	A	C	2026.11	PASS	AC=5;AF=0.00316;AN=1584;DS;set=Intersection
22	39382387	.	T	C	782.59	PASS	AC=1;AF=0.00063;AN=1588;DS;set=Intersection
22	39382414	.	T	C	35659.66	PASS	AC=38;AF=0.02396;AN=1586;DS;set=Intersection
22	39382418	.	G	A	770.15	PASS	AC=1;AF=0.00063;AN=1586;DS;set=Intersection
22	39382443	.	A	G	509.68	PASS	AC=1;AF=0.00063;AN=1582;DS;set=Intersection
22	39382447	.	C	G	435.09	PASS	AC=1;AF=0.00063;AN=1582;DS;set=Intersection
22	39385422	.	G	A,T	2624.92	PASS	AC=1,4;AF=0.00063,0.00253;AN=1580;DS;set=Intersection
22	39385423	.	A	C	3041.58	PASS	AC=4;AF=0.00253;AN=1580;DS;set=Intersection
22	39385463	.	T	C	4243.48	PASS	AC=4;AF=0.00253;AN=1584;DS;set=Intersection
22	39385510	.	T	C	16401.93	PASS	AC=22;AF=0.01391;AN=1582;DS;set=Intersection
22	39385622	.	G	A,C,T	1426.55	PASS	AC=2,1,1;AF=0.00126,0.00063,0.00063;AN=1582;DS;set=Intersection
22	39385639	.	C	T	484.95	PASS	AC=2;AF=0.00126;AN=1582;DS;set=Intersection
22	39385663	.	G	A	17724.19	PASS	AC=85;AF=0.05380;AN=1580;DS;set=Intersection
22	39387395	.	TG	T	3926.42	PASS	AC=19;AF=0.01305;AN=1456;DS;set=Intersection
22	39388010	.	C	T	1582.84	PASS	AC=4;AF=0.00253;AN=1580;DS;set=Intersection
22	39388046	.	G	C	1107.98	PASS	AC=3;AF=0.00189;AN=1586;DS;set=Intersection
22	39388163	.	T	C	743.05	PASS	AC=1;AF=0.00062;AN=1608;DS;set=Intersection
22	39410388	.	C	T	726.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39411555	.	C	T	1233.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39411619	.	T	C	907.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39411696	.	C	T	1743.89	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39411711	.	G	C	996	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39411738	.	G	A	558.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39413744	.	CCT	C	5409.41	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39413748	.	T	C	1710.79	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39413782	.	G	C	949.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39413784	.	C	T	595.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39413824	.	C	T	849.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39413871	.	C	T	841.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39414026	.	G	A	919.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39414042	.	A	C	715.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39414087	.	G	A	54195.09	PASS	AC=59;AF=0.03589;AN=1644;DS;set=Intersection
22	39414090	.	A	T	566.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39414224	.	A	G	199383.72	PASS	AC=1079;AF=0.65633;AN=1644;DS;set=Intersection
22	39414240	.	G	A	94045.08	PASS	AC=320;AF=0.19465;AN=1644;DS;set=Intersection
22	39414282	.	T	C	899.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39414382	.	G	T	26000.78	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	39414439	.	A	G	7519.14	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	39417547	.	G	A	765.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39417553	.	C	CACTAT	14192.22	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39417573	.	TC	T	268.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39417583	.	TC	T	31813	PASS	AC=59;AF=0.03589;AN=1644;DS;set=Intersection
22	39421109	.	GCTT	G	3930.72	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39421112	.	T	G	738.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421118	.	C	T	710.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421122	.	G	C	1103.67	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39421136	.	G	C	1013.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421153	.	C	T	18324.53	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	39421201	.	G	A	1357.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39421240	.	G	A	792.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421367	.	G	C	608.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421382	.	T	C	1001.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421383	.	G	A	1037.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421512	.	A	G	2465.67	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39421526	.	G	A	1015.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421564	.	T	A	1022.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421586	.	T	G	1158.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421592	.	G	A	831.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421595	.	A	G	849.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421607	.	C	A	1137.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39421612	.	A	G	1564.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39421622	.	A	G	1002.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421701	.	C	T	891.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421706	.	C	G	868.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39421715	.	C	T	1015.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39425328	.	G	A	11633.80	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	39425438	.	C	A	758.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39425443	.	C	A	1176.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39425474	.	A	G	1002.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39425505	.	G	A	35696.97	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	39425510	.	G	C	929.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39428289	.	C	A	605.67	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39428305	.	G	A	1125.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39428331	.	C	A	508.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39440149	.	C	T	124537.30	PASS	AC=861;AF=0.52628;AN=1636;DS;set=Intersection
22	39440176	.	A	T	2501.31	PASS	AC=17;AF=0.01037;AN=1640;DS;set=Intersection
22	39440199	.	G	T	1685.09	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	39440236	.	A	C	77.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39440271	.	G	A	188.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39441203	.	C	T	191634.81	PASS	AC=976;AF=0.59367;AN=1644;DS;set=Intersection
22	39441243	.	CAG	C	8280.20	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	39441383	.	G	C	2202.35	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39441399	.	C	G	888.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39441449	.	G	T	690.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39441451	.	A	G	893.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39441478	.	C	A	9623.27	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	39441570	.	A	G	824.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39445380	.	G	A	205553.07	PASS	AC=865;AF=0.52616;AN=1644;DS;set=Intersection
22	39445421	.	T	C	874.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39445436	.	G	A	18054.90	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	39445449	.	T	A	892.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39445554	.	G	A	245969.68	PASS	AC=864;AF=0.52555;AN=1644;DS;set=Intersection
22	39445556	.	C	T	1057.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39448336	.	C	T	4801.49	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39448615	.	A	G	4710.09	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39448695	.	G	A	1835.30	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39448711	.	C	A	232276.14	PASS	AC=889;AF=0.54075;AN=1644;DS;set=Intersection
22	39448750	.	T	C	213676.22	PASS	AC=891;AF=0.54197;AN=1644;DS;set=Intersection
22	39476946	.	C	T	379.16	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39476982	.	C	T	849.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39477120	.	C	T	1459.93	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39477123	.	T	C	133769.21	PASS	AC=508;AF=0.30900;AN=1644;DS;set=Intersection
22	39477173	.	G	A	2187.53	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39477252	.	G	A	8610.67	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	39477438	.	C	G	1330.63	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39477455	.	G	T	918.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39477566	.	A	G	116769.69	PASS	AC=197;AF=0.11983;AN=1644;DS;set=Intersection
22	39477616	.	G	T	4563.95	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39479729	.	T	C	630.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39479742	.	G	A	1152.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39482267	.	C	T	39912.83	PASS	AC=88;AF=0.05353;AN=1644;DS;set=Intersection
22	39482314	.	C	T	1234.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39482315	.	G	A	5934.98	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39482359	.	C	G	1085.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39482371	.	C	G	44301.84	PASS	AC=88;AF=0.05353;AN=1644;DS;set=Intersection
22	39482461	.	G	A	489.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39482536	.	G	A	703.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39482595	.	G	A	754.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39482970	.	C	G,T	1305.32	PASS	AC=1,1;AF=0.00061,0.00061;AN=1644;DS;set=Intersection
22	39482982	.	G	A	594.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39483102	.	C	T	7971.52	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39483155	.	A	G	659.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39483165	.	C	T	503.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39483399	.	C	T	646.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39483432	.	G	A	10111.78	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	39483459	.	A	T	9413.07	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	39496322	.	TAAC	T	114860	PASS	AC=497;AF=0.30231;AN=1644;DS;set=Intersection
22	39496336	.	G	T	90647.46	PASS	AC=336;AF=0.20438;AN=1644;DS;set=Intersection
22	39496357	.	C	G	2079.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39496364	.	G	A	1209.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39496412	.	G	C	242604.26	PASS	AC=768;AF=0.46715;AN=1644;DS;set=Intersection
22	39497268	.	T	C	803.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39497300	.	A	G	714.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39497303	.	C	T	515.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39497389	.	G	C	1559.19	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39497404	.	G	C	178148.49	PASS	AC=776;AF=0.47202;AN=1644;DS;set=Intersection
22	39497406	.	C	T	7030.71	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	39497412	.	C	A,T	4214.02	PASS	AC=1,4;AF=0.00061,0.00243;AN=1644;DS;set=Intersection
22	39497452	.	A	G	246639.65	PASS	AC=784;AF=0.47689;AN=1644;DS;set=Intersection
22	39497454	.	G	C	219089.97	PASS	AC=784;AF=0.47689;AN=1644;DS;set=Intersection
22	39497509	.	A	G	255470.67	PASS	AC=1644;AF=1.00000;AN=1644;DS;set=Intersection
22	39497549	.	C	T	7456.90	PASS	AC=71;AF=0.04319;AN=1644;DS;set=Intersection
22	39497902	.	G	T	1048.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39497952	.	G	A	686.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39498038	.	G	C	203923.90	PASS	AC=774;AF=0.47080;AN=1644;DS;set=Intersection
22	39498075	.	C	T	145.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39499653	.	C	T	319198.66	PASS	AC=764;AF=0.46472;AN=1644;DS;set=Intersection
22	39499698	.	C	A	788.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39529880	.	G	A	558.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39529935	.	T	C	1972.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39530409	.	C	T	75.01	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	39530426	.	G	A	38.16	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	39530461	.	G	A	157.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39530475	.	G	C	182.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39530494	.	C	CCGT	533.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39530539	.	C	T	216.41	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	39537456	.	G	C	1127.18	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39537468	.	T	TTGGGGC	548.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39545758	.	G	GCAGA	8308.40	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	39545759	.	CAG	C	1184.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39545788	.	G	A	1801.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39545829	.	G	C	920.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39621704	.	CCA	C	7060.61	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	39621754	.	C	T	1104.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39621797	.	G	T	10014.95	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	39621819	.	G	A	1092.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39621882	.	C	T	978.49	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39621893	.	T	C	6656.34	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	39626262	.	G	A	671.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39627630	.	G	C	877.77	PASS	AC=26;AF=0.01599;AN=1626;set=Intersection
22	39627821	.	T	C	100.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39629406	.	T	C	194.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39629415	.	C	A	265.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39629418	.	T	C	20334.90	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	39629478	.	C	T	646.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39629561	.	G	A	250.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39629575	.	C	G	456.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39631747	.	C	G	9997.52	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	39631768	.	G	T	15293.95	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	39631786	.	C	T	873.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39631788	.	G	A	764.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39636829	.	A	T	5154.52	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39636853	.	T	C	1225	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39636923	.	TGC	T,TGCGCGC	214741.30	PASS	AC=641,814;AF=0.38990,0.49513;AN=1644;DS;set=Intersection
22	39636924	.	GCGCA	G	13516.53	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	39636926	.	GCACA	G,GCA,GCACACACA	99546.17	PASS	AC=909,93,300;AF=0.55292,0.05657,0.18248;AN=1644;DS;set=Intersection
22	39639934	.	C	A	345.83	PASS	AC=4;AF=0.00244;AN=1640;set=Intersection
22	39708899	.	A	G	9496.38	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39708926	.	G	A	2281.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39708965	.	C	T	5814.76	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	39708996	.	GGA	G	1564.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39709003	.	G	C	401.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39709009	.	G	A	154735.97	PASS	AC=501;AF=0.30474;AN=1644;DS;set=Intersection
22	39709030	.	G	A	2111.34	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39709146	.	G	A	41.90	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	39709605	.	G	A	97509.68	PASS	AC=128;AF=0.07786;AN=1644;DS;set=Intersection
22	39709748	.	A	G	2124.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39709751	.	G	A	2046.13	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39709759	.	A	ACAGGCCCAGCAC	12780.93	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39709776	.	T	C	169427.31	PASS	AC=526;AF=0.31995;AN=1644;DS;set=Intersection
22	39710062	.	A	G	6439.30	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39710104	.	T	TTAC	1140.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39710145	.	G	A	5529.01	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39710211	.	A	G	43747.02	PASS	AC=47;AF=0.02859;AN=1644;DS;set=Intersection
22	39710244	.	G	A	123511.37	PASS	AC=527;AF=0.32056;AN=1644;DS;set=Intersection
22	39710664	.	C	T	9112.89	PASS	AC=68;AF=0.04136;AN=1644;DS;set=Intersection
22	39710721	.	G	C	716.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39710793	.	G	A	1305.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39710867	.	A	G	5334.88	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39711351	.	A	G	221946.48	PASS	AC=558;AF=0.33942;AN=1644;DS;set=Intersection
22	39711362	.	C	CTT	5639.20	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39711495	.	A	G	2430.65	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39711504	.	G	A	2197.84	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39711574	.	G	GAC	1943.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39712776	.	G	A	1200.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39713419	.	CAGCTCCCA	C	50544.89	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	39713638	.	C	CA	2254.84	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39714394	.	T	C	16630.60	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	39714580	.	G	A	7570.05	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	39714606	.	G	GA	848.48	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39715592	.	A	G	304.09	PASS	AC=1;AF=0.00062;AN=1612;DS;set=Intersection
22	39715593	.	C	G	318.17	PASS	AC=1;AF=0.00062;AN=1610;DS;set=Intersection
22	39715606	.	G	A	1268.34	PASS	AC=4;AF=0.00250;AN=1600;DS;set=Intersection
22	39715608	.	C	T	828.67	PASS	AC=7;AF=0.00436;AN=1604;DS;set=Intersection
22	39715639	.	C	T	87.19	PASS	AC=1;AF=0.00062;AN=1620;DS;set=Intersection
22	39760172	.	G	A	29635.31	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	39760211	.	A	C	710.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39760267	.	C	A	441.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39760275	.	A	G	4923.80	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	39760314	.	T	TTTAC	116389.73	PASS	AC=80;AF=0.04866;AN=1644;DS;set=Intersection
22	39760344	.	C	G	1437.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39770380	.	C	T	850.76	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39770500	.	G	A	5368.08	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39770507	.	A	G	803.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39770512	.	C	T	711.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39770597	.	A	G	142398.67	PASS	AC=1207;AF=0.73418;AN=1644;DS;set=Intersection
22	39772029	.	T	C	70482.90	PASS	AC=64;AF=0.03893;AN=1644;DS;set=Intersection
22	39772051	.	C	T	908.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39772094	.	C	T	2286.16	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39772109	.	G	A	935.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39772181	.	C	G	3147.16	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39772220	.	G	C	56249.59	PASS	AC=64;AF=0.03893;AN=1644;DS;set=Intersection
22	39773624	.	G	A	334.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39773740	.	C	T	1082.22	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39777666	.	C	T	1126.14	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39777680	.	C	T	1203.83	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	39777788	.	G	C	254.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39777821	.	C	CCCA	95178.90	PASS	AC=1353;AF=0.82299;AN=1644;DS;set=Intersection
22	39777822	.	C	CCAA	179896.67	PASS	AC=1354;AF=0.82360;AN=1644;DS;set=Intersection
22	39777824	.	A	AACC	102982.73	PASS	AC=1346;AF=0.81873;AN=1644;DS;set=Intersection
22	39777880	.	C	T	441.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39777886	.	C	T	183.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39795772	.	C	CG	308.67	PASS	AC=3;AF=0.00193;AN=1558;DS;set=Intersection
22	39795800	.	C	T	1042.76	PASS	AC=4;AF=0.00252;AN=1588;DS;set=Intersection
22	39795847	.	A	G	316.40	PASS	AC=1;AF=0.00062;AN=1610;DS;set=Intersection
22	39795852	.	G	A	674.74	PASS	AC=5;AF=0.00313;AN=1600;DS;set=Intersection
22	39795855	.	C	T	128.37	PASS	AC=1;AF=0.00063;AN=1600;DS;set=Intersection
22	39795866	.	C	T	32.21	PASS	AC=1;AF=0.00063;AN=1596;DS;set=Intersection
22	39810972	.	C	T	600.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39810974	.	C	T	440.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39811081	.	G	A	338.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39811120	.	C	T	155.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39811185	.	T	A	2164.33	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39811485	.	C	G	1988.34	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39811541	.	C	T	726.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39811589	.	C	T	515.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39811645	.	G	A	861.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39811687	.	A	T	4786.35	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39811704	.	C	T	327.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39812769	.	C	G	15976.43	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	39812791	.	C	T	11889.86	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	39813705	.	G	A	1141.18	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39813741	.	C	T	2904.44	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39813759	.	T	C	24202.04	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	39813793	.	G	A	617.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39813820	.	C	T	892.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39813844	.	C	T	2905.13	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39814746	.	G	A	881.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39814765	.	G	C	9822.72	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	39814843	.	G	A	3071.05	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39814872	.	G	A	501.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39814886	.	A	G	346.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39815516	.	CTCCG	C	1477.35	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39815519	.	C	T	2621.73	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39815564	.	T	G	985.67	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39815646	.	G	A	1999.67	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39815651	.	G	A	922.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39822659	.	C	A	880.25	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39822665	.	C	T	568.94	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39822691	.	C	T	380.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39822699	.	C	T	1221.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39822701	.	C	T	1239.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39822748	.	C	A	455.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39822761	.	A	G	930.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39822851	.	C	T	11747.83	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	39822889	.	C	T	1996.29	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39822938	.	T	C	410.26	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39822949	.	C	G	2260.47	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39822972	.	C	T	167.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39822980	.	C	T	319.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39824055	.	G	C	1102.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39824171	.	C	G	500.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39826056	.	G	A	1080.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39826100	.	G	A	747.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39826104	.	C	T	5971.84	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	39826111	.	G	A	869.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39826125	.	G	A	585.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39826137	.	C	T	677.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39826250	.	A	G	1783.30	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39832609	.	G	A	2025.24	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	39883344	.	T	C	120914.04	PASS	AC=236;AF=0.14355;AN=1644;DS;set=Intersection
22	39883384	.	T	C	765.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39883434	.	A	T	798.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39883448	.	C	CA	1258.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39883517	.	G	T	2803.10	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39883525	.	C	T	428.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39883564	.	G	A	537.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39883604	.	G	T	2869.72	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39883605	.	C	T	2546.27	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39883629	.	C	G	298.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39883736	.	G	C	16057.30	PASS	AC=160;AF=0.09816;AN=1630;DS;set=Intersection
22	39883927	.	A	C	116.41	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	39884279	.	C	T	1527.25	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39884315	.	C	T	799.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39884357	.	C	G	1832.25	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	39884393	.	G	A	5257.67	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39884498	.	C	G	305.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39884582	.	C	T	798.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39884623	.	C	A	381.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39884847	.	G	C	702.51	PASS	AC=6;AF=0.00366;AN=1640;set=Intersection
22	39884878	.	C	T	54.20	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	39884906	.	C	G	245.72	PASS	AC=3;AF=0.00186;AN=1614;set=Intersection
22	39884910	.	G	A	126.79	PASS	AC=1;AF=0.00062;AN=1624;set=Intersection
22	39884925	.	C	T	106.27	PASS	AC=1;AF=0.00062;AN=1606;set=Intersection
22	39884942	.	G	A	729.61	PASS	AC=20;AF=0.01238;AN=1616;set=Intersection
22	39884987	.	C	T	93	PASS	AC=1;AF=0.00064;AN=1564;set=Intersection
22	39907368	.	G	A	1246.67	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	39907422	.	C	T	1334.38	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39907906	.	C	T	1083.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39907916	.	G	A	891.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39907917	.	A	T	873.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39907934	.	C	T	12286.11	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	39907941	.	G	C	18645.24	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	39907975	.	C	T	22784.73	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	39908249	.	C	T	703.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39908255	.	G	A	1308.37	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39908419	.	C	T	5236.28	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	39909600	.	G	A	785.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39909614	.	T	C	872.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39909722	.	C	T	21208.21	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	39909726	.	G	A	873.60	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39909787	.	A	G	743.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39909821	.	C	T	944.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39909836	.	G	A	1050.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39909847	.	G	A	5420.65	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	39909907	.	T	C	1589.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39909922	.	G	A	687.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39909963	.	C	T	610.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39909968	.	G	A	1102.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39910064	.	T	A	748.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39910106	.	C	T	910.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39910113	.	G	C	1151.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39910228	.	A	G	814.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39910268	.	C	T	1768.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39910324	.	C	T	663.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39917515	.	A	C	87709.85	PASS	AC=401;AF=0.24392;AN=1644;DS;set=Intersection
22	39917584	.	A	T	586.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39917587	.	C	T	1831.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39917725	.	C	T	4607.72	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	39917753	.	G	T	22496.85	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	39917768	.	TG	T	1239.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39917791	.	C	T	2812.27	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39917944	.	T	C	2819.66	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39917952	.	C	T	795.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39917955	.	C	T	9566.03	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	39917960	.	A	T	880.83	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39918036	.	C	T	769.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39918057	.	T	A	745.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39918323	.	C	G	11207.28	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	39918625	.	C	T	1187.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39918642	.	A	G	1155.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39925564	.	T	G	429.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39925565	.	T	C	475.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39925642	.	G	C	1151.35	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39925797	.	G	A	706.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39925806	.	T	C	7393.42	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	39925840	.	C	T	467.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39925898	.	C	T	648.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39925958	.	C	T	332.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39925960	.	C	T	186.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39928516	.	G	A	614.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39928517	.	G	A	9738.03	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	39928547	.	G	A	1341.25	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	39928558	.	G	A	690.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	39928569	.	G	A	483.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	39928738	.	G	A	944.07	PASS	AC=17;AF=0.01102;AN=1542;set=Intersection
22	39966777	.	C	T	13244.65	PASS	AC=42;AF=0.03079;AN=1364;set=Intersection
22	39966856	.	C	T	78849.36	PASS	AC=561;AF=0.39563;AN=1418;DS;set=Intersection
22	39994293	.	C	CGCCCT	7890.14	PASS	AC=580;AF=0.48495;AN=1196;set=Intersection
22	39996692	.	T	C	753.05	PASS	AC=5;AF=0.00399;AN=1252;DS;set=Intersection
22	40015321	.	C	T	1716.95	PASS	AC=3;AF=0.00211;AN=1420;DS;set=Intersection
22	40030520	.	T	C	4482.68	PASS	AC=5;AF=0.00338;AN=1480;DS;set=Intersection
22	40030565	.	C	T	803.17	PASS	AC=1;AF=0.00065;AN=1532;DS;set=Intersection
22	40030685	.	G	A	1676.77	PASS	AC=2;AF=0.00131;AN=1522;DS;set=Intersection
22	40030766	.	A	G	583.63	PASS	AC=1;AF=0.00067;AN=1498;DS;set=Intersection
22	40036825	.	G	A	385.41	PASS	AC=1;AF=0.00076;AN=1310;set=Intersection
22	40036908	.	G	A	731.62	PASS	AC=2;AF=0.00148;AN=1348;set=Intersection
22	40036950	.	C	T	657.68	PASS	AC=2;AF=0.00156;AN=1282;DS;set=Intersection
22	40036959	.	G	A	406.91	PASS	AC=1;AF=0.00078;AN=1286;DS;set=Intersection
22	40037036	.	A	G	439.79	PASS	AC=1;AF=0.00080;AN=1254;DS;set=Intersection
22	40037051	.	G	A	1297.54	PASS	AC=4;AF=0.00317;AN=1262;DS;set=Intersection
22	40037222	.	T	C	902.29	PASS	AC=1;AF=0.00080;AN=1250;DS;set=Intersection
22	40038776	.	G	A	31.02	PASS	AC=1;AF=0.00066;AN=1518;set=Intersection
22	40038911	.	C	G	984.25	PASS	AC=10;AF=0.00695;AN=1438;set=Intersection
22	40042711	.	C	T	109.31	PASS	AC=2;AF=0.00153;AN=1308;set=Intersection
22	40042714	.	G	A	108.72	PASS	AC=1;AF=0.00077;AN=1298;set=Intersection
22	40042720	.	C	T	427.35	PASS	AC=5;AF=0.00385;AN=1298;set=Intersection
22	40042840	.	G	T	80.34	PASS	AC=2;AF=0.00193;AN=1036;set=Intersection
22	40043812	.	A	G	127095.18	PASS	AC=678;AF=0.57751;AN=1174;DS;set=Intersection
22	40043867	.	C	T	6748.27	PASS	AC=9;AF=0.00787;AN=1144;DS;set=Intersection
22	40043877	.	C	A	1967.32	PASS	AC=3;AF=0.00260;AN=1152;DS;set=Intersection
22	40043909	.	T	C	285.11	PASS	AC=1;AF=0.00085;AN=1178;DS;set=Intersection
22	40045537	.	G	A	32.74	PASS	AC=1;AF=0.00090;AN=1114;set=Intersection
22	40045588	.	C	T	92.22	PASS	AC=4;AF=0.00372;AN=1074;set=Intersection
22	40045654	.	G	A	507.19	PASS	AC=16;AF=0.01309;AN=1222;set=Intersection
22	40045685	.	G	A	211.20	PASS	AC=4;AF=0.00302;AN=1324;set=Intersection
22	40045718	.	G	T	201.83	PASS	AC=1;AF=0.00073;AN=1362;set=Intersection
22	40045841	.	G	C	192.55	PASS	AC=1;AF=0.00070;AN=1428;DS;set=Intersection
22	40045915	.	C	T	321.17	PASS	AC=1;AF=0.00072;AN=1386;DS;set=Intersection
22	40045924	.	C	T	250.26	PASS	AC=1;AF=0.00072;AN=1382;DS;set=Intersection
22	40054285	.	C	T	1263.78	PASS	AC=3;AF=0.00217;AN=1384;DS;set=Intersection
22	40054335	.	G	A	1933.04	PASS	AC=5;AF=0.00377;AN=1328;DS;set=Intersection
22	40054347	.	G	A	126.02	PASS	AC=1;AF=0.00076;AN=1308;DS;set=Intersection
22	40054907	.	T	A	45.52	PASS	AC=1;AF=0.00062;AN=1616;set=Intersection
22	40054925	.	C	T	112.68	PASS	AC=1;AF=0.00062;AN=1604;set=Intersection
22	40054948	.	T	C	44014.02	PASS	AC=1181;AF=0.74370;AN=1588;set=Intersection
22	40055136	.	C	G	296.23	PASS	AC=2;AF=0.00136;AN=1474;set=Intersection
22	40055489	.	T	C	146.32	PASS	AC=1;AF=0.00076;AN=1308;set=Intersection
22	40055498	.	G	A	512.42	PASS	AC=2;AF=0.00153;AN=1306;set=Intersection
22	40055540	.	C	T	994.91	PASS	AC=2;AF=0.00152;AN=1320;DS;set=Intersection
22	40055566	.	G	A	582.62	PASS	AC=1;AF=0.00074;AN=1346;DS;set=Intersection
22	40055667	.	G	A	888.41	PASS	AC=2;AF=0.00154;AN=1302;DS;set=Intersection
22	40055782	.	C	T	8091.54	PASS	AC=7;AF=0.00517;AN=1354;DS;set=Intersection
22	40055896	.	T	C	158899.29	PASS	AC=950;AF=0.72188;AN=1316;DS;set=Intersection
22	40055900	.	C	T	429.86	PASS	AC=1;AF=0.00075;AN=1330;DS;set=Intersection
22	40056330	.	G	A	903.25	PASS	AC=2;AF=0.00152;AN=1316;set=Intersection
22	40056354	.	C	T	336.30	PASS	AC=3;AF=0.00231;AN=1298;DS;set=Intersection
22	40056387	.	C	T	421.20	PASS	AC=1;AF=0.00077;AN=1302;DS;set=Intersection
22	40056448	.	C	T	511.54	PASS	AC=1;AF=0.00079;AN=1270;DS;set=Intersection
22	40056454	.	C	T	418.38	PASS	AC=1;AF=0.00079;AN=1264;DS;set=Intersection
22	40056457	.	G	A	999.27	PASS	AC=3;AF=0.00237;AN=1264;DS;set=Intersection
22	40057127	.	C	T	370.14	PASS	AC=2;AF=0.00129;AN=1546;DS;set=Intersection
22	40057273	.	T	C	112416.26	PASS	AC=1029;AF=0.72772;AN=1414;DS;set=Intersection
22	40057288	.	G	A	540.24	PASS	AC=1;AF=0.00071;AN=1400;DS;set=Intersection
22	40058186	.	A	G	5619.52	PASS	AC=516;AF=0.7030;AN=734;set=Intersection
22	40059705	.	C	T	1357.66	PASS	AC=2;AF=0.00154;AN=1302;DS;set=Intersection
22	40059707	.	C	T	1058.61	PASS	AC=3;AF=0.00227;AN=1324;DS;set=Intersection
22	40059828	.	G	C	883.52	PASS	AC=2;AF=0.00152;AN=1318;DS;set=Intersection
22	40060048	.	G	C	1637.49	PASS	AC=5;AF=0.00421;AN=1188;set=Intersection
22	40060724	.	C	A	74.20	PASS	AC=3;AF=0.00269;AN=1116;set=Intersection
22	40060767	.	C	T	15129.80	PASS	AC=57;AF=0.04831;AN=1180;set=Intersection
22	40060887	.	C	T	1912.32	PASS	AC=5;AF=0.00430;AN=1162;DS;set=Intersection
22	40061497	.	C	T	999.63	PASS	AC=4;AF=0.00260;AN=1538;DS;set=Intersection
22	40064278	.	G	A	403.36	PASS	AC=1;AF=0.00073;AN=1378;set=Intersection
22	40064281	.	T	C	218.51	PASS	AC=1;AF=0.00073;AN=1378;set=Intersection
22	40064419	.	T	A	935.32	PASS	AC=3;AF=0.00213;AN=1410;DS;set=Intersection
22	40066114	.	G	T	904.33	PASS	AC=1;AF=0.00066;AN=1524;DS;set=Intersection
22	40066117	.	C	T	4463.22	PASS	AC=9;AF=0.00596;AN=1510;DS;set=Intersection
22	40066920	.	C	T	1805.68	PASS	AC=5;AF=0.00318;AN=1574;DS;set=Intersection
22	40066958	.	C	T	87373.78	PASS	AC=101;AF=0.06525;AN=1548;DS;set=Intersection
22	40069029	.	G	A	1750.18	PASS	AC=2;AF=0.00155;AN=1290;DS;set=Intersection
22	40069104	.	G	T	604.82	PASS	AC=1;AF=0.00076;AN=1310;DS;set=Intersection
22	40069919	.	G	A	6893.35	PASS	AC=22;AF=0.01716;AN=1282;set=Intersection
22	40069928	.	G	A	10347.81	PASS	AC=31;AF=0.02411;AN=1286;set=Intersection
22	40070062	.	C	T	198.75	PASS	AC=1;AF=0.00083;AN=1202;DS;set=Intersection
22	40070073	.	G	A	273.70	PASS	AC=1;AF=0.00081;AN=1230;DS;set=Intersection
22	40073945	.	G	A	112.69	PASS	AC=2;AF=0.00170;AN=1174;set=Intersection
22	40074125	.	C	A	45.52	PASS	AC=1;AF=0.00071;AN=1410;set=Intersection
22	40075107	.	C	T	462.39	PASS	AC=5;AF=0.00375;AN=1332;set=Intersection
22	40075195	.	C	T	128.20	PASS	AC=1;AF=0.00076;AN=1314;set=Intersection
22	40075324	.	T	C	53.87	PASS	AC=3;AF=0.00290;AN=1034;set=Intersection
22	40075341	.	C	T	94.14	PASS	AC=9;AF=0.0096;AN=936;set=Intersection
22	40075683	.	G	A	527.52	PASS	AC=5;AF=0.00433;AN=1154;set=Intersection
22	40075733	.	C	A	306.15	PASS	AC=5;AF=0.00411;AN=1218;set=Intersection
22	40075825	.	C	T	589.52	PASS	AC=4;AF=0.00322;AN=1244;set=Intersection
22	40075834	.	G	A	119.40	PASS	AC=1;AF=0.00081;AN=1236;set=Intersection
22	40075887	.	G	A	368.31	PASS	AC=3;AF=0.00244;AN=1228;set=Intersection
22	40075897	.	G	A	244.57	PASS	AC=2;AF=0.00166;AN=1208;set=Intersection
22	40076912	.	G	A	352.85	PASS	AC=2;AF=0.00169;AN=1180;DS;set=Intersection
22	40077043	.	C	T	284.98	PASS	AC=1;AF=0.00079;AN=1262;DS;set=Intersection
22	40077088	.	G	A	2085.17	PASS	AC=19;AF=0.01498;AN=1268;DS;set=Intersection
22	40078527	.	G	A	177.69	PASS	AC=1;AF=0.00076;AN=1322;DS;set=Intersection
22	40078528	.	C	T	894.82	PASS	AC=1;AF=0.00075;AN=1328;DS;set=Intersection
22	40078536	.	A	C	662.63	PASS	AC=1;AF=0.00076;AN=1314;DS;set=Intersection
22	40080349	.	T	C	100.46	PASS	AC=1;AF=0.00070;AN=1430;DS;set=Intersection
22	40139984	.	A	T	1742.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40140046	.	G	A	861.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40140137	.	G	T	4995.39	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	40140163	.	G	A	1177.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40140181	.	C	T	1521.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40140299	.	T	C	6079.24	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	40140303	.	T	C	625.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40161282	.	G	C	260.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40161341	.	GGA	G	5095.73	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	40161439	.	C	G	1279.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40161527	.	G	T	760.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40161572	.	C	G	1156.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40161646	.	A	G	75.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40217114	.	A	G	6806.20	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	40217132	.	C	T	911.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40217139	.	A	G	901.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40217164	.	A	G	54.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40231839	.	A	G	11345.09	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	40231986	.	G	C	1173.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40257783	.	C	G	993.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40257834	.	T	G	937.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40257887	.	T	C	490.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40257994	.	T	C	1153.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40258001	.	G	A	849.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40258005	.	A	G	7653.10	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	40283365	.	C	G	1000.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40283389	.	T	C	1257.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40283427	.	A	G	41638.53	PASS	AC=66;AF=0.04015;AN=1644;DS;set=Intersection
22	40283543	.	G	A	1028.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40283561	.	A	G	9563.24	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	40283682	.	G	A	1712.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40283727	.	T	A	1095.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40343227	.	T	G	894.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40356068	.	C	T	967.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40356069	.	G	A	1074.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40361957	.	C	T	4494.16	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	40362211	.	G	A	890.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40364039	.	C	T	268.60	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40364052	.	C	T	620.39	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	40364122	.	G	A	1080.43	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	40364307	.	C	T	670.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40365390	.	C	G	971.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40365391	.	C	A	9718.92	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	40365463	.	G	A	14727.60	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	40365489	.	C	T	891.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40365525	.	C	G	8265.42	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	40366872	.	C	T	557.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40366876	.	T	C	233.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40366914	.	G	A	820.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40366915	.	C	T	517.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40366925	.	G	A	261.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40366977	.	C	T	997.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40367070	.	G	A	1101.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40367129	.	C	T	259.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40415140	.	C	T	107051.49	PASS	AC=347;AF=0.21107;AN=1644;DS;set=Intersection
22	40415141	.	G	A	1922.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40415264	.	C	T	935.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40415266	.	T	A	1271.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40415273	.	C	A,T	1246.10	PASS	AC=1,1;AF=0.00061,0.00061;AN=1644;DS;set=Intersection
22	40415323	.	C	T	1271.02	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40415903	.	C	T	512.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40415968	.	G	T	9659.10	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	40415988	.	A	G	499.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40416025	.	G	A	83931.03	PASS	AC=91;AF=0.05535;AN=1644;DS;set=Intersection
22	40416051	.	T	C	1265.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40417372	.	G	A	1050.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40417495	.	C	T	7620.96	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	40417551	.	G	A	282.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40417571	.	G	A	9000.04	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	40417579	.	G	A	133.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40417604	.	G	A	748.65	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40417780	.	C	T	47774.10	PASS	AC=354;AF=0.21533;AN=1644;DS;set=Intersection
22	40417800	.	G	C	204.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40417820	.	A	G	33796.61	PASS	AC=341;AF=0.20767;AN=1642;DS;set=Intersection
22	40417851	.	G	A	639.52	PASS	AC=2;AF=0.00122;AN=1636;DS;set=Intersection
22	40417943	.	G	A	882.48	PASS	AC=5;AF=0.00307;AN=1628;DS;set=Intersection
22	40417964	.	T	C	701.42	PASS	AC=1;AF=0.00062;AN=1616;DS;set=Intersection
22	40425535	.	G	A	387.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40425594	.	C	T	1005.23	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	40552078	.	A	T	172.18	PASS	AC=1;AF=0.00077;AN=1302;set=Intersection
22	40552117	.	A	G	173.67	PASS	AC=2;AF=0.00156;AN=1286;set=Intersection
22	40552119	.	G	A	2263.48	PASS	AC=59;AF=0.04595;AN=1284;set=Intersection
22	40552234	.	A	T	107.80	PASS	AC=1;AF=0.00084;AN=1196;set=Intersection
22	40574097	.	C	T	1808.13	PASS	AC=2;AF=0.00169;AN=1180;DS;set=Intersection
22	40574170	.	T	A	275180.08	PASS	AC=787;AF=0.66582;AN=1182;DS;set=Intersection
22	40574176	.	A	G	1970.77	PASS	AC=2;AF=0.00171;AN=1172;DS;set=Intersection
22	40647167	.	T	C	122.76	PASS	AC=2;AF=0.00187;AN=1072;set=Intersection
22	40657807	.	A	G	736.21	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	40657967	.	G	A	415.19	PASS	AC=1;AF=0.00085;AN=1176;set=Intersection
22	40658117	.	A	G	105.58	PASS	AC=1;AF=0.00077;AN=1292;set=Intersection
22	40658145	.	C	T	148.79	PASS	AC=1;AF=0.00077;AN=1306;set=Intersection
22	40660813	.	C	T	1470.68	PASS	AC=5;AF=0.00394;AN=1268;DS;set=Intersection
22	40660856	.	A	G	2039.21	PASS	AC=2;AF=0.00157;AN=1274;DS;set=Intersection
22	40660900	.	G	T	1302.93	PASS	AC=1;AF=0.00079;AN=1262;DS;set=Intersection
22	40661041	.	A	G	1419.70	PASS	AC=2;AF=0.00163;AN=1224;DS;set=Intersection
22	40661112	.	T	C	584.59	PASS	AC=1;AF=0.00079;AN=1258;DS;set=Intersection
22	40661149	.	T	C	1529.76	PASS	AC=5;AF=0.00391;AN=1278;DS;set=Intersection
22	40661502	.	G	T	1104.89	PASS	AC=1;AF=0.00077;AN=1294;DS;set=Intersection
22	40661522	.	G	A	652.83	PASS	AC=1;AF=0.00077;AN=1296;DS;set=Intersection
22	40661566	.	A	C	891.38	PASS	AC=1;AF=0.00076;AN=1324;DS;set=Intersection
22	40661729	.	G	C	2908.40	PASS	AC=3;AF=0.00234;AN=1284;DS;set=Intersection
22	40661738	.	A	G	988.77	PASS	AC=1;AF=0.00078;AN=1274;DS;set=Intersection
22	40662358	.	C	T	720.29	PASS	AC=1;AF=0.00073;AN=1372;set=Intersection
22	40662585	.	G	T	1147.65	PASS	AC=1;AF=0.00062;AN=1622;DS;set=Intersection
22	40662843	.	A	C	530.27	PASS	AC=1;AF=0.00062;AN=1622;DS;set=Intersection
22	40662940	.	T	C	1596.61	PASS	AC=4;AF=0.00258;AN=1550;DS;set=Intersection
22	40662984	.	G	C	457.57	PASS	AC=2;AF=0.00137;AN=1460;DS;set=Intersection
22	40666230	.	T	C	284.24	PASS	AC=7;AF=0.00567;AN=1234;set=Intersection
22	40669393	.	G	C	338.71	PASS	AC=2;AF=0.00158;AN=1266;set=Intersection
22	40669456	.	G	A	71.09	PASS	AC=1;AF=0.00075;AN=1340;set=Intersection
22	40669482	.	G	A	518.11	PASS	AC=4;AF=0.00302;AN=1326;set=Intersection
22	40669648	.	A	G	15964.14	PASS	AC=326;AF=0.24848;AN=1312;set=Intersection
22	40673035	.	T	C	481.25	PASS	AC=1;AF=0.00092;AN=1086;set=Intersection
22	40673999	.	C	T	21457.09	PASS	AC=805;AF=0.67420;AN=1194;set=Intersection
22	40674062	.	C	T	52.17	PASS	AC=2;AF=0.00159;AN=1254;set=Intersection
22	40675957	.	A	G	4951.58	PASS	AC=4;AF=0.00346;AN=1156;DS;set=Intersection
22	40676092	.	G	A	874.85	PASS	AC=1;AF=0.00088;AN=1136;DS;set=Intersection
22	40676184	.	A	G	9508.14	PASS	AC=13;AF=0.01152;AN=1128;DS;set=Intersection
22	40681601	.	ATTTTC	A	1759.69	PASS	AC=1;AF=0.00082;AN=1218;DS;set=Intersection
22	40681788	.	C	T	150238.15	PASS	AC=450;AF=0.35714;AN=1260;DS;set=Intersection
22	40696605	.	T	G	357.56	PASS	AC=1;AF=0.00079;AN=1262;DS;set=Intersection
22	40696612	.	TG	T	163	PASS	AC=1;AF=0.00080;AN=1248;DS;set=Intersection
22	40696633	.	CT	C,CTT	4770.94	PASS	AC=212,37;AF=0.17097,0.02984;AN=1240;DS;set=Intersection
22	40696881	.	T	A	349.43	PASS	AC=5;AF=0.00351;AN=1424;set=Intersection
22	40697377	.	A	G	27964.97	PASS	AC=495;AF=0.35458;AN=1396;set=Intersection
22	40704537	.	A	T	765.94	PASS	AC=1;AF=0.00074;AN=1350;DS;set=Intersection
22	40704692	.	G	C	238.14	PASS	AC=1;AF=0.00074;AN=1352;DS;set=Intersection
22	40704697	.	T	G	460.76	PASS	AC=1;AF=0.00075;AN=1334;DS;set=Intersection
22	40706978	.	C	T	606.64	PASS	AC=2;AF=0.00174;AN=1152;set=Intersection
22	40708601	.	G	A	915.16	PASS	AC=1;AF=0.00063;AN=1582;DS;set=Intersection
22	40708679	.	T	C	165034.43	PASS	AC=548;AF=0.35219;AN=1556;DS;set=Intersection
22	40709036	.	G	A	842.81	PASS	AC=1;AF=0.00072;AN=1386;DS;set=Intersection
22	40711248	.	G	A	5571.96	PASS	AC=12;AF=0.00892;AN=1346;DS;set=Intersection
22	40711260	.	T	C	427.38	PASS	AC=2;AF=0.00147;AN=1362;DS;set=Intersection
22	40712022	.	T	C	541.42	PASS	AC=1;AF=0.00080;AN=1256;DS;set=Intersection
22	40717243	.	C	T	2275.61	PASS	AC=4;AF=0.00313;AN=1280;DS;set=Intersection
22	40718840	.	T	C	797.98	PASS	AC=2;AF=0.00157;AN=1272;DS;set=Intersection
22	40718965	.	C	T	364.87	PASS	AC=1;AF=0.00077;AN=1294;DS;set=Intersection
22	40718974	.	C	T	155.16	PASS	AC=1;AF=0.00077;AN=1294;DS;set=Intersection
22	40742527	.	T	A	36.09	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	40742540	.	C	T	331.26	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	40742542	.	T	A	148.96	PASS	AC=1;AF=0.00061;AN=1632;DS;set=Intersection
22	40742552	.	G	T	764.42	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	40742567	.	C	T	129.59	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	40742686	.	C	T	1179.12	PASS	AC=9;AF=0.00549;AN=1640;DS;set=Intersection
22	40745898	.	C	T	2704.67	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	40746045	.	C	T	978.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40749066	.	T	G	547.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40749073	.	G	A	8459.72	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	40750289	.	A	T	14579.57	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	40750380	.	C	T	1372.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40754826	.	GTCTC	G	163609.74	PASS	AC=354;AF=0.21533;AN=1644;DS;set=Intersection
22	40755001	.	G	T	1379.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40755034	.	C	G	194.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40755222	.	G	C	895.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40756399	.	T	C	843.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40756526	.	C	T	838.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40756542	.	CACAG	C	1263.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40757228	.	A	C	61247.96	PASS	AC=200;AF=0.12165;AN=1644;DS;set=Intersection
22	40757292	.	C	T	885.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40757509	.	T	C	5251.17	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	40757524	.	A	G	688.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40757657	.	A	G	692.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40757684	.	C	G	13874.97	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	40760241	.	G	C	310.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40760264	.	G	C	764.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40760290	.	G	A	1560.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40760858	.	C	T	1238.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40760881	.	C	T	1261.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40762397	.	T	A	240.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40762408	.	TC	T	221.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40797647	.	T	C	2165.72	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	40798179	.	G	A	905.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40798227	.	T	G	15174.63	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	40800282	.	G	A	534.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40800320	.	G	A	856.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40800385	.	G	A	850.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40800386	.	C	T	1194.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40800400	.	C	T	1799.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40800518	.	G	A	56141.73	PASS	AC=370;AF=0.22506;AN=1644;DS;set=Intersection
22	40800522	.	C	T	12122.96	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	40800544	.	C	T	55012.61	PASS	AC=370;AF=0.22506;AN=1644;DS;set=Intersection
22	40800653	.	C	G	238.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40800676	.	C	T	187.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40801129	.	G	A	887.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40801181	.	G	A	457.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40801207	.	C	T	1098.73	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	40801282	.	C	T	128.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40801312	.	A	G	19705.69	PASS	AC=345;AF=0.21011;AN=1642;DS;set=Intersection
22	40801604	.	T	A	8209.60	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	40801663	.	G	T	779.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40801733	.	C	T	971.31	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40801787	.	G	C	7671.87	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	40801855	.	C	T	4526.85	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	40801874	.	C	T	1140.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40802189	.	G	A	1586.39	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40802194	.	G	A	841.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40802267	.	C	T	848.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40802392	.	G	A	278.84	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	40802444	.	G	A	823.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40802489	.	G	A	110.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40802567	.	C	G	130.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40802577	.	G	A	33.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40802642	.	C	T	78.58	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	40803041	.	G	A	340.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40803083	.	C	T	500.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40803089	.	G	A	8261.28	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	40803104	.	T	C	366.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40803112	.	C	T	34568.92	PASS	AC=323;AF=0.19647;AN=1644;DS;set=Intersection
22	40803186	.	G	T	170279.56	PASS	AC=950;AF=0.57786;AN=1644;DS;set=Intersection
22	40803230	.	G	A	298.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40803367	.	C	T	8314.05	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	40803454	.	G	A	512.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40803584	.	C	T	12992.90	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	40803782	.	C	T	327.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40803845	.	G	A	380.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804033	.	G	T	631.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40804078	.	G	A	455.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804150	.	C	T	320.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804164	.	C	G	617.08	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	40804168	.	C	T	450.32	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40804286	.	C	G	288.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804348	.	C	T	591.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804356	.	A	G	562.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804412	.	C	T	1559.66	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40804428	.	G	A	297.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804448	.	G	A	273.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804597	.	G	A	2435.66	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40804648	.	C	T	482.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804825	.	C	A	1071.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40804844	.	C	T	1049.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804901	.	G	A	419.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40804922	.	C	T	229.68	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40804932	.	C	A	5962.97	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	40804954	.	C	T	635.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805230	.	C	T	302.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805231	.	C	T	379.39	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	40805242	.	C	T	111.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805305	.	C	T	288.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805320	.	C	T	315.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805448	.	C	G	1910.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40805470	.	G	A	1079.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805512	.	C	T	762.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805520	.	G	A	823.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805541	.	G	A	583.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805569	.	C	G	5811.33	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	40805648	.	C	T	862.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805657	.	TGTGAG	T	8238.95	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	40805688	.	G	A	1295.83	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40805714	.	G	A	975.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40805799	.	T	G	241.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40807368	.	T	TCCCCA	392.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40807378	.	G	A	171.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40807391	.	G	C	232.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40807436	.	G	A	467.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40807755	.	C	A	394.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40807775	.	T	C	203.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40807799	.	G	A	989.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40807902	.	G	A	252.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40807936	.	T	C	249.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40812958	.	C	T	843.65	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	40812974	.	G	A	1058.44	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	40813030	.	C	T	717.95	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	40813075	.	AAG	A	125.89	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	40813325	.	G	T	539.44	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40813334	.	G	A	601.79	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40814334	.	C	T	581.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40814356	.	G	A	368.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40814431	.	C	T	499.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40814500	.	T	C	155166.68	PASS	AC=649;AF=0.39477;AN=1644;DS;set=Intersection
22	40814533	.	C	T	80.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40814542	.	G	A	5341.71	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	40814545	.	C	T	987.02	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	40814594	.	C	T	38782.14	PASS	AC=283;AF=0.17214;AN=1644;DS;set=Intersection
22	40814595	.	G	A	282.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40814636	.	C	T	22720.42	PASS	AC=281;AF=0.17113;AN=1642;DS;set=Intersection
22	40814662	.	C	T	33.80	PASS	AC=2;AF=0.00122;AN=1638;DS;set=Intersection
22	40814737	.	C	T	427.72	PASS	AC=15;AF=0.01142;AN=1314;set=Intersection
22	40814749	.	C	T	219.13	PASS	AC=8;AF=0.00606;AN=1320;set=Intersection
22	40814899	.	G	A	280.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40814988	.	G	A	6448.96	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	40815047	.	C	T	99.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40815056	.	C	T	314.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40815089	.	G	C	41125.49	PASS	AC=228;AF=0.13869;AN=1644;DS;set=Intersection
22	40815097	.	A	G	147.13	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	40815133	.	C	T	84.32	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	40815147	.	A	G	103.70	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	40815190	.	C	T	197.82	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	40815256	.	C	T	6561.56	PASS	AC=34;AF=0.02068;AN=1644;set=Intersection
22	40815294	.	T	C	234.87	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	40815429	.	G	A	582.24	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	40816417	.	C	T	845.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40816430	.	C	T	470.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40816443	.	G	A	750.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40816503	.	G	A	548.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40816548	.	G	T	652.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40816571	.	G	A	460.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40816623	.	G	A	136.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40816822	.	G	A	8838.79	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	40816841	.	G	A	65449.58	PASS	AC=213;AF=0.12956;AN=1644;DS;set=Intersection
22	40816882	.	T	TGTG	525.07	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	40816889	.	C	G	2324.85	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	40816955	.	G	A	1330.93	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	40816960	.	A	G	466.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40817154	.	C	T	650.17	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40819551	.	T	C	858.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40819629	.	G	C	2942.98	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	40819664	.	C	T	939.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40820160	.	G	A	2124.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	40820172	.	C	T	1030.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40820203	.	C	A	869.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40820213	.	G	C	526.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40820236	.	T	C	661.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40820248	.	C	T	899.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40820273	.	C	T	2680.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	40825561	.	C	T	4673.37	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	40825765	.	G	A	579.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40825806	.	T	C	404.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40825814	.	G	A	71534.76	PASS	AC=242;AF=0.14720;AN=1644;DS;set=Intersection
22	40827397	.	C	T	918.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40831478	.	C	T	854.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40831541	.	C	T	1024.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40831542	.	G	A	811.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	40859205	.	TGAGA	T	35198.37	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	41075523	.	C	T	61.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41075532	.	A	T	1918.01	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	41075543	.	A	G	112358.43	PASS	AC=1181;AF=0.71837;AN=1644;DS;set=Intersection
22	41075695	.	C	T	178396.18	PASS	AC=1109;AF=0.67457;AN=1644;DS;set=Intersection
22	41075719	.	C	T	342.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41076969	.	G	A	984.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41076970	.	G	A	49641.54	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	41077024	.	C	T	810.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077150	.	C	T	1092.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077282	.	G	A	890.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077283	.	C	T	811.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077343	.	C	T	1112.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077547	.	C	T	722.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077548	.	C	T	9462.66	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	41077549	.	G	A	810.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077612	.	C	T	1956.48	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41077613	.	G	A	2714.05	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41077734	.	C	T	1907.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41077744	.	T	C	6172.94	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41077804	.	A	G	868.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077832	.	G	A	2110.17	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41077864	.	G	A	5610.18	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	41077866	.	G	A	532.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077873	.	C	T	875.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41077895	.	C	T	2505.88	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41077980	.	C	T	2208.08	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41077981	.	G	A	106.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41166819	.	T	C	2833.01	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41166855	.	G	A	1133.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41169950	.	T	C	517.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41169975	.	G	A	1160.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41170063	.	T	C	164764.62	PASS	AC=640;AF=0.38929;AN=1644;DS;set=Intersection
22	41173002	.	G	A	979.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41173106	.	C	T	797.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41173152	.	GGAA	G	6736.68	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	41173256	.	C	T	10787.86	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	41174979	.	C	A	1022.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41175014	.	A	C	996.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41175065	.	T	C	5378.43	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	41188570	.	T	C	6263	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	41190602	.	G	A	760.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41190603	.	C	A	785.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41190621	.	TA	T	1161.38	PASS	AC=9;AF=0.00548;AN=1642;DS;set=Intersection
22	41190631	.	A	T	516.23	PASS	AC=4;AF=0.00244;AN=1638;DS;set=Intersection
22	41195082	.	G	A	60408.09	PASS	AC=109;AF=0.06630;AN=1644;DS;set=Intersection
22	41195121	.	C	T	4368.93	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	41215150	.	G	A	319.58	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	41215183	.	A	G	42955.38	PASS	AC=219;AF=0.13321;AN=1644;DS;set=Intersection
22	41215298	.	C	A	170.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41222527	.	T	C	6554.77	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41222684	.	G	A	5655.13	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	41223058	.	C	A	393.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41223190	.	C	T	30312.53	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	41223206	.	T	C	11861.46	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	41223247	.	T	C	1410.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41225613	.	C	T	4918.86	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	41225691	.	AG	A	2762.31	PASS	AC=11;AF=0.00670;AN=1642;DS;set=Intersection
22	41225709	.	TAGA	T	2807.85	PASS	AC=14;AF=0.00856;AN=1636;DS;set=Intersection
22	41225726	.	GCTGTCCATGCAAC	G	1485.12	PASS	AC=3;AF=0.00184;AN=1634;DS;set=Intersection
22	41226815	.	C	G	943.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41226883	.	T	G	452.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41228525	.	C	T	1110.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41231826	.	A	C	1060.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41231896	.	A	T	602.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41236696	.	T	C	443.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41236729	.	G	A	711.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41236745	.	G	A	79.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41240803	.	A	G	412.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41240835	.	G	A	44335.48	PASS	AC=155;AF=0.09428;AN=1644;DS;set=Intersection
22	41240846	.	C	T	361.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41240909	.	A	C	855.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41244257	.	A	G	13451.39	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	41244287	.	C	T	873.71	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41244398	.	C	G	165450.66	PASS	AC=630;AF=0.38321;AN=1644;DS;set=Intersection
22	41246782	.	T	G	2947.31	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	41246855	.	T	C	816.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41246931	.	C	T	383.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41252405	.	C	G	7622.32	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	41252523	.	C	T	638.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41252584	.	C	G	881.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41252593	.	G	A	291.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41253163	.	C	T	2980.74	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	41253248	.	A	G	1036.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41253293	.	A	T	233.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41253296	.	G	T	59.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41253297	.	A	T	59.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257051	.	T	C	52708.37	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	41257213	.	G	A	11787.54	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	41257393	.	C	A	8625.99	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	41257440	.	C	G	1087.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257470	.	C	G	935.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257503	.	C	T	965.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257518	.	CCT	C	1046.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257566	.	G	T	2108.64	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41257567	.	A	G	938.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257620	.	A	C	13548.12	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	41257628	.	C	A	1124.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257631	.	G	A	886.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257739	.	C	G	8564.57	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	41257741	.	G	A	1067.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257802	.	T	C	1128.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257815	.	G	A	665.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41257835	.	A	AC	16022.20	PASS	AC=87;AF=0.05292;AN=1644;DS;set=Intersection
22	41257853	.	ACTT	A	2619.97	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41257877	.	T	G	25135.66	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	41257977	.	G	T	586.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41265049	.	A	G	15429.98	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	41265054	.	G	A	1042.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41265143	.	C	T	54895.68	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	41277919	.	C	T	1093.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41282308	.	C	T	7629.81	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	41282309	.	A	G	2054.43	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41282324	.	G	A	1530.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41282501	.	T	C	495.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41282558	.	G	A	2163.60	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	41303615	.	A	G	764.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41303689	.	G	A	895.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41305076	.	G	A	77.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41305106	.	CT	C	839.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41305166	.	C	T	875.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41310203	.	C	G	41628.63	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	41310234	.	T	C	4956.12	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	41310343	.	G	A	13242.59	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	41318328	.	C	T	2972.95	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41318329	.	G	A	1035.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41318366	.	A	C	2169.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41318539	.	C	T	1036.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41320390	.	C	G	715.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41320505	.	A	G	1098.76	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41322392	.	C	G	1704.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41322422	.	T	C	879.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41347387	.	A	C	6716.20	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	41347390	.	G	C	764.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41347529	.	C	A	2078.86	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	41349511	.	G	C	1119.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41360004	.	G	C	387.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41368493	.	GAA	G	505.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41489077	.	C	T	226.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41489115	.	A	G	666.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41489143	.	C	T	1134.79	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41489150	.	A	G	241.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41513175	.	T	C	46508.51	PASS	AC=137;AF=0.08333;AN=1644;DS;set=Intersection
22	41513199	.	T	G	343.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41513412	.	A	G	913.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41513472	.	A	G	1466.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41513628	.	T	C	2676.12	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41513727	.	G	A	8856.03	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	41513746	.	A	C	1165.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41513774	.	C	G	6025.77	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	41521848	.	CTTTTGTTTCT	C	109605.24	PASS	AC=132;AF=0.08029;AN=1644;DS;set=Intersection
22	41521868	.	A	T	1133.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41521877	.	A	G	1539.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41522003	.	A	G	1124.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41523526	.	C	T	21371.84	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	41523688	.	C	T	1806.44	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41523759	.	G	C	1080.71	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41523770	.	G	A	46329.22	PASS	AC=137;AF=0.08333;AN=1644;DS;set=Intersection
22	41523772	.	T	C	6263.11	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	41525845	.	T	C	163.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41525859	.	C	T	952.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41526036	.	T	C	152.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41527376	.	C	T	1123.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41527384	.	T	C	23382.64	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	41527386	.	C	G	814.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41527628	.	A	G	6095.52	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	41527652	.	T	C	1006.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41533637	.	T	C	6925.02	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41533720	.	A	C	1062.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41533761	.	C	A	993.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41533824	.	G	A	547.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41536112	.	GAT	G	5755.09	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41536165	.	G	C	926.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41536270	.	C	G	790.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41536274	.	T	C	1154.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41536308	.	G	T	517.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41537138	.	G	A	1052.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41537192	.	T	C	10562.17	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	41537234	.	G	T	342154.01	PASS	AC=1597;AF=0.97141;AN=1644;DS;set=Intersection
22	41537244	.	T	C	1244.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41537268	.	A	G	15746.04	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	41542753	.	A	G	1392.88	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41542772	.	C	T	1209	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41542780	.	T	G	855.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41542837	.	A	T	8533.26	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	41542838	.	T	A	8173.53	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	41542862	.	G	A	862.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41543796	.	A	G	912.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41543949	.	C	T	1133.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41543983	.	C	G	46403	PASS	AC=136;AF=0.08273;AN=1644;DS;set=Intersection
22	41545729	.	T	C	54.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41545750	.	T	C	52044.61	PASS	AC=136;AF=0.08273;AN=1644;DS;set=Intersection
22	41545884	.	G	A	15635.32	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	41545905	.	C	T	1228.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41545919	.	C	G	2566.55	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41545957	.	A	G	832.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41545961	.	T	C	3076.83	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41546056	.	A	C	1132.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41546131	.	T	A	1519.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41546158	.	C	A	1020.96	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41547873	.	T	C	1929.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41547908	.	T	C	994.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41547941	.	G	A	837.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41547944	.	A	G	1834.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41548008	.	A	G	189972.21	PASS	AC=366;AF=0.22263;AN=1644;DS;set=Intersection
22	41548198	.	G	A	8755.73	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	41548242	.	C	G	973.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41548275	.	T	C	861.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41548375	.	G	A	636.46	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41550954	.	C	T	263808.04	PASS	AC=1118;AF=0.68005;AN=1644;DS;set=Intersection
22	41551039	.	T	A	315044.42	PASS	AC=1118;AF=0.68005;AN=1644;DS;set=Intersection
22	41553160	.	C	T	730.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41553259	.	G	A	46460.62	PASS	AC=129;AF=0.07847;AN=1644;DS;set=Intersection
22	41553337	.	C	T	15139.41	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	41554407	.	C	A	71.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41556596	.	G	A	1810.55	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41556625	.	G	A	817.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41556685	.	G	A	2645.88	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41558821	.	CT	C	4710.69	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41560146	.	C	T	620.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41562562	.	T	C	1142.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41562585	.	GTT	G	917.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41562640	.	A	G	1247.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41562710	.	T	C	593.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41564627	.	TCTC	T	1529.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41564708	.	C	A	56670.81	PASS	AC=168;AF=0.10219;AN=1644;DS;set=Intersection
22	41564718	.	T	C	816.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41564725	.	G	A	801.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41564900	.	G	A	2820.89	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41565468	.	A	C	402.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41565653	.	T	C	10193.10	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	41565654	.	A	C	878.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41566360	.	T	G	608.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41566434	.	A	C	5266.11	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41566522	.	T	A	737.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41566595	.	C	T	141531.96	PASS	AC=399;AF=0.24270;AN=1644;DS;set=Intersection
22	41568480	.	T	C	203918.73	PASS	AC=935;AF=0.56873;AN=1644;DS;set=Intersection
22	41568649	.	C	G	404.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41569591	.	AC	A	249.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41569609	.	C	T	159276.66	PASS	AC=508;AF=0.30900;AN=1644;DS;set=Intersection
22	41569822	.	G	A	10522.88	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	41572210	.	C	T	768.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41572223	.	C	CA	427.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41572269	.	C	G	2958.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41572295	.	C	G	703.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41572541	.	C	T	9430.36	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	41572542	.	G	A	1367.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41572554	.	G	A	560.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41572559	.	A	T	367.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41572566	.	C	G	251.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41572785	.	C	T	1454.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41572792	.	A	G	885.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41572862	.	G	C	1136.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41572974	.	C	T	2286.20	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41572986	.	C	T	789.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573190	.	C	T	702.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573283	.	G	A	1141.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41573319	.	G	T	943.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573384	.	C	G	211.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573440	.	A	G	1070.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573523	.	G	A	1071.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573529	.	G	A	1698.64	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41573672	.	C	T	657.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41573798	.	C	T	479.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573806	.	C	T	806.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573809	.	G	C	858.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573823	.	A	T	858.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41573925	.	G	A	1799.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41573977	.	C	T	284.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574087	.	C	T	19069.46	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	41574105	.	G	A	1854.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41574132	.	C	T	396.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574196	.	A	G	4923.43	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	41574351	.	G	A	1811.21	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41574356	.	C	T	305.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574357	.	C	T	727.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574383	.	A	C	9195.02	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	41574510	.	TCAG	T	1399.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41574570	.	C	T	773.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574666	.	G	A	4766.47	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41574685	.	C	T	815.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574697	.	T	C	923.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574730	.	C	T	579.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574932	.	T	C	1012.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574966	.	C	A	421.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41574969	.	TGTA	T	162452.03	PASS	AC=394;AF=0.23966;AN=1644;DS;set=Intersection
22	41574976	.	T	G	935.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41601385	.	A	G	9754.41	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	41605741	.	C	T	868.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41605776	.	G	C	25655.18	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	41605809	.	G	C	5144.35	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41605892	.	A	G	1062.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41605948	.	A	C	580.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41609859	.	T	C	195292.55	PASS	AC=563;AF=0.34246;AN=1644;DS;set=Intersection
22	41610024	.	G	A	171162.31	PASS	AC=563;AF=0.34246;AN=1644;DS;set=Intersection
22	41610059	.	G	A	11460.68	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	41612265	.	C	T	1886.02	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41612295	.	A	G	991.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41613188	.	C	T	132308.16	PASS	AC=385;AF=0.23418;AN=1644;DS;set=Intersection
22	41613246	.	G	A	10124.53	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	41613250	.	C	A	15799.53	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	41615376	.	C	T	147019.28	PASS	AC=578;AF=0.35158;AN=1644;DS;set=Intersection
22	41615404	.	C	T	24680.43	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	41615581	.	G	A	254.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41616696	.	C	T	2395.05	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41616757	.	G	C	882.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41616778	.	C	T	18670.89	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	41616805	.	G	T	663.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41616906	.	C	T	751.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41617159	.	G	GC,GT	38601.28	PASS	AC=402,803;AF=0.27236,0.54404;AN=1476;DS;set=Intersection
22	41617160	.	T	TG	145674.81	PASS	AC=1033;AF=0.69892;AN=1478;DS;set=Intersection
22	41617247	.	C	T	891.71	PASS	AC=2;AF=0.00136;AN=1476;DS;set=Intersection
22	41617318	.	G	C	120621	PASS	AC=1001;AF=0.71705;AN=1396;DS;set=Intersection
22	41620091	.	T	C	7895.71	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	41620681	.	G	T	1096.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41620825	.	C	T	10020.29	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	41621057	.	C	T	530.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41621086	.	G	A	4594.38	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	41621751	.	G	T	398.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41621788	.	C	T	2073.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41621871	.	A	C	370.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41622663	.	C	T	783.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41622724	.	C	T	1853.58	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41622770	.	A	G	878.49	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41622781	.	G	A	566.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41623179	.	G	A	286.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41623305	.	G	A	284.61	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	41623324	.	G	T	229.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41623346	.	C	T	224.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41623351	.	A	G	27887.95	PASS	AC=235;AF=0.14294;AN=1644;DS;set=Intersection
22	41623773	.	T	C	162.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41623888	.	G	A	614.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41623890	.	T	A	17330.31	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	41625554	.	C	T	251.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41625582	.	CAG	C	393.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41625590	.	C	T	633.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41625611	.	C	T	331.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41625709	.	C	CA	225.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41626111	.	C	A	239.97	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	41626190	.	G	A	438.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41626245	.	C	T	445.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41626255	.	A	G	303.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41626269	.	C	T	228.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41642642	.	G	A	737.77	PASS	AC=1;AF=0.00062;AN=1616;DS;set=Intersection
22	41645303	.	G	T	8564.49	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	41645309	.	G	A	671.39	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41645341	.	C	G	360.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41645500	.	TG	T	111562.67	PASS	AC=1323;AF=0.80474;AN=1644;DS;set=Intersection
22	41645707	.	G	A	218.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41645724	.	C	T	678.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41645757	.	C	G	268483.60	PASS	AC=1239;AF=0.75365;AN=1644;DS;set=Intersection
22	41645827	.	G	A	418.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41645871	.	G	A	25051.17	PASS	AC=51;AF=0.03102;AN=1644;DS;set=Intersection
22	41648860	.	G	A	1649.86	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41648966	.	A	G	506.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41648994	.	T	C	864.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41650338	.	G	A,C,T	1065.95	PASS	AC=1,1,0;AF=0.00061,0.00061,0.00000;AN=1644;DS;set=Intersection
22	41650371	.	G	C	17859.40	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	41650387	.	TTCC	T	753.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41650414	.	CTCTTCCTCA	C	1965.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41650417	.	TTCC	T	2367.59	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41650548	.	T	G	5009.93	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41651996	.	G	A	1116.82	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41652030	.	G	C	692.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41652080	.	G	C	1030.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41652120	.	G	A	979.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41652250	.	C	T	4886.72	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	41652257	.	G	C	5215.04	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41652332	.	C	T	49400.54	PASS	AC=114;AF=0.06934;AN=1644;DS;set=Intersection
22	41652679	.	C	A	154.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41652733	.	G	A	41652.27	PASS	AC=276;AF=0.16788;AN=1644;DS;set=Intersection
22	41652846	.	G	T	55717.05	PASS	AC=418;AF=0.25426;AN=1644;DS;set=Intersection
22	41653902	.	G	A	700.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41653910	.	C	T	153.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41653946	.	C	T	2266.45	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41654030	.	G	A	8663.31	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	41654123	.	G	A	974.14	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41657442	.	C	T	598.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41657451	.	C	T	416.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41657477	.	G	A	750.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41657511	.	A	G	1287.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41657598	.	C	T	513.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41657608	.	T	C	1243.22	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41657626	.	C	T	75013.75	PASS	AC=674;AF=0.40998;AN=1644;DS;set=Intersection
22	41660645	.	G	A	24776.40	PASS	AC=237;AF=0.14416;AN=1644;DS;set=Intersection
22	41660665	.	C	T	237.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41660751	.	C	G	4897.53	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41660879	.	T	C	2385.39	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41664071	.	G	A	15061.78	PASS	AC=39;AF=0.02416;AN=1614;DS;set=Intersection
22	41664085	.	C	G	892.82	PASS	AC=2;AF=0.00124;AN=1616;DS;set=Intersection
22	41670623	.	T	C	856.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41676968	.	G	C	2957.99	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41676991	.	C	T	583.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41677050	.	T	C	545.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41721539	.	C	T	16663.67	PASS	AC=50;AF=0.03045;AN=1642;DS;set=Intersection
22	41721792	.	A	G	185.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41721853	.	C	T	133.43	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41721905	.	G	A	611.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41721949	.	C	G	693.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41723248	.	G	A	945.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41723315	.	C	T	843.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41723316	.	G	A	820.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41723393	.	C	T	379.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41726003	.	C	T	994.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41726004	.	G	A	714.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41726053	.	G	A	131607.17	PASS	AC=395;AF=0.24027;AN=1644;DS;set=Intersection
22	41726079	.	G	A	1624.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41726080	.	A	G	235.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41728205	.	G	A	1104.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41728213	.	G	A	658.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41728239	.	C	T	595.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41728242	.	G	T	8625.53	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	41728274	.	T	C	5260.69	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41734292	.	CGCCA	C	5359.88	PASS	AC=11;AF=0.00671;AN=1640;DS;set=Intersection
22	41734296	.	A	T	207.12	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	41734988	.	G	C	1026.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41735050	.	C	T	1490.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41735075	.	C	T	584	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41735108	.	C	T	27345.04	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	41735958	.	G	A	646.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41735999	.	C	T	123.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41736090	.	G	A	2297.48	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	41736138	.	A	C	1078.52	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41736188	.	A	C	228.66	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	41737045	.	C	T	110292.24	PASS	AC=323;AF=0.19647;AN=1644;DS;set=Intersection
22	41737126	.	C	T	399.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41737160	.	T	C	1297.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41738660	.	C	G	495.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41738668	.	A	G	1070.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41739370	.	T	C	178137.41	PASS	AC=1086;AF=0.66058;AN=1644;DS;set=Intersection
22	41739451	.	G	A	22166.21	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	41739486	.	C	T	509.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41739597	.	G	A	599.87	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41739610	.	C	T	730.03	PASS	AC=7;AF=0.00427;AN=1640;set=Intersection
22	41739618	.	G	A	248.40	PASS	AC=2;AF=0.00123;AN=1630;set=Intersection
22	41741970	.	C	T	944.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41742139	.	G	A	550.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41742149	.	C	T	599.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41742150	.	G	A	492.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41742164	.	C	T	624.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41742209	.	C	T	408.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41742229	.	C	G	5219.37	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	41742237	.	C	T	119.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41742241	.	A	G	1604.92	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41744022	.	C	G	121855.21	PASS	AC=323;AF=0.19647;AN=1644;DS;set=Intersection
22	41744145	.	T	G	726.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41745095	.	C	T	303.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41745115	.	GC	G	437.19	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41745316	.	G	A	866.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41745355	.	A	G	126017.43	PASS	AC=1089;AF=0.66241;AN=1644;DS;set=Intersection
22	41747576	.	G	A	1890.94	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41751437	.	G	A	105727.27	PASS	AC=305;AF=0.18552;AN=1644;DS;set=Intersection
22	41751488	.	C	T	12548.53	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	41751526	.	A	G	1246.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41751599	.	C	T	656.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41751910	.	G	A	1956.47	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41752102	.	G	A	419.16	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41752113	.	A	G	140.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41752302	.	TGGA	T	2985.72	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41752493	.	C	T	1349.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41752505	.	G	A	2727.69	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41752513	.	G	A	8349.59	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	41752645	.	C	G	561.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41752747	.	G	A	139192.62	PASS	AC=348;AF=0.21168;AN=1644;DS;set=Intersection
22	41752804	.	C	T	809.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41752838	.	C	T	584.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41753135	.	T	A	16154.19	PASS	AC=58;AF=0.03532;AN=1642;DS;set=Intersection
22	41753444	.	T	C	825.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41753466	.	G	T	108.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41778228	.	C	A	69.02	PASS	AC=1;AF=0.0011;AN=940;set=Intersection
22	41778236	.	G	T	67.74	PASS	AC=1;AF=0.0011;AN=932;set=Intersection
22	41778250	.	T	C	175.39	PASS	AC=9;AF=0.0102;AN=886;set=Intersection
22	41783389	.	C	T	1050.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41783530	.	C	T	472.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41783610	.	C	T	740.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41783659	.	C	T	81221.13	PASS	AC=311;AF=0.18917;AN=1644;DS;set=Intersection
22	41790179	.	G	A	21099.97	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	41790308	.	C	T	520.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41790354	.	C	T	148.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41790359	.	G	A	507.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41791719	.	G	A	612	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41791972	.	C	T	149.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41791983	.	GC	G	81.16	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41791985	.	G	A	398.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41791990	.	A	G	16713.41	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	41832484	.	C	T	262.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41832485	.	T	C	1717.92	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41832498	.	G	C	456.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41832522	.	A	G	582.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41832561	.	G	A	8474.28	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	41832562	.	T	C	438.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41832698	.	G	A	215.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41832726	.	C	T	195.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41832816	.	G	A	736.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41832989	.	C	T	835.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41832990	.	G	A	811.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41833080	.	C	T	852.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41833116	.	C	T	227319.86	PASS	AC=1237;AF=0.75243;AN=1644;DS;set=Intersection
22	41833136	.	C	T	556.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41833225	.	C	G	800.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41856377	.	G	T	623.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41856513	.	T	C	333.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41856527	.	A	G	2744.80	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41863423	.	A	G	228679.03	PASS	AC=1273;AF=0.77433;AN=1644;DS;set=Intersection
22	41863427	.	G	A	235.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41864114	.	T	C	397.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41864190	.	A	T	35784.30	PASS	AC=110;AF=0.06691;AN=1644;DS;set=Intersection
22	41864658	.	A	T	5322.71	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41864688	.	T	C	8973.66	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	41864700	.	G	C	1030.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41865217	.	G	C	4764.45	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	41895686	.	C	T	918.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41895777	.	A	G	1971.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41895813	.	C	T	2281.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41895908	.	C	T	1322.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41903813	.	A	C	66480.98	PASS	AC=642;AF=0.39051;AN=1644;DS;set=Intersection
22	41903841	.	C	G	553.70	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41903852	.	C	T	365.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41903960	.	C	T	565.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41904072	.	T	C	818.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41907930	.	T	C	207.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41907933	.	C	T	2658.04	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	41911426	.	A	C	775.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41911525	.	C	T	106699.52	PASS	AC=474;AF=0.28832;AN=1644;DS;set=Intersection
22	41911570	.	G	C	506.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41911805	.	G	C	925.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41911941	.	G	A	411.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41913649	.	G	C	561.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41914453	.	C	A	12199.81	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	41914593	.	C	T	197168.96	PASS	AC=720;AF=0.43796;AN=1644;DS;set=Intersection
22	41916140	.	C	T	952.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41919009	.	C	T	727.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41919029	.	C	G	753.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41919182	.	C	T	819.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41919330	.	A	G	58010	PASS	AC=314;AF=0.19100;AN=1644;DS;set=Intersection
22	41919787	.	G	T	8056.73	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	41919850	.	G	T	319.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41919893	.	C	T	1198.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41919894	.	G	A	892.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41919961	.	T	C	314.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41919978	.	T	C	414.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41920984	.	C	T	765.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41920995	.	T	C	240.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41921151	.	G	A	961.33	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41921177	.	A	G	885.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41921234	.	C	G	336.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41921247	.	C	T	1537.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41921369	.	C	T	443.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41922216	.	C	T	757.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41922376	.	T	A	1029.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41922488	.	TG	T	916.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41923260	.	G	C	8373.88	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	41923279	.	G	A	10888.81	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	41923280	.	C	T	1792.02	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	41923318	.	C	T	2827.87	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	41923407	.	G	A	764.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41924483	.	C	T	590.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41924552	.	G	A	1614.48	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41924557	.	G	A	826.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41924620	.	G	A	929.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41924640	.	C	T	758.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41925266	.	G	A	5636.65	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	41925342	.	T	C	802.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41926645	.	G	A	470.33	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	41926698	.	G	A	1872.69	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41926730	.	A	C	1520.20	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41926756	.	T	C	1092.14	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41926757	.	G	A	23048.58	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	41926859	.	G	A	853.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41926892	.	G	A	1545.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41926924	.	G	C	5399.67	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	41928058	.	G	C	1104.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41928086	.	C	T	639.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41928145	.	G	A	973.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41928211	.	G	A	781.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41928740	.	C	T	644.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41928785	.	G	A	518.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41928797	.	C	T	401.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41928798	.	G	A	5075.79	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	41936710	.	G	A	1026.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41936720	.	C	G	1117.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41936799	.	C	A	118.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41968168	.	G	A	2859.36	PASS	AC=20;AF=0.01242;AN=1610;DS;set=Intersection
22	41969683	.	C	G	1221.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41969745	.	A	C	504.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41969823	.	T	G	778.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41969831	.	A	G	14612.09	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	41970731	.	C	T	703.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	41970752	.	C	T	671.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41970770	.	C	T	6494.28	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	41970872	.	G	A	376.65	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41970909	.	T	C	15550.47	PASS	AC=134;AF=0.08161;AN=1642;DS;set=Intersection
22	41970939	.	G	A	431.09	PASS	AC=1;AF=0.00062;AN=1610;DS;set=Intersection
22	41973290	.	C	T	424.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41973374	.	G	A	628.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41973390	.	C	T	1022.86	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	41973452	.	C	T	872.97	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	41973780	.	G	A	751.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41973824	.	G	A	579.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41974805	.	C	T	143.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41974904	.	G	A	43243.32	PASS	AC=120;AF=0.07299;AN=1644;DS;set=Intersection
22	41979929	.	C	T	726.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41980043	.	G	A	999.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41980349	.	G	T	571.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41980403	.	C	T	745.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41980567	.	C	T	543.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41982107	.	C	T	877.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41982136	.	A	G	636.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41982207	.	G	T	571.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41985797	.	C	A	1406.03	PASS	AC=16;AF=0.00980;AN=1632;DS;set=Intersection
22	41985801	.	G	A	825.60	PASS	AC=6;AF=0.00367;AN=1634;DS;set=Intersection
22	41997072	.	G	T	239	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	41997217	.	GA	G	16664.04	PASS	AC=64;AF=0.03893;AN=1644;DS;set=Intersection
22	41999432	.	G	A	1003.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42000072	.	G	A	910.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42003243	.	A	G	915.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42003362	.	G	A	5235.05	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	42003373	.	T	C	164	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42003820	.	A	G	1149.60	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42016808	.	G	A	111.38	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42016862	.	C	G	1526.91	PASS	AC=13;AF=0.00817;AN=1592;DS;set=Intersection
22	42024073	.	CAAAT	C	772.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42024106	.	A	AT	13762.15	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	42032101	.	G	A	1005.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42032103	.	A	AT	19050.79	PASS	AC=132;AF=0.08029;AN=1644;DS;set=Intersection
22	42032277	.	G	C	607.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42032481	.	C	T	425.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42032610	.	C	T	868.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42032806	.	C	T	681.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42032815	.	A	G	696.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42033686	.	A	G	233.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42033821	.	C	A	698.08	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42042889	.	T	G	1108.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42043096	.	G	A	2815.04	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	42046861	.	C	T	823.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42046910	.	C	G	482.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42046936	.	G	C	1271	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42049736	.	A	G	705.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42052872	.	A	C	1090.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42054239	.	CATT	C	6578.03	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	42054365	.	G	A	851.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42054366	.	T	C	931.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42054373	.	G	C	1029.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42057294	.	C	T	6183.83	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	42057295	.	G	C	625.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42057308	.	C	G	820.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42059768	.	G	T	94593.91	PASS	AC=414;AF=0.25182;AN=1644;DS;set=Intersection
22	42059828	.	C	T	6728.60	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	42059854	.	G	T	6413.05	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	42076318	.	G	A	963.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42076330	.	G	A	30332.38	PASS	AC=63;AF=0.03832;AN=1644;DS;set=Intersection
22	42076372	.	T	TG	7440.76	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	42076381	.	C	A	261156.84	PASS	AC=1309;AF=0.79623;AN=1644;DS;set=Intersection
22	42078409	.	G	A	541.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42084790	.	G	A	190.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42095517	.	C	T	1357.42	PASS	AC=8;AF=0.00680;AN=1176;DS;set=Intersection
22	42095539	.	G	GGA	36562.74	PASS	AC=102;AF=0.08500;AN=1200;DS;set=Intersection
22	42095573	.	A	G	60.49	PASS	AC=1;AF=0.00088;AN=1138;DS;set=Intersection
22	42095603	.	G	A	3167.60	PASS	AC=13;AF=0.01155;AN=1126;DS;set=Intersection
22	42095644	.	C	T	891.52	PASS	AC=6;AF=0.00552;AN=1086;DS;set=Intersection
22	42095658	.	T	G	385.38	PASS	AC=7;AF=0.00663;AN=1056;DS;set=Intersection
22	42095711	.	G	C	934.32	PASS	AC=20;AF=0.01855;AN=1078;set=Intersection
22	42095725	.	G	A	5212.22	PASS	AC=73;AF=0.07101;AN=1028;set=Intersection
22	42099300	.	G	A	128.36	PASS	AC=1;AF=0.00089;AN=1120;set=Intersection
22	42099371	.	G	C	275.77	PASS	AC=1;AF=0.00087;AN=1146;set=Intersection
22	42099494	.	A	C	81.72	PASS	AC=1;AF=0.00088;AN=1130;set=Intersection
22	42101465	.	C	T	12299.07	PASS	AC=15;AF=0.01244;AN=1206;DS;set=Intersection
22	42101594	.	A	G	2681.22	PASS	AC=3;AF=0.00244;AN=1230;DS;set=Intersection
22	42110049	.	C	T	526.12	PASS	AC=2;AF=0.00141;AN=1420;set=Intersection
22	42112035	.	C	T	265.08	PASS	AC=2;AF=0.00145;AN=1376;set=Intersection
22	42114027	.	G	A	9179.24	PASS	AC=14;AF=0.01190;AN=1176;DS;set=Intersection
22	42114112	.	C	G	534.49	PASS	AC=1;AF=0.00083;AN=1202;DS;set=Intersection
22	42114122	.	G	T	1750.66	PASS	AC=2;AF=0.00165;AN=1214;DS;set=Intersection
22	42114160	.	A	G	2966.49	PASS	AC=5;AF=0.00404;AN=1238;DS;set=Intersection
22	42114306	.	G	A	627.71	PASS	AC=1;AF=0.00081;AN=1230;DS;set=Intersection
22	42120121	.	G	T	5519.61	PASS	AC=14;AF=0.01127;AN=1242;DS;set=Intersection
22	42125754	.	C	T	185.97	PASS	AC=1;AF=0.00062;AN=1614;set=Intersection
22	42126652	.	A	G	1068.48	PASS	AC=2;AF=0.00166;AN=1208;DS;set=Intersection
22	42126683	.	C	T	1593.20	PASS	AC=13;AF=0.01094;AN=1188;DS;set=Intersection
22	42128343	.	G	C	8273.44	PASS	AC=19;AF=0.01229;AN=1546;DS;set=Intersection
22	42128450	.	G	A	1143.73	PASS	AC=1;AF=0.00069;AN=1456;DS;set=Intersection
22	42128461	.	T	A	189730.17	PASS	AC=256;AF=0.17680;AN=1448;DS;set=Intersection
22	42128468	.	C	T	521.16	PASS	AC=1;AF=0.00069;AN=1446;DS;set=Intersection
22	42139043	.	G	A	270.12	PASS	AC=2;AF=0.00161;AN=1246;set=Intersection
22	42139054	.	G	A	156623.93	PASS	AC=1048;AF=0.82780;AN=1266;set=Intersection
22	42139078	.	A	G	192180.89	PASS	AC=1050;AF=0.82547;AN=1272;DS;set=Intersection
22	42139175	.	A	C	550.89	PASS	AC=1;AF=0.00083;AN=1210;DS;set=Intersection
22	42139215	.	C	T	2386.24	PASS	AC=4;AF=0.00332;AN=1206;DS;set=Intersection
22	42141069	.	G	A	65.70	PASS	AC=1;AF=0.00073;AN=1370;set=Intersection
22	42141111	.	G	A	242.82	PASS	AC=4;AF=0.00291;AN=1376;set=Intersection
22	42141117	.	G	A	145.94	PASS	AC=2;AF=0.00147;AN=1358;set=Intersection
22	42141871	.	C	CA	40110.88	PASS	AC=138;AF=0.11093;AN=1244;DS;set=Intersection
22	42141949	.	C	T	667.17	PASS	AC=1;AF=0.00080;AN=1248;DS;set=Intersection
22	42148633	.	G	A	183.91	PASS	AC=1;AF=0.00072;AN=1396;set=Intersection
22	42148678	.	T	C	141.26	PASS	AC=1;AF=0.00071;AN=1418;set=Intersection
22	42148689	.	A	G	286.89	PASS	AC=1;AF=0.00071;AN=1414;set=Intersection
22	42149910	.	T	C	1518.65	PASS	AC=2;AF=0.00163;AN=1226;DS;set=Intersection
22	42149991	.	A	G	853.70	PASS	AC=1;AF=0.00081;AN=1238;DS;set=Intersection
22	42154380	.	G	A	748.88	PASS	AC=1;AF=0.00078;AN=1288;DS;set=Intersection
22	42154386	.	G	C	13304.87	PASS	AC=21;AF=0.01667;AN=1260;DS;set=Intersection
22	42154430	.	T	C	67793.11	PASS	AC=103;AF=0.07875;AN=1308;DS;set=Intersection
22	42154546	.	A	G	6565.03	PASS	AC=15;AF=0.01046;AN=1434;DS;set=Intersection
22	42154579	.	C	A	916.04	PASS	AC=2;AF=0.00144;AN=1388;DS;set=Intersection
22	42159229	.	G	T	297683.59	PASS	AC=1080;AF=0.83333;AN=1296;DS;set=Intersection
22	42159255	.	C	T	611.36	PASS	AC=1;AF=0.00078;AN=1288;DS;set=Intersection
22	42159270	.	A	G	1679.40	PASS	AC=2;AF=0.00153;AN=1306;DS;set=Intersection
22	42159297	.	G	C	738.81	PASS	AC=1;AF=0.00078;AN=1286;DS;set=Intersection
22	42166724	.	G	A	10189.36	PASS	AC=16;AF=0.01256;AN=1274;DS;set=Intersection
22	42166729	.	C	T	64.97	PASS	AC=1;AF=0.00078;AN=1282;DS;set=Intersection
22	42166956	.	C	T	780.74	PASS	AC=1;AF=0.00076;AN=1308;DS;set=Intersection
22	42172056	.	TC	T	903.84	PASS	AC=1;AF=0.00080;AN=1244;DS;set=Intersection
22	42172080	.	C	T	187096.87	PASS	AC=369;AF=0.28828;AN=1280;DS;set=Intersection
22	42172118	.	T	A	17838	PASS	AC=17;AF=0.01326;AN=1282;DS;set=Intersection
22	42174779	.	A	G	4877.66	PASS	AC=16;AF=0.01214;AN=1318;set=Intersection
22	42177317	.	A	G	6121.43	PASS	AC=35;AF=0.02616;AN=1338;set=Intersection
22	42177684	.	G	A	234.69	PASS	AC=1;AF=0.00075;AN=1342;DS;set=Intersection
22	42177816	.	C	A	120637.61	PASS	AC=225;AF=0.16187;AN=1390;DS;set=Intersection
22	42177822	.	T	C	351.37	PASS	AC=1;AF=0.00072;AN=1386;DS;set=Intersection
22	42177825	.	C	T	756.50	PASS	AC=1;AF=0.00073;AN=1378;DS;set=Intersection
22	42177841	.	A	G	467.10	PASS	AC=1;AF=0.00074;AN=1356;DS;set=Intersection
22	42177899	.	A	G	53538.24	PASS	AC=214;AF=0.16114;AN=1328;DS;set=Intersection
22	42180400	.	A	G	5159.72	PASS	AC=5;AF=0.00391;AN=1278;DS;set=Intersection
22	42180441	.	C	A	18561.09	PASS	AC=23;AF=0.01803;AN=1276;DS;set=Intersection
22	42180458	.	C	T	500.15	PASS	AC=2;AF=0.00160;AN=1250;DS;set=Intersection
22	42180584	.	T	C	96570.64	PASS	AC=213;AF=0.16410;AN=1298;DS;set=Intersection
22	42180679	.	G	A	349.01	PASS	AC=1;AF=0.00085;AN=1172;DS;set=Intersection
22	42189810	.	A	AT	6866.58	PASS	AC=593;AF=0.47138;AN=1258;set=Intersection
22	42190388	.	C	T	992.45	PASS	AC=1;AF=0.00079;AN=1270;DS;set=Intersection
22	42191507	.	G	A	2884.82	PASS	AC=3;AF=0.00212;AN=1412;DS;set=Intersection
22	42191540	.	C	T	107935.68	PASS	AC=219;AF=0.16270;AN=1346;DS;set=Intersection
22	42191798	.	G	A	1310.96	PASS	AC=2;AF=0.00151;AN=1326;DS;set=Intersection
22	42191844	.	G	T	2028.94	PASS	AC=4;AF=0.00283;AN=1414;DS;set=Intersection
22	42195237	.	C	T	357.97	PASS	AC=1;AF=0.00068;AN=1474;DS;set=Intersection
22	42195324	.	A	G	609.35	PASS	AC=1;AF=0.00069;AN=1450;DS;set=Intersection
22	42195345	.	C	T	856.62	PASS	AC=1;AF=0.00070;AN=1438;DS;set=Intersection
22	42204854	.	C	T	1821.26	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42204918	.	C	A	757.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42204946	.	A	T	1038.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42205043	.	T	C	1027.76	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42205863	.	C	T	984.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42205957	.	C	T	792.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42206019	.	G	A	779.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42206050	.	C	T	1779.22	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	42206280	.	G	A	196.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42206303	.	C	T	501.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42209251	.	C	A	661.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42209258	.	C	T	10202.81	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	42209279	.	G	A	727.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42209326	.	G	A	6310.69	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	42209356	.	C	T	927.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42209418	.	A	G	773.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42221714	.	A	G	13656.06	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	42221786	.	C	T	488.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42221808	.	G	A	622.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42221811	.	C	T	1042.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42221836	.	C	A	691.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42221846	.	C	T	111690.27	PASS	AC=219;AF=0.13321;AN=1644;DS;set=Intersection
22	42229249	.	G	T	250.56	PASS	AC=1;AF=0.00094;AN=1060;set=Intersection
22	42262921	.	G	A	369.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42262930	.	AGCAGCAGCG	A	1357.91	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42263050	.	C	G	1050.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42263112	.	C	A	27506.48	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	42264726	.	A	C	217.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42264732	.	C	T	539.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42264751	.	G	A	498.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42264775	.	G	A	6725.04	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	42264796	.	G	A	1498.36	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42266992	.	C	T	621.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42267054	.	C	T	1980.24	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42269767	.	G	A	1107.51	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	42271293	.	T	C	8280.41	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	42271363	.	G	A	834.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42271491	.	C	T	1379.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42271495	.	G	A	1780.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42271533	.	G	A	624.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42271539	.	C	T	953.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42271653	.	C	A	731.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42271760	.	A	G	3013.74	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42273264	.	C	T	745.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42273269	.	G	C	744.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42273340	.	T	C	949.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42273418	.	C	T	1042.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42273443	.	G	C	723.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42273462	.	G	A	55910.92	PASS	AC=143;AF=0.08698;AN=1644;DS;set=Intersection
22	42273467	.	A	T	36.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42273933	.	C	T	5380.36	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	42273963	.	G	A	559.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42274034	.	G	T	23359.95	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	42274076	.	C	T	986.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42274135	.	C	A	600.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42276742	.	G	C	219512.30	PASS	AC=611;AF=0.37165;AN=1644;DS;set=Intersection
22	42276792	.	C	T	473.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42276825	.	G	A	28375.66	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	42276857	.	G	A	965.85	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42276895	.	G	A	349.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42276957	.	G	T	327.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42280875	.	G	A	1684.53	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42280889	.	G	A	967.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42289096	.	A	G	1687.81	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42289164	.	A	G	953.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42289299	.	C	G	189.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42289317	.	T	C	22197.42	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	42290857	.	G	A	1460.76	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42290962	.	C	T	87.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42290984	.	C	T	1089.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42293026	.	T	C	399.60	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42293140	.	G	C	21367.92	PASS	AC=113;AF=0.06873;AN=1644;DS;set=Intersection
22	42293178	.	G	A	262.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42293205	.	G	T	247.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42294613	.	C	T	784.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42294751	.	G	C	2223.20	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	42294806	.	A	G	165.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42296330	.	G	A	433.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42298957	.	C	T	169.26	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	42299074	.	C	T	515.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42299116	.	G	A	145.06	PASS	AC=2;AF=0.00123;AN=1630;DS;set=Intersection
22	42299177	.	G	C	39.07	PASS	AC=1;AF=0.00063;AN=1588;set=Intersection
22	42299183	.	G	A	53.24	PASS	AC=3;AF=0.00190;AN=1580;set=Intersection
22	42300878	.	T	C	272.47	PASS	AC=3;AF=0.00184;AN=1634;set=Intersection
22	42300948	.	C	A	6048.40	PASS	AC=99;AF=0.06059;AN=1634;set=Intersection
22	42301014	.	A	G	5317.02	PASS	AC=146;AF=0.08990;AN=1624;set=Intersection
22	42301409	.	G	A	51.96	PASS	AC=1;AF=0.00063;AN=1596;set=Intersection
22	42301434	.	C	T	4523.29	PASS	AC=61;AF=0.03789;AN=1610;set=Intersection
22	42301477	.	G	A	122.23	PASS	AC=1;AF=0.00063;AN=1598;set=Intersection
22	42301535	.	G	A	43.98	PASS	AC=1;AF=0.00062;AN=1616;set=Intersection
22	42301537	.	G	A	299.37	PASS	AC=1;AF=0.00062;AN=1620;set=Intersection
22	42301554	.	C	T	271.61	PASS	AC=5;AF=0.00308;AN=1622;set=Intersection
22	42301655	.	C	T	50.61	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	42301690	.	CCTCTCTCTCGATTT	C	778.99	PASS	AC=1;AF=0.00062;AN=1616;DS;set=Intersection
22	42301712	.	T	C	11081.27	PASS	AC=233;AF=0.14710;AN=1584;DS;set=Intersection
22	42321451	.	G	A	2246.54	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	42321584	.	C	T	369.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42321591	.	A	G	59534.20	PASS	AC=217;AF=0.13200;AN=1644;DS;set=Intersection
22	42322087	.	C	T	534.02	PASS	AC=5;AF=0.00306;AN=1636;DS;set=Intersection
22	42322155	.	C	T	90.21	PASS	AC=1;AF=0.00064;AN=1562;DS;set=Intersection
22	42322190	.	G	A	1102.63	PASS	AC=5;AF=0.00308;AN=1624;DS;set=Intersection
22	42322243	.	G	A	549.52	PASS	AC=13;AF=0.00905;AN=1436;DS;set=Intersection
22	42322716	.	G	C	114.67	PASS	AC=17;AF=0.0350;AN=486;set=Intersection
22	42335147	.	G	A	198.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42336172	.	G	A	17530.36	PASS	AC=423;AF=0.27220;AN=1554;set=Intersection
22	42341201	.	G	T	185.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42341205	.	G	A	883.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42341308	.	A	G	95327.47	PASS	AC=430;AF=0.26156;AN=1644;DS;set=Intersection
22	42341934	.	A	G	21306.52	PASS	AC=104;AF=0.06326;AN=1644;DS;set=Intersection
22	42341979	.	G	A	422.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42342462	.	C	T	6340.18	PASS	AC=19;AF=0.01156;AN=1644;set=Intersection
22	42342470	.	G	A	54.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42342977	.	G	C	188.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42342995	.	G	T	670.14	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42342996	.	C	T	686.90	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42343017	.	C	T	6076.99	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	42343091	.	G	A	103304.95	PASS	AC=623;AF=0.37895;AN=1644;DS;set=Intersection
22	42377667	.	C	A	461.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42377851	.	C	T	217.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42377878	.	G	A	92359.64	PASS	AC=273;AF=0.16606;AN=1644;DS;set=Intersection
22	42382109	.	C	T	577.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42382126	.	A	G	1022.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42383244	.	C	T	690.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42383583	.	T	C	49969.27	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	42385696	.	G	T	788.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42385700	.	C	G	283.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42385701	.	C	G	444.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42385720	.	C	T	44529.79	PASS	AC=52;AF=0.03163;AN=1644;DS;set=Intersection
22	42385731	.	C	T	1318.43	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42387568	.	C	T	1347.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42387596	.	T	C	989.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42387654	.	G	A	28114.36	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	42387681	.	C	T	977.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42387705	.	G	A	741.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42388638	.	G	A	816.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42390393	.	G	C	1116.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42390746	.	G	A	754.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42390786	.	A	C	653.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42392945	.	G	A	701.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42394785	.	C	T	2342.58	PASS	AC=13;AF=0.00795;AN=1636;DS;set=Intersection
22	42394794	.	C	G	277.53	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	42394835	.	C	G	10460.79	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	42415292	.	C	G	796.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42415326	.	G	A	1102.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42415359	.	G	A	1408.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42415381	.	T	C	2314.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42415433	.	A	G	1227.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42415437	.	C	G	1316.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42415457	.	ACT	A	13588.78	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	42415744	.	A	G	998.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42415831	.	T	C	1055.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42415841	.	TC	T	740.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42416056	.	A	G	247054.65	PASS	AC=926;AF=0.56326;AN=1644;DS;set=Intersection
22	42416137	.	G	T	756.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42418204	.	A	G	944.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42418249	.	C	G	790.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42418265	.	T	G	857.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42418294	.	A	C	860	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42418333	.	A	C	734.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42418340	.	C	G	1086.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42418355	.	G	T	48404.28	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	42422777	.	CTATGGAGCCCCACCTGCAGGA	C	2803.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42422876	.	T	C	1777.29	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42422973	.	GCCCCACCTCTTGGATATGGAA	G	62.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42423052	.	A	G	985.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42423069	.	G	A	13025.26	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	42423110	.	G	C	327764.44	PASS	AC=1275;AF=0.77555;AN=1644;DS;set=Intersection
22	42456238	.	C	A	998.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42456265	.	G	A	461.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42456271	.	T	G	32802.65	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	42456373	.	A	G	1904.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42456461	.	G	T	74411.17	PASS	AC=94;AF=0.05718;AN=1644;DS;set=Intersection
22	42456944	.	C	A	381.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42457043	.	C	T	926.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42458827	.	G	C	27687.46	PASS	AC=61;AF=0.03710;AN=1644;DS;set=Intersection
22	42458942	.	C	T	85.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42458951	.	G	T	529.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42459021	.	A	G	664.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42459035	.	G	T	4821.17	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	42461804	.	C	T	785.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42461883	.	C	T	592.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42461918	.	G	A	47452.69	PASS	AC=247;AF=0.15024;AN=1644;DS;set=Intersection
22	42462729	.	G	A	42.01	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	42463071	.	C	T	1653.95	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	42463091	.	G	A	2533.72	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42463114	.	C	T	641.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463140	.	G	C	447.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463165	.	T	C	483.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463213	.	C	T	1077.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463244	.	G	A	1097.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463267	.	T	C	881.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463302	.	G	A	777.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463342	.	G	A	711.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463736	.	T	C	868.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463768	.	C	T	961.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463769	.	G	A	708.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463813	.	C	T	1874.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42463814	.	C	T	252815.74	PASS	AC=1152;AF=0.70073;AN=1644;DS;set=Intersection
22	42463897	.	C	T	627.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42463976	.	C	T	1075.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42464570	.	G	A	408.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42464614	.	G	A	2174.24	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	42464617	.	G	T	227.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42464618	.	C	T	194.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42473288	.	C	T	24492.01	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	42473376	.	TG	T	1057.59	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42473426	.	C	T	624.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42473509	.	G	A	628.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42473528	.	C	T	4772.98	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42473586	.	C	T	25293.69	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	42473603	.	C	T	146547.37	PASS	AC=599;AF=0.36436;AN=1644;DS;set=Intersection
22	42473671	.	G	A	888.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42473683	.	G	A	448.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42473684	.	C	T	911.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42473774	.	C	T	167.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42473860	.	C	G	34525.44	PASS	AC=288;AF=0.17518;AN=1644;DS;set=Intersection
22	42473883	.	G	A	441.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42473927	.	A	C	170.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42473990	.	T	C	100.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42474002	.	C	T	1480.45	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	42474068	.	T	G	827.61	PASS	AC=6;AF=0.00365;AN=1644;set=Intersection
22	42475797	.	C	T	155.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42475860	.	G	A	972.62	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42475898	.	G	C	170.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42475948	.	A	G	556.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42475971	.	C	T	794.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42476004	.	T	C	554.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42477884	.	A	G	614.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42477935	.	T	A	846.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42477982	.	C	T	827.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42478045	.	G	C	1070.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42478099	.	G	A	425.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42482164	.	G	A	2770.25	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42482177	.	C	A	919.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42482195	.	C	T	657.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42482252	.	G	A	1941.07	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42482368	.	A	G	986.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42483046	.	T	G	12970.63	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	42483090	.	T	C	2224.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42483134	.	T	G	922.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42483169	.	G	T	637.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42486611	.	A	G	653.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42486662	.	C	T	740.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42486701	.	G	A	2758.91	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42486713	.	G	A	752.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42486723	.	G	A	162230.77	PASS	AC=529;AF=0.32178;AN=1644;DS;set=Intersection
22	42486742	.	C	T	300.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42486755	.	A	C	1800.72	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42486789	.	G	A	1094.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42486842	.	G	GC	5767.23	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	42522613	.	G	C	103084.65	PASS	AC=679;AF=0.41352;AN=1642;DS;set=Intersection
22	42523639	.	G	GGACA	760.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42523805	.	C	T	18831.37	PASS	AC=90;AF=0.05481;AN=1642;DS;set=Intersection
22	42523809	.	C	T	456.79	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42523813	.	G	A	868.46	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	42523832	.	A	AGAT	953.98	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42523833	.	G	A	498.88	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42523835	.	T	C	532.65	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42523854	.	C	T	346.86	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42523871	.	G	A	652.18	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42523872	.	C	T	542.10	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42523896	.	C	T	583.53	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42524033	.	A	T	600.22	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42524130	.	C	T	4803.17	PASS	AC=19;AF=0.01157;AN=1642;DS;set=Intersection
22	42524175	.	CCTT	C	5606.08	PASS	AC=25;AF=0.01523;AN=1642;DS;set=Intersection
22	42524191	.	C	A	7529.98	PASS	AC=19;AF=0.01157;AN=1642;DS;set=Intersection
22	42524213	.	C	CG	941.44	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42524243	.	CT	C	5259.98	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	42524322	.	T	G	1017.98	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42524820	.	T	TC	341.88	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	42525046	.	G	A	349.15	PASS	AC=2;AF=0.00122;AN=1636;DS;set=Intersection
22	42525085	.	CA	C	735.93	PASS	AC=12;AF=0.00743;AN=1614;set=Intersection
22	42525134	.	C	T	8507.19	PASS	AC=36;AF=0.02258;AN=1594;DS;set=Intersection
22	42525728	.	A	C	12920.63	PASS	AC=33;AF=0.02022;AN=1632;DS;set=Intersection
22	42525756	.	G	A	45036.61	PASS	AC=298;AF=0.18193;AN=1638;DS;set=Intersection
22	42525772	.	G	A	24364.46	PASS	AC=68;AF=0.04167;AN=1632;DS;set=Intersection
22	42525801	.	G	C	152.05	PASS	AC=1;AF=0.00063;AN=1582;DS;set=Intersection
22	42526763	.	C	T	6319.87	PASS	AC=41;AF=0.02497;AN=1642;DS;set=Intersection
22	42526778	.	G	A	417.82	PASS	AC=1;AF=0.00061;AN=1632;DS;set=Intersection
22	42526836	.	A	AC	2388.55	PASS	AC=35;AF=0.02174;AN=1610;DS;set=Intersection
22	42557344	.	T	C	167.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42557356	.	C	T	945.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42557363	.	A	G	768.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42557413	.	C	A	144.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42564698	.	C	T	61.89	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	42564718	.	G	A,C,T	889.43	PASS	AC=3,1,1;AF=0.00182,0.00061,0.00061;AN=1644;DS;set=Intersection
22	42564732	.	G	A	670.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42564750	.	G	A	79.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42565835	.	T	C	5795.06	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	42565950	.	T	C	69159.86	PASS	AC=95;AF=0.05779;AN=1644;DS;set=Intersection
22	42575632	.	G	A	1439.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42575687	.	C	T	795.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42575719	.	G	A	859.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42605724	.	T	C	789.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42605821	.	T	C	2037.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42605878	.	C	T	1096.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42606257	.	C	T	100250.14	PASS	AC=420;AF=0.25547;AN=1644;DS;set=Intersection
22	42606263	.	C	T	1322.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42606744	.	G	A	1066.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42606818	.	A	G	790.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42606905	.	T	C	5452.79	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	42606992	.	G	A	1600.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42607071	.	G	A	977.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42607085	.	T	C	487.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42607160	.	A	G	844.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42607194	.	G	A	1025.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42607338	.	C	T	14932.22	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	42607451	.	T	A	1108.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42607652	.	T	A	1031.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42607690	.	T	C	744.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42607817	.	C	T	40477.75	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	42607937	.	C	T	1004.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42607947	.	C	G	796.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42608024	.	C	T	422.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42608203	.	T	C	997.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42608238	.	C	A	707.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42608314	.	C	G	576.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42608432	.	A	G	547.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42608515	.	A	G	1296.91	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42608568	.	A	C	614.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42608574	.	C	T	1127.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42609148	.	T	C	81021.49	PASS	AC=330;AF=0.20073;AN=1644;DS;set=Intersection
22	42609249	.	G	A	1125.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42609539	.	C	T	919.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42609579	.	C	G	821.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42609845	.	G	A	5659.59	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	42609858	.	G	T	1983.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42609871	.	G	A	817.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42609872	.	A	C	42500.38	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	42610099	.	T	C	56829.48	PASS	AC=118;AF=0.07178;AN=1644;DS;set=Intersection
22	42610256	.	A	G	2400.35	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42610336	.	G	C	995.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42610343	.	GTGT	G	1047.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42610547	.	C	T	865.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42610583	.	G	A	656.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42610653	.	G	A	1036.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42610728	.	G	T	905.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42610793	.	G	A	6974.93	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	42610871	.	G	A	15225.27	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	42610958	.	A	G	4524.70	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42610968	.	A	G	724.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42611053	.	C	T	929.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42611077	.	A	AACC	1475.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42611099	.	G	A	801.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42611108	.	C	T	10410.87	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	42611113	.	C	A	720.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42611114	.	C	T	832.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42611115	.	G	A	1479.01	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42611144	.	ACCACTG	A	1067.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42611174	.	G	A	33275.92	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	42611265	.	C	G	4766.14	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	42611360	.	G	A	961.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42781187	.	G	A	10983.27	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	42781198	.	C	G	11174.22	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	42781200	.	A	G	2374.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42781208	.	C	T	725.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42781209	.	G	A	914.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42781219	.	G	A	1241.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42782982	.	A	T	890.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42782985	.	G	A	808.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42783019	.	G	A	70316.93	PASS	AC=120;AF=0.07299;AN=1644;DS;set=Intersection
22	42783064	.	G	A	1131.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42783070	.	G	A	34204.06	PASS	AC=152;AF=0.09246;AN=1644;DS;set=Intersection
22	42783096	.	G	A	6399.11	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	42783130	.	G	T	12197.94	PASS	AC=83;AF=0.05049;AN=1644;DS;set=Intersection
22	42793845	.	C	T	57112.50	PASS	AC=211;AF=0.12835;AN=1644;DS;set=Intersection
22	42793846	.	G	A	709.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42793873	.	A	G	61354.65	PASS	AC=211;AF=0.12835;AN=1644;DS;set=Intersection
22	42793987	.	C	T	251.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42794001	.	T	C	1572.98	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	42805436	.	C	T	302	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42805437	.	G	A	827.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42805444	.	G	C	31479.70	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	42805496	.	G	GTGA	1427.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42805531	.	C	T	2461.86	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	42805580	.	G	T	301.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42807401	.	A	G	26390.89	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	42807455	.	G	A	6701.41	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	42807612	.	A	G	818.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42828212	.	G	T	197.73	PASS	AC=1;AF=0.00062;AN=1624;DS;set=Intersection
22	42828277	.	G	A	427.40	PASS	AC=1;AF=0.00061;AN=1628;DS;set=Intersection
22	42828404	.	G	A	93.12	PASS	AC=3;AF=0.00185;AN=1620;set=Intersection
22	42908870	.	T	G	12623.60	PASS	AC=161;AF=0.09805;AN=1642;DS;set=Intersection
22	42908897	.	T	C	22646.13	PASS	AC=235;AF=0.14294;AN=1644;DS;set=Intersection
22	42908903	.	C	A	8214.69	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	42910142	.	C	T	18878.19	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	42910685	.	T	TA	4556.98	PASS	AC=131;AF=0.07988;AN=1640;DS;set=Intersection
22	42910786	.	C	CT	571.13	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	42911973	.	C	CCCA	683.03	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	42911980	.	C	G	6959.34	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	42911981	.	C	G	430.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42912011	.	G	A	959.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42912024	.	G	A	244.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42912029	.	G	T	85879.94	PASS	AC=348;AF=0.21168;AN=1644;DS;set=Intersection
22	42912091	.	A	G	238.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42912097	.	C	T	33003.52	PASS	AC=161;AF=0.09793;AN=1644;DS;set=Intersection
22	42912106	.	C	T	121874.78	PASS	AC=437;AF=0.26582;AN=1644;DS;set=Intersection
22	42912136	.	G	T	15403.76	PASS	AC=119;AF=0.07238;AN=1644;DS;set=Intersection
22	42913971	.	T	C	975.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42915711	.	G	T	316.82	PASS	AC=8;AF=0.00635;AN=1260;set=Intersection
22	42915803	.	G	A	33.49	PASS	AC=3;AF=0.00245;AN=1224;set=Intersection
22	42949982	.	C	T	60.36	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	42950004	.	A	G	1912.07	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	42950033	.	G	A	2737.23	PASS	AC=11;AF=0.00672;AN=1636;DS;set=Intersection
22	42950055	.	C	T	1284.67	PASS	AC=8;AF=0.00489;AN=1636;DS;set=Intersection
22	42952488	.	CT	C	3766.10	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	42956183	.	TC	T	159.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42956189	.	C	T	19698.65	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	42956211	.	C	T	635.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42956224	.	A	C	561.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42956273	.	T	A	2717.67	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42956284	.	A	G	292.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42962329	.	C	T	1630.94	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	42962330	.	C	T	903.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42962356	.	T	G	6354.69	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	42962359	.	C	T	1994.68	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42967257	.	C	T	621.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42968536	.	G	A	21268.91	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	42969938	.	CCAG	C	607.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42981795	.	G	A	1205.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42981840	.	G	A	514.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42981860	.	T	C	861.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42981890	.	G	A	124233.10	PASS	AC=207;AF=0.12591;AN=1644;DS;set=Intersection
22	42981961	.	T	A	698.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42982018	.	C	T	1273.81	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	42983467	.	A	G	1944.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42983472	.	C	T	1562.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42983560	.	T	C	821.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42983620	.	C	T	709.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42988031	.	C	T	994.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42988076	.	C	T	685.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42988117	.	T	C	89383.07	PASS	AC=262;AF=0.15937;AN=1644;DS;set=Intersection
22	42988118	.	G	C	629.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42992147	.	C	T	1869.62	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42992251	.	T	C	1097.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42992275	.	A	C	607.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42992355	.	GA	G	282.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42992386	.	A	G	337.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42992387	.	GA	G	5732.82	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	42995674	.	C	T	1783.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42995724	.	C	T	823.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42995754	.	G	C	527.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42997957	.	T	TCTCA	35967.95	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	42998007	.	A	G	4776.49	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	42998030	.	A	G	933.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42998054	.	C	T	1788.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	42998731	.	T	G	449.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42998740	.	G	A	3155.56	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	42998759	.	C	CA	5628.22	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	42998846	.	G	A	1155.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	42998902	.	G	T	9762.94	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	42999138	.	C	T	1083.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43010817	.	G	A	54353.81	PASS	AC=178;AF=0.10827;AN=1644;DS;set=Intersection
22	43010821	.	C	T	906.74	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	43010889	.	C	T	180.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43010909	.	C	A	182.69	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	43015787	.	C	T	753.48	PASS	AC=9;AF=0.00556;AN=1618;set=Intersection
22	43015795	.	C	T	57.64	PASS	AC=2;AF=0.00123;AN=1624;set=Intersection
22	43015977	.	T	G	1717.07	PASS	AC=13;AF=0.00793;AN=1640;DS;set=Intersection
22	43019769	.	C	T	825.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43019817	.	GTACCAGAGCTTGAAGCGTGCA	G	433.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43019826	.	C	T	419.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43019843	.	G	A	247.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43019943	.	C	G	1462.54	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43023263	.	C	T	412.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023295	.	G	A	504	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023368	.	C	T	833.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023409	.	G	C	476.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023429	.	G	C	404.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023432	.	C	T	1372.51	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	43023563	.	C	T	827.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023579	.	C	T	293.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023586	.	C	G	1233.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43023599	.	G	T	406.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023621	.	C	T	917.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023622	.	G	A	469.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43023687	.	G	A	501.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43024119	.	G	A	691.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43024145	.	C	T	1184.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43024189	.	G	A	990.79	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43024214	.	A	G	1030.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43024271	.	G	C	128114.54	PASS	AC=107;AF=0.06509;AN=1644;DS;set=Intersection
22	43024318	.	C	T	439.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43026905	.	C	T	1028.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43026908	.	A	C	759.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43026924	.	G	A	5125.53	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	43027000	.	G	A	361.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43027356	.	G	A	63106.50	PASS	AC=405;AF=0.31011;AN=1306;DS;set=Intersection
22	43032742	.	C	T	25405.24	PASS	AC=159;AF=0.09672;AN=1644;DS;set=Intersection
22	43032757	.	C	T	804.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43032829	.	T	C	5093.91	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	43032843	.	T	C	4725.47	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	43032870	.	G	T	82435.23	PASS	AC=382;AF=0.23236;AN=1644;DS;set=Intersection
22	43088856	.	C	T	571.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43088890	.	G	A	412.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43088902	.	G	A	407.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43088928	.	T	TG	213.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43088971	.	C	T	73405.41	PASS	AC=524;AF=0.31873;AN=1644;DS;set=Intersection
22	43089044	.	G	A	470.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43089055	.	G	C	128244.50	PASS	AC=1095;AF=0.66606;AN=1644;DS;set=Intersection
22	43089066	.	C	A	506.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43089109	.	G	A	1028.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43089281	.	C	T	764.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43089289	.	G	A	12283.66	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	43089400	.	G	A	3083.93	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	43089464	.	C	T	1948.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43089470	.	T	C	14711.41	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	43089517	.	C	T	2628.12	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	43089591	.	A	G	6253.22	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	43089658	.	C	G	24219.40	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	43089753	.	G	A	660.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43089757	.	G	C	645.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43089849	.	T	C	46738.95	PASS	AC=527;AF=0.32056;AN=1644;DS;set=Intersection
22	43089858	.	C	T	5802.67	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	43089997	.	G	A	63.58	PASS	AC=1;AF=0.00062;AN=1604;DS;set=Intersection
22	43193576	.	C	T	660.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43193579	.	A	G	12695.04	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	43193590	.	A	G	12268.92	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	43193603	.	G	A	17703.34	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	43193641	.	G	A	144448.02	PASS	AC=514;AF=0.31265;AN=1644;DS;set=Intersection
22	43195109	.	T	C	2011.37	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	43195114	.	G	C	1944.24	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43195134	.	C	T	22962.54	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	43195147	.	A	G	164630.28	PASS	AC=560;AF=0.34063;AN=1644;DS;set=Intersection
22	43195164	.	T	C	708.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43195172	.	C	T	8157.57	PASS	AC=43;AF=0.02616;AN=1644;DS;set=Intersection
22	43195179	.	A	G	1937.89	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43195194	.	A	T	822.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43203086	.	C	A	617.32	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43203137	.	C	T	78964.10	PASS	AC=474;AF=0.28867;AN=1642;DS;set=Intersection
22	43203210	.	T	C	12528.63	PASS	AC=46;AF=0.02808;AN=1638;DS;set=Intersection
22	43204800	.	C	T	869.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43204801	.	A	G	1027.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43204809	.	T	C	961.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43204882	.	C	T	4636.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43206775	.	A	G	1247.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43206781	.	G	T	868.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43206882	.	T	C	15386.77	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	43206950	.	A	C	271263.89	PASS	AC=1114;AF=0.67762;AN=1644;DS;set=Intersection
22	43213215	.	T	G	1241.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43213217	.	G	A	723.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43213262	.	G	A	6255.15	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	43213266	.	T	A	13623.44	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	43213278	.	A	T	376.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43213761	.	G	A	818.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43218227	.	A	G	457.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43218254	.	A	G	23092.99	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	43218397	.	T	C	16620.95	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	43218435	.	A	G	1444.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43218446	.	G	A	17505.74	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	43218463	.	C	T	292124.91	PASS	AC=1099;AF=0.66849;AN=1644;DS;set=Intersection
22	43219712	.	C	T	3162.82	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	43222925	.	G	A	808.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43222927	.	A	G	378.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43223032	.	C	T	7325.22	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	43227519	.	T	C	950.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43227524	.	T	C	1079.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43227529	.	T	C	155.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43227577	.	T	C	2274.70	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43227592	.	T	C	949.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43227654	.	C	T	267.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43230224	.	AATGATGTGAAGCATAAT	A	5513.34	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43230229	.	T	C	749.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43230266	.	G	A	22027.73	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	43230278	.	T	C	1016.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43231360	.	T	C	1110.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43231515	.	T	C	11970.37	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	43231532	.	G	C	1147.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43231541	.	C	T	505.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43237072	.	C	A	9596.13	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	43243552	.	G	A	800.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43253126	.	A	C	90.74	PASS	AC=1;AF=0.00076;AN=1320;set=Intersection
22	43253204	.	G	A,C,T	869.52	PASS	AC=3,13,0;AF=0.00223,0.00966,0.00000;AN=1346;DS;set=Intersection
22	43267326	.	G	A	782.11	PASS	AC=5;AF=0.00395;AN=1266;set=Intersection
22	43267328	.	C	T	178.85	PASS	AC=1;AF=0.00078;AN=1288;set=Intersection
22	43267336	.	T	TC	37460.01	PASS	AC=461;AF=0.33798;AN=1364;DS;set=Intersection
22	43267356	.	C	T	1090.84	PASS	AC=1;AF=0.00070;AN=1420;DS;set=Intersection
22	43267405	.	T	C	1205.31	PASS	AC=2;AF=0.00130;AN=1538;DS;set=Intersection
22	43267515	.	A	G	510.13	PASS	AC=1;AF=0.00071;AN=1406;DS;set=Intersection
22	43267522	.	C	T	630.34	PASS	AC=1;AF=0.00071;AN=1404;DS;set=Intersection
22	43272108	.	C	A	923.47	PASS	AC=1;AF=0.00075;AN=1342;DS;set=Intersection
22	43272116	.	C	T	14740.76	PASS	AC=17;AF=0.01263;AN=1346;DS;set=Intersection
22	43272195	.	C	G	4500.33	PASS	AC=5;AF=0.00362;AN=1380;DS;set=Intersection
22	43272283	.	G	A	903.57	PASS	AC=1;AF=0.00076;AN=1322;DS;set=Intersection
22	43272291	.	G	A	4626.72	PASS	AC=5;AF=0.00382;AN=1308;DS;set=Intersection
22	43272384	.	G	A	3156.69	PASS	AC=22;AF=0.01774;AN=1240;DS;set=Intersection
22	43272854	.	G	C	969.03	PASS	AC=1;AF=0.00071;AN=1408;DS;set=Intersection
22	43272856	.	G	A	632.83	PASS	AC=1;AF=0.00071;AN=1408;DS;set=Intersection
22	43272982	.	C	T	1300.42	PASS	AC=3;AF=0.00206;AN=1456;DS;set=Intersection
22	43273063	.	C	A	776.41	PASS	AC=2;AF=0.00150;AN=1330;DS;set=Intersection
22	43275010	.	C	T	139.80	PASS	AC=1;AF=0.00083;AN=1202;DS;set=Intersection
22	43275082	.	C	T	517.78	PASS	AC=2;AF=0.00160;AN=1252;DS;set=Intersection
22	43275083	.	G	A	1049.98	PASS	AC=1;AF=0.00080;AN=1248;DS;set=Intersection
22	43275113	.	G	A	454.98	PASS	AC=3;AF=0.00236;AN=1270;DS;set=Intersection
22	43278148	.	C	T	86213.09	PASS	AC=450;AF=0.32514;AN=1384;DS;set=Intersection
22	43278162	.	T	C	97657.79	PASS	AC=477;AF=0.34666;AN=1376;DS;set=Intersection
22	43278180	.	C	T	3067.56	PASS	AC=5;AF=0.00368;AN=1358;DS;set=Intersection
22	43278220	.	C	T	88828.81	PASS	AC=461;AF=0.33503;AN=1376;DS;set=Intersection
22	43278230	.	T	C	811.20	PASS	AC=1;AF=0.00072;AN=1394;DS;set=Intersection
22	43280363	.	G	A	1454.74	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43280466	.	C	T	643.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43284643	.	G	A	1091.93	PASS	AC=1;AF=0.00072;AN=1386;DS;set=Intersection
22	43284734	.	T	C	19469.42	PASS	AC=17;AF=0.01171;AN=1452;DS;set=Intersection
22	43284802	.	T	C	5538.72	PASS	AC=4;AF=0.00278;AN=1438;DS;set=Intersection
22	43286904	.	G	A	129.47	PASS	AC=1;AF=0.00063;AN=1592;set=Intersection
22	43286924	.	G	A	654.45	PASS	AC=2;AF=0.00124;AN=1612;set=Intersection
22	43287108	.	C	A,T	587.65	PASS	AC=1,1;AF=0.00062,0.00062;AN=1624;DS;set=Intersection
22	43287160	.	G	C	104.14	PASS	AC=1;AF=0.00062;AN=1612;DS;set=Intersection
22	43287173	.	G	A	631.80	PASS	AC=1;AF=0.00063;AN=1596;DS;set=Intersection
22	43287237	.	G	A	6223.57	PASS	AC=11;AF=0.00707;AN=1556;DS;set=Intersection
22	43289453	.	G	A	452.25	PASS	AC=1;AF=0.00066;AN=1510;DS;set=Intersection
22	43289473	.	G	A	56763.11	PASS	AC=443;AF=0.28470;AN=1556;DS;set=Intersection
22	43289518	.	C	T	514.74	PASS	AC=1;AF=0.00062;AN=1616;DS;set=Intersection
22	43308063	.	G	A	16857.03	PASS	AC=20;AF=0.01582;AN=1264;DS;set=Intersection
22	43308084	.	C	A	1408.61	PASS	AC=2;AF=0.00156;AN=1282;DS;set=Intersection
22	43308112	.	A	C	12433.39	PASS	AC=20;AF=0.01543;AN=1296;DS;set=Intersection
22	43435812	.	C	T	212833.93	PASS	AC=750;AF=0.45620;AN=1644;DS;set=Intersection
22	43435821	.	C	T	5614.47	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	43435875	.	G	A	898.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43435918	.	A	G	781.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43442376	.	A	G	4787.94	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43442393	.	C	T	981.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43442542	.	T	C	1354.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43442557	.	G	A	1107.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43442599	.	T	C	252529.66	PASS	AC=1102;AF=0.67032;AN=1644;DS;set=Intersection
22	43442609	.	C	G	6461.36	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	43442620	.	G	A	1962.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43447827	.	G	A	20075.39	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	43447870	.	G	A	1181.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43447891	.	C	T	12943.92	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	43447939	.	C	T	381.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43455432	.	G	A	150367.97	PASS	AC=579;AF=0.35219;AN=1644;DS;set=Intersection
22	43455457	.	T	C	6422.90	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	43455531	.	C	T	54948.50	PASS	AC=274;AF=0.16667;AN=1644;DS;set=Intersection
22	43455537	.	G	A	785.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43455549	.	C	T	1208.17	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43459813	.	A	G	85986.90	PASS	AC=207;AF=0.12591;AN=1644;DS;set=Intersection
22	43459846	.	G	A	109246.60	PASS	AC=276;AF=0.16788;AN=1644;DS;set=Intersection
22	43459864	.	G	A	69952.02	PASS	AC=185;AF=0.11253;AN=1644;DS;set=Intersection
22	43460215	.	G	A	877.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43460324	.	C	T	2421.02	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	43460379	.	C	T	5411.20	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	43464416	.	G	A	938.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43464436	.	G	C	5385.76	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	43464544	.	C	T	926.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43464621	.	T	G	7853.90	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	43465650	.	A	C	850.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43465668	.	T	A	662.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43465814	.	A	G	82095.54	PASS	AC=198;AF=0.12044;AN=1644;DS;set=Intersection
22	43465885	.	G	C	1369.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43465887	.	T	C	627.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43471437	.	G	A	45452.67	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	43471560	.	G	A	819.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43520017	.	C	G	861.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43520105	.	C	T	6350.28	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	43520205	.	C	T	1533.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43520218	.	T	G	20981.18	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	43523668	.	C	T	561.94	PASS	AC=3;AF=0.00201;AN=1494;set=Intersection
22	43523766	.	G	A	517.99	PASS	AC=11;AF=0.00733;AN=1500;DS;set=Intersection
22	43524487	.	CCT	C	196841.77	PASS	AC=811;AF=0.49331;AN=1644;DS;set=Intersection
22	43524582	.	T	C	689.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43524587	.	G	A	990.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43524613	.	C	G	557.26	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43524655	.	C	G	2824.66	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	43524665	.	G	A	828.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43525176	.	C	T	146010.74	PASS	AC=1108;AF=0.67397;AN=1644;DS;set=Intersection
22	43525197	.	C	T	962.12	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	43525231	.	C	T	411.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43525234	.	GTGCTGCTGGCGCTGCTGC	G	1156.54	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43525262	.	C	T	1533.04	PASS	AC=6;AF=0.00371;AN=1616;DS;set=Intersection
22	43525278	.	G	A	819.42	PASS	AC=3;AF=0.00184;AN=1634;DS;set=Intersection
22	43525285	.	G	A	298.91	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	43525315	.	C	T	251.12	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	43525321	.	G	A	711.77	PASS	AC=2;AF=0.00123;AN=1620;DS;set=Intersection
22	43525331	.	G	A	619.86	PASS	AC=1;AF=0.00062;AN=1616;DS;set=Intersection
22	43525332	.	G	T	1312.46	PASS	AC=13;AF=0.00807;AN=1610;DS;set=Intersection
22	43529016	.	C	T	581.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43529020	.	G	T	9983.97	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	43529024	.	G	T	15175.64	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	43529029	.	C	T	160580.18	PASS	AC=851;AF=0.51764;AN=1644;DS;set=Intersection
22	43529059	.	G	A	784.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43529061	.	C	A	21210.70	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	43529094	.	C	G	9391.96	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	43529138	.	T	C	1030.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43529314	.	G	C	232427.89	PASS	AC=896;AF=0.54501;AN=1644;DS;set=Intersection
22	43529321	.	C	T	336.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43529322	.	G	A	772.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43529323	.	T	C	1017.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43529393	.	C	T	879.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43529408	.	G	A	1293.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43529517	.	C	T	70750.45	PASS	AC=843;AF=0.51402;AN=1640;DS;set=Intersection
22	43533044	.	C	T	2121.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43533105	.	C	G	35013.04	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	43533146	.	C	T	908.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43533221	.	G	A	813.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43533222	.	G	A	1276.39	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43538965	.	G	C	36.91	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	43539120	.	G	C	132.84	PASS	AC=3;AF=0.00187;AN=1604;set=Intersection
22	43539246	.	C	T	125.38	PASS	AC=1;AF=0.00079;AN=1258;set=Intersection
22	43539279	.	G	A	244.54	PASS	AC=10;AF=0.0100;AN=1000;set=Intersection
22	43539375	.	G	A	61.39	PASS	AC=1;AF=0.0012;AN=848;set=Intersection
22	43555285	.	C	T	252.88	PASS	AC=3;AF=0.00192;AN=1560;set=Intersection
22	43555337	.	C	T	82.42	PASS	AC=2;AF=0.00133;AN=1504;set=Intersection
22	43555409	.	G	A	50.21	PASS	AC=1;AF=0.00075;AN=1336;set=Intersection
22	43557008	.	G	A	700.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43557156	.	C	T	203.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43558843	.	C	T	75.72	PASS	AC=3;AF=0.00189;AN=1584;set=Intersection
22	43558926	.	A	G	98865.60	PASS	AC=1339;AF=0.81946;AN=1634;DS;set=Intersection
22	43558972	.	G	A	13514.15	PASS	AC=329;AF=0.20537;AN=1602;DS;set=Intersection
22	43558999	.	T	G	1812.19	PASS	AC=25;AF=0.01603;AN=1560;DS;set=Intersection
22	43559056	.	G	A	1905.31	PASS	AC=16;AF=0.01003;AN=1596;set=Intersection
22	43563998	.	T	C	4856.17	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43564050	.	G	C	1675.43	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43564146	.	C	A	914.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43564733	.	A	AG	91.71	PASS	AC=1;AF=0.00067;AN=1492;set=Intersection
22	43564814	.	G	A	660.90	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	43564860	.	G	A	653.15	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	43564923	.	G	T	9273.58	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	43564963	.	C	G	112029.04	PASS	AC=1298;AF=0.79050;AN=1642;DS;set=Intersection
22	43565459	.	C	T	44.88	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	43565460	.	G	A	1503.56	PASS	AC=8;AF=0.00488;AN=1640;DS;set=Intersection
22	43565473	.	C	T	4645.22	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	43565515	.	C	T	290.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43565516	.	G	A	274.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43565600	.	G	A	553.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43567789	.	T	C	147017.82	PASS	AC=402;AF=0.24453;AN=1644;DS;set=Intersection
22	43567813	.	C	T	43705.94	PASS	AC=60;AF=0.03650;AN=1644;DS;set=Intersection
22	43567816	.	A	T	397.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43567861	.	C	T	2872.40	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43567876	.	G	A	16146.58	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	43567936	.	G	A	2826.99	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	43567937	.	T	A	2503.63	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	43567954	.	C	A	23798.79	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	43568362	.	C	T	312.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43568439	.	T	C	812.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43568494	.	C	T	748.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43568495	.	G	A	1053.48	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43568512	.	C	T	68588.79	PASS	AC=337;AF=0.20499;AN=1644;DS;set=Intersection
22	43568534	.	G	A	620.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43568583	.	C	T	642.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43569673	.	GT	G	9957.85	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	43569692	.	C	G	823.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43569755	.	T	C	531.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43569836	.	G	C	117.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43569838	.	G	A	4518.36	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	43569839	.	A	G	72.03	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	43569858	.	G	C	12494.59	PASS	AC=76;AF=0.04634;AN=1640;DS;set=Intersection
22	43569861	.	C	T	446.90	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	43570223	.	C	T	1208.21	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43570301	.	G	A	2623.30	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43570322	.	G	A	4651.85	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	43570441	.	G	A	315.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43570454	.	G	A	6676.79	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	43570463	.	A	G	102248.69	PASS	AC=525;AF=0.31934;AN=1644;DS;set=Intersection
22	43570487	.	G	C	471.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43570498	.	C	A	171.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43570531	.	G	A	7881.62	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	43570546	.	G	A	26880.04	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	43570550	.	G	A	311.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43570583	.	G	A	8734.60	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	43570602	.	G	C	636.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43570659	.	A	C	94231.62	PASS	AC=595;AF=0.36192;AN=1644;DS;set=Intersection
22	43570670	.	C	T	138.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43570671	.	G	A	256.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43572308	.	TG	T,TGG	26081.28	PASS	AC=472,86;AF=0.28851,0.05257;AN=1636;DS;set=Intersection
22	43572311	.	G	A,T	1058.82	PASS	AC=1,1;AF=0.00061,0.00061;AN=1632;DS;set=Intersection
22	43572322	.	G	A	299.59	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	43572349	.	C	A	613.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43572354	.	C	T	12652.14	PASS	AC=71;AF=0.04319;AN=1644;DS;set=Intersection
22	43572416	.	C	T	714.28	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43572420	.	G	A	17914	PASS	AC=153;AF=0.09318;AN=1642;DS;set=Intersection
22	43575616	.	G	A	81098.25	PASS	AC=293;AF=0.17822;AN=1644;DS;set=Intersection
22	43575682	.	G	A	4898.58	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	43575775	.	G	A	13252.20	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	43575795	.	C	T	767.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43575828	.	G	A	639.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43575849	.	C	T	705.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43575914	.	G	C	5630.15	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	43575935	.	C	T	19162.30	PASS	AC=64;AF=0.03893;AN=1644;DS;set=Intersection
22	43575939	.	TC	T	577.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43575941	.	C	T	568.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43575956	.	C	T	938.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43576006	.	T	C	982.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43576035	.	C	T	212.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43576049	.	C	A	774.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43576054	.	C	T	827.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43576721	.	C	G	11071.11	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	43576727	.	G	A	81.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43576831	.	C	G	1188.59	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43576832	.	G	A	7465.74	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	43576880	.	C	A	20414.33	PASS	AC=103;AF=0.06265;AN=1644;DS;set=Intersection
22	43576904	.	G	A	78084.17	PASS	AC=572;AF=0.34793;AN=1644;DS;set=Intersection
22	43576977	.	C	T	113.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43579006	.	G	A	4917.31	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	43579008	.	G	C	9917.66	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	43579012	.	G	A	32935.15	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	43579049	.	T	C	36242.28	PASS	AC=107;AF=0.06509;AN=1644;DS;set=Intersection
22	43579055	.	G	A	1724.71	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43579081	.	C	T	24328.65	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	43579083	.	G	A	44476.70	PASS	AC=99;AF=0.06022;AN=1644;DS;set=Intersection
22	43579150	.	G	A	504.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43579181	.	G	C	621.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43583051	.	G	A	39.40	PASS	AC=6;AF=0.0441;AN=136;set=Intersection
22	43599958	.	C	T	307.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43599965	.	C	T	881.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43599991	.	C	T	32755.09	PASS	AC=179;AF=0.10888;AN=1644;DS;set=Intersection
22	43600000	.	C	T	11243.21	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	43600126	.	G	A	1592.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43603510	.	C	T	9888.84	PASS	AC=54;AF=0.03285;AN=1644;DS;set=Intersection
22	43603585	.	G	A	171.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43603665	.	G	A	3149.63	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	43604034	.	C	T	19894.17	PASS	AC=54;AF=0.03285;AN=1644;DS;set=Intersection
22	43604152	.	T	C	1857.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43604235	.	G	A	9859.47	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	43606024	.	C	G	195.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43606040	.	C	T	10203.16	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	43606057	.	C	T	767.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43606088	.	C	T	1078.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43606143	.	C	T	176902.33	PASS	AC=1198;AF=0.72871;AN=1644;DS;set=Intersection
22	43606158	.	G	A	407.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43606181	.	C	T	1462.10	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43606203	.	G	A	503.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43606212	.	G	A	354.59	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43606215	.	G	A	12591.18	PASS	AC=43;AF=0.02616;AN=1644;DS;set=Intersection
22	43606236	.	G	A	573.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43606944	.	G	A	673.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43606987	.	G	A	822.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43607031	.	G	A	13374.26	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	43607040	.	G	A	29772.80	PASS	AC=113;AF=0.06873;AN=1644;DS;set=Intersection
22	43608531	.	C	T	6556.74	PASS	AC=83;AF=0.05307;AN=1564;DS;set=Intersection
22	43608626	.	G	A	1485.25	PASS	AC=30;AF=0.01896;AN=1582;DS;set=Intersection
22	43610059	.	C	G	5022.43	PASS	AC=42;AF=0.02645;AN=1588;set=Intersection
22	43610090	.	A	G	5297.74	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	43610106	.	C	T	14813.80	PASS	AC=119;AF=0.07238;AN=1644;DS;set=Intersection
22	43610112	.	G	A	1228.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43610138	.	C	T	245.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43610141	.	C	T	2081.35	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	43610201	.	T	C	6646.83	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	43610207	.	A	G	115580.40	PASS	AC=718;AF=0.43674;AN=1644;DS;set=Intersection
22	43614223	.	C	G	140784.07	PASS	AC=552;AF=0.33577;AN=1644;DS;set=Intersection
22	43614292	.	G	A	330.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43614316	.	C	G	147725.48	PASS	AC=554;AF=0.33698;AN=1644;DS;set=Intersection
22	43614364	.	G	T	505.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43614489	.	A	G	13416.42	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	43616481	.	G	A	1028.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43616565	.	G	C	7185.18	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	43616580	.	C	T	1948.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43616627	.	G	A	641.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43616628	.	C	T	608.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43617144	.	G	A	531.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43617168	.	G	A	2110.23	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	43618619	.	A	G	49627.83	PASS	AC=255;AF=0.15606;AN=1634;DS;set=Intersection
22	43618632	.	CG	C	70739.18	PASS	AC=1132;AF=0.69109;AN=1638;DS;set=Intersection
22	43618637	.	G	GGGTT	1028.78	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	43618695	.	C	A	1182.54	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	43618708	.	C	A	48.73	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	43619062	.	C	G	53423.21	PASS	AC=504;AF=0.30657;AN=1644;DS;set=Intersection
22	43619072	.	A	C	869.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43619096	.	G	A	364.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43619125	.	C	G	370.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43619170	.	G	A	1029.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43619183	.	C	T	952.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43619200	.	G	A	94272.23	PASS	AC=331;AF=0.20134;AN=1644;DS;set=Intersection
22	43623353	.	G	A	45997.07	PASS	AC=593;AF=0.36071;AN=1644;DS;set=Intersection
22	43623383	.	C	T	314.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43623386	.	A	G	125.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43623395	.	C	G	80312.69	PASS	AC=1146;AF=0.69708;AN=1644;DS;set=Intersection
22	43623417	.	C	T	98.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43623418	.	G	C	582.19	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43623429	.	G	A	682.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43623430	.	C	T	437.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43623515	.	C	T	513.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43625045	.	G	C	150.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43625063	.	G	A	182.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43625093	.	T	C	119.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43625113	.	C	T	748.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43625127	.	C	T	880.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43625225	.	G	T	46112.09	PASS	AC=245;AF=0.14903;AN=1644;DS;set=Intersection
22	43627712	.	C	T	2875.63	PASS	AC=45;AF=0.02788;AN=1614;set=Intersection
22	43627727	.	C	T	283.24	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	43627728	.	G	A	27233.58	PASS	AC=385;AF=0.23591;AN=1632;set=Intersection
22	43627838	.	G	A	76.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43634809	.	C	T	12273.70	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	43634902	.	G	A	719.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43634953	.	G	A	693.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43654190	.	C	T	547.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43654226	.	G	A	1046.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43654253	.	G	A	2648.42	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43654278	.	G	A	29370.03	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	43658691	.	C	T	281.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43658774	.	C	T	349.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43658876	.	C	T	368.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43658892	.	C	A	883.62	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43687007	.	C	T	6408.80	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	43687014	.	G	T	3029.06	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	43687171	.	T	C	594.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43687213	.	C	T	674.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43716097	.	G	A	975.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43716118	.	T	G	4382.06	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	43735086	.	C	T	16341.65	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	43735096	.	C	T	878.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43735185	.	T	C	3132.62	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	43735234	.	G	A	149.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43739290	.	C	T	71.05	PASS	AC=6;AF=0.0545;AN=110;set=Intersection
22	43820952	.	C	T	80.68	PASS	AC=2;AF=0.00140;AN=1426;set=Intersection
22	43820981	.	G	A	69.42	PASS	AC=1;AF=0.00067;AN=1486;set=Intersection
22	43830908	.	C	T	663.65	PASS	AC=1;AF=0.00081;AN=1242;DS;set=Intersection
22	43830910	.	C	T	29017.93	PASS	AC=95;AF=0.07813;AN=1216;DS;set=Intersection
22	43830921	.	C	T	218.71	PASS	AC=1;AF=0.00082;AN=1214;DS;set=Intersection
22	43830996	.	C	T	134988.92	PASS	AC=464;AF=0.37480;AN=1238;DS;set=Intersection
22	43831005	.	C	T	999.67	PASS	AC=3;AF=0.00245;AN=1222;DS;set=Intersection
22	43831023	.	C	T	4836.83	PASS	AC=16;AF=0.01274;AN=1256;DS;set=Intersection
22	43831056	.	C	T	122816.20	PASS	AC=470;AF=0.37903;AN=1240;DS;set=Intersection
22	43831058	.	G	C	2359.04	PASS	AC=3;AF=0.00243;AN=1236;DS;set=Intersection
22	43870704	.	G	A	2060.59	PASS	AC=2;AF=0.00142;AN=1410;DS;set=Intersection
22	43870725	.	T	A	981.01	PASS	AC=2;AF=0.00141;AN=1420;DS;set=Intersection
22	43870743	.	G	A	21483.05	PASS	AC=41;AF=0.02929;AN=1400;DS;set=Intersection
22	43870761	.	G	A	10991.84	PASS	AC=10;AF=0.00715;AN=1398;DS;set=Intersection
22	43870800	.	G	A	88039.37	PASS	AC=98;AF=0.07313;AN=1340;DS;set=Intersection
22	43870810	.	G	A	723.52	PASS	AC=1;AF=0.00074;AN=1350;DS;set=Intersection
22	43898489	.	C	T	1325.57	PASS	AC=3;AF=0.00188;AN=1596;DS;set=Intersection
22	43898650	.	C	T	44163.80	PASS	AC=107;AF=0.06613;AN=1618;DS;set=Intersection
22	43898667	.	C	T	616.70	PASS	AC=2;AF=0.00124;AN=1616;DS;set=Intersection
22	43898685	.	T	C	283.35	PASS	AC=1;AF=0.00062;AN=1614;DS;set=Intersection
22	43901333	.	C	T	723.78	PASS	AC=20;AF=0.01486;AN=1346;set=Intersection
22	43924691	.	G	T	1779.73	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43924749	.	C	T	1176.60	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43924753	.	G	A	757.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43926715	.	T	G	810.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43926725	.	T	C	506.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43926729	.	C	A	4520.89	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	43926741	.	T	C	951.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43926758	.	C	G	518.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43926808	.	CAGAGT	C	1411.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43926857	.	CAAGAAGGGGT	C	22456.98	PASS	AC=80;AF=0.04866;AN=1644;DS;set=Intersection
22	43930524	.	C	G	9313.08	PASS	AC=51;AF=0.03102;AN=1644;DS;set=Intersection
22	43930672	.	C	T	924.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43930785	.	G	A	1782.17	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43930797	.	C	T	898.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43933207	.	TGCCACAGGG	T	2150.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43933252	.	C	A	2913.66	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43933284	.	CCT	C	8283.43	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	43933317	.	T	C	880.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43933329	.	G	A	2284.55	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43933352	.	C	T	1080.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43933357	.	C	A	5635.96	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	43933408	.	G	A	11076.04	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	43933463	.	G	A	153.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43933473	.	G	A	9471.69	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	43936074	.	G	C	1199.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43936082	.	C	T	1059.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43936117	.	C	T	15628.97	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	43936166	.	C	T	2013.95	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43936181	.	C	T	1965.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43936207	.	T	A	1629.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	43936219	.	C	T	52285.38	PASS	AC=176;AF=0.10706;AN=1644;DS;set=Intersection
22	43950728	.	G	C	988.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43950774	.	C	T	930.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43950800	.	C	T	1282.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43950819	.	G	A	1722.02	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43950826	.	T	C	667.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43950853	.	T	G	22396.83	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	43950891	.	C	T	567.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43950935	.	C	T	1192.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43950936	.	G	A	1151.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43950949	.	G	A	2809.99	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	43951008	.	T	A	18554.02	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	43972255	.	C	G	1100.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43972363	.	A	C	520.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43972393	.	G	A	2100.74	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43976307	.	T	C	672.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43976359	.	C	A	1010.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43976396	.	G	A	364275.41	PASS	AC=1267;AF=0.77068;AN=1644;DS;set=Intersection
22	43976414	.	G	A	8938.93	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	43976423	.	T	C	3162.16	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	43985907	.	T	G	4324.21	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	43985929	.	CAT	C	37362.24	PASS	AC=96;AF=0.05839;AN=1644;DS;set=Intersection
22	43986125	.	T	C	1048.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43986134	.	T	C	63230.06	PASS	AC=200;AF=0.12165;AN=1644;DS;set=Intersection
22	43986141	.	A	G	49365.84	PASS	AC=78;AF=0.04745;AN=1644;DS;set=Intersection
22	43986153	.	CAAAT	C	1265.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43995970	.	G	A	845.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	43996082	.	T	C	1113.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44004350	.	C	T	899	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44004351	.	G	A	366.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44004465	.	C	T	768.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44004498	.	G	A	1143.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44004513	.	G	A	524.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44022331	.	T	G	997.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44022344	.	C	T	957.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44022345	.	G	A	11120.68	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	44022394	.	G	A	35270.94	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	44022418	.	T	C	955.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44022441	.	C	T	827.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44022454	.	C	T	12762.39	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	44022466	.	T	A	965.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44022493	.	G	A	1940.56	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44022578	.	C	A	76813.93	PASS	AC=392;AF=0.23844;AN=1644;DS;set=Intersection
22	44022601	.	C	T	165.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44027964	.	C	A,T	2757.16	PASS	AC=1,6;AF=0.00061,0.00365;AN=1644;DS;set=Intersection
22	44027965	.	G	A	46755.42	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	44028078	.	A	G	778.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44028085	.	G	A	928.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44028087	.	C	T	5190.95	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	44028100	.	G	A	949.86	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44028139	.	G	A	757.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44030935	.	G	A	22072.29	PASS	AC=61;AF=0.03710;AN=1644;DS;set=Intersection
22	44030959	.	G	A	1127.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44030977	.	G	C	783.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44030978	.	C	G	725.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44031027	.	C	T	2093.40	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44031042	.	T	C	16468.20	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	44031070	.	C	T	1372.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44031075	.	G	A	1165.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44031101	.	C	G	699.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44031110	.	CAG	C	813.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44031114	.	G	A	1794.43	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44031128	.	C	A,T	331.54	PASS	AC=1,1;AF=0.00061,0.00061;AN=1644;DS;set=Intersection
22	44031140	.	C	T	1103.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44031142	.	C	T	774.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44031143	.	G	A	258.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44062938	.	G	A	52506.20	PASS	AC=230;AF=0.13990;AN=1644;DS;set=Intersection
22	44063048	.	T	C	1313.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44063052	.	A	G	575.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44063179	.	C	T	1941.07	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44064909	.	G	C	4583.77	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44064973	.	C	T	1002.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44067871	.	G	A	1066.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44068081	.	A	G	517.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44068193	.	G	A	11661.01	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	44068194	.	G	T	175.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44068226	.	T	C	536.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44073983	.	T	C	938.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44074021	.	C	A	1313.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44074059	.	T	C	1045.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44074063	.	T	C	532.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44074076	.	GA	G,GAA	23642.10	PASS	AC=1213,39;AF=0.73783,0.02372;AN=1644;DS;set=Intersection
22	44079645	.	T	C	59459.21	PASS	AC=125;AF=0.07603;AN=1644;DS;set=Intersection
22	44079660	.	C	T	1166.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44079680	.	G	A	51505.12	PASS	AC=166;AF=0.10097;AN=1644;DS;set=Intersection
22	44079728	.	A	C	14441.09	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	44083327	.	G	GT,GTT	49824.46	PASS	AC=901,241;AF=0.54805,0.14659;AN=1644;DS;set=Intersection
22	44083330	.	T	TG	432.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44083332	.	T	TTG	281.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44083333	.	T	TG	764.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44083368	.	G	T	1123.06	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44083418	.	G	A	9277.60	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	44083442	.	T	C	121335.22	PASS	AC=609;AF=0.37044;AN=1644;DS;set=Intersection
22	44083501	.	AT	A	4602.12	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	44107306	.	C	T	1076.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44107329	.	T	C	658.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44107407	.	C	T	936.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44107471	.	G	A	11548.89	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	44107498	.	C	T	2076.67	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44107499	.	G	A	1106.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44112807	.	C	T	676.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44112845	.	C	T	243642.13	PASS	AC=1288;AF=0.78345;AN=1644;DS;set=Intersection
22	44112846	.	G	A	810.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44127543	.	T	C	246.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44127629	.	T	G	1355.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44127643	.	G	A	1362.23	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44131776	.	T	C	915.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44131786	.	T	C	37557.34	PASS	AC=108;AF=0.06569;AN=1644;DS;set=Intersection
22	44131803	.	C	T	5792.44	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	44131832	.	G	A	1250.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44151656	.	A	G	15020.27	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	44151684	.	G	A	102.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44151721	.	TA	T	790.09	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	44161173	.	C	G	456.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44161194	.	C	T	1121.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44161245	.	G	A	781.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44161261	.	T	A	1212.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44161285	.	G	C	741.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44168935	.	A	G	3182.43	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44168955	.	G	A	5110.93	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	44178050	.	G	A	703.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44178103	.	T	C	66362.42	PASS	AC=176;AF=0.10706;AN=1644;DS;set=Intersection
22	44178160	.	C	T	5733.45	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	44178161	.	G	A	1289.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44178231	.	C	T	583.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44178232	.	G	A	1112.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44221971	.	G	A	1671.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44222001	.	G	A	795.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44222036	.	G	A	1110.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44224917	.	G	A	921.26	PASS	AC=15;AF=0.00984;AN=1524;set=Intersection
22	44225073	.	C	A	405.21	PASS	AC=2;AF=0.00124;AN=1618;DS;set=Intersection
22	44229492	.	G	C	63348.89	PASS	AC=1507;AF=0.92002;AN=1638;set=Intersection
22	44229508	.	G	A	18518.43	PASS	AC=322;AF=0.19610;AN=1642;DS;set=Intersection
22	44234713	.	C	T	177.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44234728	.	G	T	554.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44234737	.	C	T	710.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44235819	.	G	GCTTA	2506.45	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	44237662	.	G	A	664.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44237700	.	C	T	740.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44237862	.	C	T	308.68	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	44258221	.	C	T	360.01	PASS	AC=1;AF=0.00062;AN=1616;DS;set=Intersection
22	44258283	.	C	T	620.06	PASS	AC=18;AF=0.01269;AN=1418;DS;set=Intersection
22	44276760	.	G	A	807.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44276788	.	G	A	778.29	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	44276807	.	G	A	2124.42	PASS	AC=9;AF=0.00551;AN=1634;DS;set=Intersection
22	44277398	.	CA	C	161.91	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	44277406	.	C	T	52987.32	PASS	AC=488;AF=0.29720;AN=1642;DS;set=Intersection
22	44277512	.	C	G	557.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44277559	.	A	T	35.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44280049	.	C	T	1029.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44280050	.	G	A	921.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44280057	.	G	A	7227.60	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	44280076	.	C	T	350.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44280184	.	G	C	679.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44280226	.	C	T	256.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44280250	.	C	T	1073.45	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44282177	.	C	A	1431.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44282276	.	A	G	198788.69	PASS	AC=840;AF=0.51095;AN=1644;DS;set=Intersection
22	44282278	.	C	T	441.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44282280	.	T	C	917.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44282307	.	G	A	209839.08	PASS	AC=830;AF=0.50487;AN=1644;DS;set=Intersection
22	44282388	.	A	T	673.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44283440	.	G	A	95372.56	PASS	AC=355;AF=0.21620;AN=1642;DS;set=Intersection
22	44283556	.	A	G	182965.34	PASS	AC=841;AF=0.51218;AN=1642;DS;set=Intersection
22	44285258	.	G	A	23497.19	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	44285272	.	G	A	8752.42	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	44285312	.	G	A	21624.06	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	44285348	.	G	A	829.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44285418	.	G	A	691.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44285428	.	G	A	32663.56	PASS	AC=131;AF=0.07968;AN=1644;DS;set=Intersection
22	44285639	.	G	A	8348.08	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	44285658	.	G	A	76554.54	PASS	AC=373;AF=0.22689;AN=1644;DS;set=Intersection
22	44285667	.	G	A	73655.36	PASS	AC=611;AF=0.37165;AN=1644;DS;set=Intersection
22	44285693	.	C	T	834.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44285723	.	A	G	1952.54	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44285765	.	A	G	149028.72	PASS	AC=1038;AF=0.63139;AN=1644;DS;set=Intersection
22	44286916	.	A	G	5188.48	PASS	AC=27;AF=0.01644;AN=1642;DS;set=Intersection
22	44286930	.	C	A	87.21	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44286950	.	G	A	52375.14	PASS	AC=388;AF=0.23601;AN=1644;DS;set=Intersection
22	44286956	.	C	T	868.80	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44287062	.	A	G	45403.63	PASS	AC=613;AF=0.37287;AN=1644;DS;set=Intersection
22	44287073	.	G	A	449.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44287074	.	C	T	1084.24	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	44287165	.	C	A	271.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44287207	.	C	T	16444.39	PASS	AC=387;AF=0.23655;AN=1636;DS;set=Intersection
22	44287629	.	G	A	4937.81	PASS	AC=156;AF=0.12303;AN=1268;set=Intersection
22	44287698	.	G	T	62.12	PASS	AC=1;AF=0.00090;AN=1110;set=Intersection
22	44319752	.	C	G	105.23	PASS	AC=6;AF=0.00441;AN=1360;set=Intersection
22	44319777	.	CCCG	C	54.05	PASS	AC=8;AF=0.00576;AN=1390;set=Intersection
22	44319951	.	G	A	59.91	PASS	AC=3;AF=0.00191;AN=1570;set=Intersection
22	44319990	.	G	A	794.92	PASS	AC=11;AF=0.00703;AN=1564;set=Intersection
22	44322766	.	A	G	76.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44322843	.	T	C	3040.10	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44322862	.	C	T	1028.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44322913	.	C	T	806.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44322922	.	T	G	44546.11	PASS	AC=131;AF=0.07968;AN=1644;DS;set=Intersection
22	44322936	.	G	A	5041.25	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	44322970	.	G	T	49835.97	PASS	AC=185;AF=0.11253;AN=1644;DS;set=Intersection
22	44322978	.	T	G	704.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44323070	.	C	T	1629.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44323074	.	G	A	81715.79	PASS	AC=553;AF=0.33637;AN=1644;DS;set=Intersection
22	44323084	.	A	C	171.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44324676	.	A	G	252755.42	PASS	AC=844;AF=0.51338;AN=1644;DS;set=Intersection
22	44324727	.	C	G	165845.41	PASS	AC=478;AF=0.29075;AN=1644;DS;set=Intersection
22	44324730	.	C	T	163523.99	PASS	AC=478;AF=0.29075;AN=1644;DS;set=Intersection
22	44328730	.	G	A	100782.03	PASS	AC=442;AF=0.26886;AN=1644;DS;set=Intersection
22	44328737	.	CT	C	128.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44328742	.	TC	T	5984.13	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	44328798	.	T	C	1210.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44328821	.	G	A	1316.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44328832	.	C	T	29615.11	PASS	AC=67;AF=0.04075;AN=1644;DS;set=Intersection
22	44328870	.	C	T	924.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44328930	.	A	G	5933.77	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	44328939	.	C	T	847.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44328950	.	G	A	2000.94	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44330464	.	C	T	852.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44330474	.	C	G	1003.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44330481	.	C	A	1913.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44330574	.	T	C	206.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44332888	.	T	TC	84523.63	PASS	AC=466;AF=0.28345;AN=1644;DS;set=Intersection
22	44332889	.	C	CA	15666.69	PASS	AC=342;AF=0.20803;AN=1644;DS;set=Intersection
22	44332890	.	C	CA	15389.23	PASS	AC=334;AF=0.20316;AN=1644;DS;set=Intersection
22	44332891	.	C	CA	16150.38	PASS	AC=344;AF=0.20925;AN=1644;DS;set=Intersection
22	44332897	.	C	G	285.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44332922	.	C	A	949.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44332974	.	A	C	2001.51	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44333034	.	G	A	439.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44333039	.	C	T	510.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44333046	.	C	T	583.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44333131	.	C	T	810.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44333145	.	C	T	6698.91	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	44333146	.	G	A	470.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44333166	.	G	A	348.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44333172	.	A	G	82085.17	PASS	AC=473;AF=0.28771;AN=1644;DS;set=Intersection
22	44333179	.	G	A	333.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44335858	.	A	C	9079.67	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	44335885	.	A	G	934.28	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44335962	.	C	T	1085.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44336019	.	G	A	841.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44336023	.	C	T	8182.24	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	44336030	.	T	A	1709.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44340532	.	C	A	2857.21	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44340560	.	C	T	847.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44340602	.	G	A	1324.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44340640	.	C	T	764.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44340642	.	C	G	1704.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44340667	.	C	T	890.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44340702	.	G	A	1198.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44341986	.	T	C	115498.22	PASS	AC=590;AF=0.35888;AN=1644;DS;set=Intersection
22	44341994	.	C	T	1229.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44342001	.	G	A	378.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44342033	.	G	A	771.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44342038	.	C	A	1665.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44342116	.	A	G	302205.71	PASS	AC=1267;AF=0.77068;AN=1644;DS;set=Intersection
22	44342146	.	G	A	315.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44342153	.	C	T	698.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44342180	.	ACTT	A	5470.65	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	44342269	.	TGAG	T	8279.41	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	44359149	.	C	T	856.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44359151	.	C	G	825.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44359218	.	AAGC	A	1186.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44359246	.	A	G	1212.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44359313	.	G	T	11376.96	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	44360335	.	G	A	1259.24	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44364594	.	C	T	273447.52	PASS	AC=1169;AF=0.71107;AN=1644;DS;set=Intersection
22	44364596	.	T	C	11765.35	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	44364651	.	G	A	1613.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44364708	.	G	T	702.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44368122	.	A	G	104202.43	PASS	AC=428;AF=0.26034;AN=1644;DS;set=Intersection
22	44368133	.	A	G	647.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44368144	.	C	A	174.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44368179	.	C	T	1631.95	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44368204	.	A	G	228164.96	PASS	AC=1118;AF=0.68005;AN=1644;DS;set=Intersection
22	44368728	.	A	AT	101149.55	PASS	AC=1021;AF=0.62105;AN=1644;DS;set=Intersection
22	44368740	.	TC	T	102295.65	PASS	AC=1115;AF=0.67822;AN=1644;DS;set=Intersection
22	44368741	.	C	T	230261.99	PASS	AC=1105;AF=0.67214;AN=1644;DS;set=Intersection
22	44368865	.	G	A	918.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44368902	.	T	C	519.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44368906	.	G	GTACAC	1497.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44369176	.	G	A	31016.67	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	44369237	.	G	A	11853.58	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	44371906	.	C	T	214.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44371941	.	A	G	337.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44372008	.	C	T	628.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44372069	.	G	A	223805.19	PASS	AC=738;AF=0.44891;AN=1644;DS;set=Intersection
22	44372632	.	C	T	113965.44	PASS	AC=716;AF=0.43552;AN=1644;DS;set=Intersection
22	44372652	.	G	A	5273.57	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44372730	.	A	G	774.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44373711	.	G	A	926.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44373744	.	C	T	880.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44373766	.	C	T	510.91	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44373820	.	G	A	1000.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44377221	.	G	T	13124.34	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	44377315	.	T	C	812.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44377391	.	CT	C	990.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44379822	.	T	C	288636.08	PASS	AC=1175;AF=0.71472;AN=1644;DS;set=Intersection
22	44379837	.	C	T	758.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44379838	.	A	G	314416.34	PASS	AC=1223;AF=0.74392;AN=1644;DS;set=Intersection
22	44379889	.	T	G	1050.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44379902	.	C	T	608.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44379923	.	G	A	880.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44385028	.	C	T	809.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44385109	.	C	T	1850.94	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44385148	.	C	T	29875.73	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	44386106	.	CG	C	1166.36	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44386173	.	G	A	808.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44386199	.	A	G	518.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44386257	.	C	T	2190.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44386281	.	C	T	96605.11	PASS	AC=386;AF=0.23479;AN=1644;DS;set=Intersection
22	44386289	.	A	ACGTGTTGGGAATTATT	5327.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44392169	.	G	C	1195.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44392187	.	C	T	676.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44392207	.	C	T	569.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44395212	.	T	C	1521.81	PASS	AC=4;AF=0.00311;AN=1288;set=Intersection
22	44395283	.	C	G	312.96	PASS	AC=1;AF=0.00079;AN=1258;DS;set=Intersection
22	44395429	.	G	T	692.87	PASS	AC=1;AF=0.00072;AN=1382;DS;set=Intersection
22	44395434	.	G	A	5246.28	PASS	AC=5;AF=0.00362;AN=1380;DS;set=Intersection
22	44395451	.	T	C	204944.21	PASS	AC=678;AF=0.48918;AN=1386;DS;set=Intersection
22	44395540	.	T	C	868.26	PASS	AC=1;AF=0.00075;AN=1338;DS;set=Intersection
22	44489815	.	C	A	855.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44489850	.	C	G,T	26564.89	PASS	AC=32,1;AF=0.01946,0.00061;AN=1644;DS;set=Intersection
22	44489868	.	T	C	294639.65	PASS	AC=1432;AF=0.87105;AN=1644;DS;set=Intersection
22	44489871	.	A	T	689.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44489896	.	T	C	175633.79	PASS	AC=1076;AF=0.65450;AN=1644;DS;set=Intersection
22	44489942	.	C	T	29302.87	PASS	AC=126;AF=0.07664;AN=1644;DS;set=Intersection
22	44495908	.	C	T	1782.94	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44495940	.	C	T	3167.13	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44495951	.	C	G,T	695.17	PASS	AC=1,1;AF=0.00061,0.00061;AN=1644;DS;set=Intersection
22	44495952	.	G	C	1317.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44495953	.	A	G	755.14	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44495983	.	A	G	10615.52	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	44496016	.	G	A	1022.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44496043	.	C	T	4932.59	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	44514941	.	C	T	2799.25	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44514974	.	G	T	888.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44514995	.	C	T	32825.19	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	44527414	.	G	A	726.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44527489	.	C	T	1691.41	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44527548	.	G	A	804.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44527551	.	C	T	545	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44528736	.	CT	C	1210.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44528781	.	C	T	4479.69	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44528826	.	C	T	7794.91	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	44532306	.	G	A	494.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44532421	.	C	T	329.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44532430	.	C	T	880.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44535956	.	T	C	938.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44536003	.	G	T	981.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44536017	.	C	A	2516.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44536045	.	G	A	1799.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44543709	.	G	A	470.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44543721	.	C	T	428.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44543766	.	C	T	2895.92	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	44547322	.	C	T	4618.47	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	44547335	.	G	A	442.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44547340	.	T	C	876.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44547355	.	C	G	7409.50	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	44547365	.	T	G	716.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44547418	.	A	G	6874.62	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	44553852	.	T	TG	16389.38	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	44553972	.	A	G	852.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44559714	.	TG	T	15088.94	PASS	AC=302;AF=0.18370;AN=1644;DS;set=Intersection
22	44559715	.	GA	G	115112.01	PASS	AC=354;AF=0.21533;AN=1644;DS;set=Intersection
22	44559716	.	AC	A	21003.16	PASS	AC=320;AF=0.19465;AN=1644;DS;set=Intersection
22	44559753	.	T	A	802.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44559755	.	C	T	21596.66	PASS	AC=47;AF=0.02859;AN=1644;DS;set=Intersection
22	44559799	.	C	A	804.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44559842	.	A	G	125853.96	PASS	AC=665;AF=0.40450;AN=1644;DS;set=Intersection
22	44559851	.	C	T	1518.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44564479	.	C	A	662.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44564507	.	C	T	10429.68	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	44564549	.	C	T	1656.99	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	44564559	.	C	T	757.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44579172	.	C	T	332	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	44579173	.	G	A	358.39	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44579253	.	G	C	934.82	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	44579275	.	G	A	111.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44581709	.	C	T	261.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44583611	.	G	A	715.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44583631	.	A	G	1113.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44583650	.	C	T	1204.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44583779	.	C	T	7537.63	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	44585138	.	C	T	660.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44586391	.	C	T	694.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44586484	.	A	G	374.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44586498	.	C	T	621.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44586506	.	C	G	2576.47	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44586519	.	C	A	8376.45	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	44586522	.	C	T	97429.65	PASS	AC=346;AF=0.21046;AN=1644;DS;set=Intersection
22	44587906	.	TC	T	292.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44588028	.	G	A	1509.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44588029	.	C	T	201.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44589693	.	C	T	397.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44589736	.	C	T	18462.41	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	44592191	.	C	T	865.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44592207	.	C	CCTTGTT	3987.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44594456	.	G	A	3223.52	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	44594476	.	T	C	380109.13	PASS	AC=1591;AF=0.96776;AN=1644;DS;set=Intersection
22	44594480	.	C	T	5246.41	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	44594535	.	G	A	1516.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44594584	.	C	G	128114.48	PASS	AC=408;AF=0.24818;AN=1644;DS;set=Intersection
22	44601602	.	T	C	229.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44601734	.	C	T	105.32	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	44602222	.	C	T	446.97	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44602229	.	A	C	211316.59	PASS	AC=1255;AF=0.76338;AN=1644;DS;set=Intersection
22	44602262	.	C	T	4490.30	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	44602300	.	G	A	214.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44602313	.	C	T	411.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44645532	.	T	A	7936.09	PASS	AC=22;AF=0.01672;AN=1316;DS;set=Intersection
22	44645539	.	C	G	403.86	PASS	AC=4;AF=0.00302;AN=1324;DS;set=Intersection
22	44645561	.	G	A	381.03	PASS	AC=1;AF=0.00077;AN=1296;DS;set=Intersection
22	44645575	.	A	ATACAAGG	11844.24	PASS	AC=16;AF=0.01254;AN=1276;DS;set=Intersection
22	44645582	.	GA	G	1791.02	PASS	AC=10;AF=0.00780;AN=1282;DS;set=Intersection
22	44645593	.	TCA	T	1182.61	PASS	AC=2;AF=0.00156;AN=1278;DS;set=Intersection
22	44645598	.	T	G	995.45	PASS	AC=2;AF=0.00158;AN=1264;DS;set=Intersection
22	44681317	.	G	A	2052.95	PASS	AC=10;AF=0.00774;AN=1292;DS;set=Intersection
22	44681418	.	TGGGGCCCGCTGACCCGGCCGA	T	2486.53	PASS	AC=5;AF=0.00395;AN=1266;DS;set=Intersection
22	44681612	.	A	G	132579.98	PASS	AC=568;AF=0.42579;AN=1334;DS;set=Intersection
22	44681613	.	G	A	13287.74	PASS	AC=13;AF=0.00975;AN=1334;DS;set=Intersection
22	44681630	.	G	A	4098.45	PASS	AC=6;AF=0.00459;AN=1306;DS;set=Intersection
22	44681644	.	G	T	57945.66	PASS	AC=83;AF=0.06375;AN=1302;DS;set=Intersection
22	44681674	.	C	T	2393.42	PASS	AC=5;AF=0.00385;AN=1298;DS;set=Intersection
22	44692540	.	A	G	65612.08	PASS	AC=122;AF=0.08802;AN=1386;DS;set=Intersection
22	44692689	.	G	T	983.68	PASS	AC=1;AF=0.00066;AN=1518;DS;set=Intersection
22	44692780	.	C	T	728.54	PASS	AC=1;AF=0.00072;AN=1390;DS;set=Intersection
22	44692800	.	C	G	4524.49	PASS	AC=15;AF=0.01101;AN=1362;DS;set=Intersection
22	44692815	.	G	C	263.23	PASS	AC=2;AF=0.00151;AN=1328;DS;set=Intersection
22	44696721	.	C	T	4739.75	PASS	AC=29;AF=0.02214;AN=1310;DS;set=Intersection
22	44696732	.	C	T	482.07	PASS	AC=1;AF=0.00078;AN=1282;DS;set=Intersection
22	44893302	.	G	T	4409.99	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	44893335	.	G	A	1040.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	44893337	.	G	T	558.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	44893383	.	C	T	665.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45110443	.	T	G	529.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45110464	.	C	A	10538.91	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	45110585	.	T	C	1173.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45121097	.	C	T	401.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45121101	.	CTT	C	1102.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45121160	.	G	A	1128.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45121195	.	A	G	615.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45122428	.	G	A	446.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45122448	.	T	A	1484.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45122483	.	G	C	782.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45122534	.	C	G	152.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45122535	.	G	A	884.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45122537	.	C	T	8140.94	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	45127568	.	C	T	292.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45127569	.	G	A	157.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45127572	.	C	T	843.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45127581	.	C	T	1165.60	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45127739	.	C	T	13804.22	PASS	AC=135;AF=0.08212;AN=1644;DS;set=Intersection
22	45128114	.	G	A	3017.41	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	45128218	.	C	T	268.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45128231	.	G	A	151.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45128232	.	T	C	58976.29	PASS	AC=599;AF=0.36436;AN=1644;DS;set=Intersection
22	45128233	.	G	A	174.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45128288	.	G	C	76520.78	PASS	AC=1109;AF=0.67457;AN=1644;DS;set=Intersection
22	45130867	.	G	C	463.97	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45130873	.	A	G	180.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45130894	.	C	A	6213.03	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	45130900	.	C	A	520.91	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45130932	.	C	T	234.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45130947	.	G	A	238.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45130949	.	C	T	172.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45130957	.	G	A	8131.33	PASS	AC=25;AF=0.01521;AN=1644;DS;set=Intersection
22	45130997	.	G	A	990.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45131053	.	G	A	16558.52	PASS	AC=140;AF=0.08516;AN=1644;DS;set=Intersection
22	45131086	.	G	T	789.98	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45131087	.	G	T	728.09	PASS	AC=5;AF=0.00305;AN=1642;DS;set=Intersection
22	45131092	.	C	T	1361.76	PASS	AC=17;AF=0.01040;AN=1634;DS;set=Intersection
22	45132638	.	G	A	768.11	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	45132665	.	C	A	378.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45132675	.	C	T	252	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	45132687	.	G	A	30522.57	PASS	AC=142;AF=0.08637;AN=1644;DS;set=Intersection
22	45132704	.	T	C	19490.48	PASS	AC=97;AF=0.05900;AN=1644;DS;set=Intersection
22	45132725	.	C	T	308.23	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45132785	.	T	C	8184.43	PASS	AC=96;AF=0.05890;AN=1630;DS;set=Intersection
22	45132794	.	C	T	48.65	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	45132831	.	G	A	992.15	PASS	AC=7;AF=0.00426;AN=1642;DS;set=Intersection
22	45132853	.	C	T	766.86	PASS	AC=8;AF=0.00488;AN=1638;DS;set=Intersection
22	45132854	.	G	A	253.59	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	45132857	.	C	T	149.94	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	45132896	.	G	A	260.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45133173	.	CG	C	190.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45133174	.	G	A	140.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45182361	.	C	T	75.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45182362	.	G	A	199.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45182428	.	G	A	560.82	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	45182436	.	C	T	112.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45182453	.	G	A	306.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45182466	.	A	G	328.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45198000	.	C	T	664.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45198002	.	G	A	812.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45198009	.	A	G	169751.13	PASS	AC=993;AF=0.60401;AN=1644;DS;set=Intersection
22	45198034	.	C	T	6413.95	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	45204163	.	C	A	1121.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45204235	.	C	A	811.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45204354	.	G	T	517.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45210505	.	T	A	5106.99	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	45210514	.	C	T	2491.52	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45210633	.	C	T	1290.15	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45210666	.	G	A	98999.96	PASS	AC=464;AF=0.28224;AN=1644;DS;set=Intersection
22	45210675	.	G	A	971.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45210685	.	C	T	8524.77	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	45218206	.	G	A	3043.14	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45218211	.	C	T	8330.81	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	45218223	.	C	T	324980.14	PASS	AC=1565;AF=0.95195;AN=1644;DS;set=Intersection
22	45218286	.	A	G	61743	PASS	AC=54;AF=0.03285;AN=1644;DS;set=Intersection
22	45218318	.	G	T	940.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45218339	.	G	A	1812.51	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45218349	.	GGTAA	G	1624.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45218385	.	A	G	517.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45221334	.	T	A	219.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45221398	.	G	A	1269.13	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	45221404	.	C	T	10453.05	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	45221423	.	A	T	23174.89	PASS	AC=184;AF=0.11192;AN=1644;DS;set=Intersection
22	45221485	.	G	A	1967.05	PASS	AC=5;AF=0.00305;AN=1642;DS;set=Intersection
22	45241102	.	C	G	627.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45241125	.	C	T	621.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45241179	.	C	A	415.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45241205	.	C	T	688.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45241206	.	G	A	1045.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45243842	.	C	G	329.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45243863	.	C	T	716.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45243899	.	C	T	431.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45243914	.	G	A	647.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45243920	.	C	A	212.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45243933	.	G	A	280.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45243980	.	C	T	414.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45244782	.	G	C	8861.87	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	45244784	.	C	A	2484.15	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45244819	.	C	T	893.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45244919	.	G	A	2364.88	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45244930	.	C	T	201188.59	PASS	AC=549;AF=0.33394;AN=1644;DS;set=Intersection
22	45244945	.	G	A	9282.01	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	45244967	.	G	T	9099.54	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	45244983	.	A	G	774.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45255580	.	G	C	57880.52	PASS	AC=369;AF=0.22473;AN=1642;DS;set=Intersection
22	45255594	.	G	A	429.93	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	45255599	.	A	C	4539.65	PASS	AC=7;AF=0.00426;AN=1642;DS;set=Intersection
22	45255628	.	C	T	13855.59	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	45255637	.	G	C	89122.09	PASS	AC=447;AF=0.27190;AN=1644;DS;set=Intersection
22	45255644	.	G	T	932.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45255655	.	C	A,T	1195.25	PASS	AC=1,3;AF=0.00061,0.00182;AN=1644;DS;set=Intersection
22	45255663	.	C	T	806.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45255677	.	A	G	847.36	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45255681	.	C	T	1122.34	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45255682	.	G	A	915.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45255687	.	C	T	1251.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45255688	.	C	T	2354.66	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	45255689	.	G	T	1425.38	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45255711	.	T	C	640.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45255713	.	C	T	1748.04	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45255714	.	G	A,C,T	2755.50	PASS	AC=8,2,0;AF=0.00487,0.00122,0.00000;AN=1644;DS;set=Intersection
22	45255727	.	G	C	49731.30	PASS	AC=365;AF=0.22202;AN=1644;DS;set=Intersection
22	45255728	.	G	C	1623.01	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45255732	.	G	GA	4377.27	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	45255735	.	C	T	471.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45255749	.	C	T	1979.09	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45255751	.	G	T	131.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45255763	.	C	G	1565.31	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45255764	.	C	A	476.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45258106	.	C	T	2011.95	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	45258130	.	TTTAC	T	21015.62	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	45258149	.	C	T	1024.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258160	.	C	G	1674.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45258162	.	G	A	2359.39	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45258168	.	G	A	950.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45258187	.	C	G	830.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258211	.	C	T	761.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258233	.	T	G	584.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258234	.	C	G	1118.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258253	.	G	A	1085.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258265	.	G	C	395.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258284	.	G	C	1325.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45258295	.	C	A	4365.91	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45258296	.	G	A	2790.10	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45258324	.	C	T	85257.75	PASS	AC=386;AF=0.23479;AN=1644;DS;set=Intersection
22	45258325	.	G	A	1696.69	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45258333	.	C	G	29183.25	PASS	AC=99;AF=0.06022;AN=1644;DS;set=Intersection
22	45258343	.	C	T	2004.12	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45258344	.	G	A	480.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45258349	.	G	A	613.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258361	.	ACAGGGGAG	A	978.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258373	.	G	C	7132.58	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	45258401	.	C	T	825.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45258402	.	G	A	1776.27	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45258414	.	C	T	232	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45258427	.	G	T	563.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258457	.	A	G	20700.32	PASS	AC=90;AF=0.05474;AN=1644;DS;set=Intersection
22	45258481	.	C	T	4866.65	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45258486	.	ACT	A	8703.96	PASS	AC=189;AF=0.11496;AN=1644;DS;set=Intersection
22	45258489	.	CTG	C	69083.93	PASS	AC=240;AF=0.14599;AN=1644;DS;set=Intersection
22	45258491	.	GTATA	G	122230.28	PASS	AC=593;AF=0.36071;AN=1644;DS;set=Intersection
22	45258511	.	C	T	512.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45258513	.	C	T	8793.71	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	45258516	.	C	T	776.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45278938	.	C	T	554.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45278963	.	G	C	413.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45279003	.	G	A	1773.33	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45279034	.	C	T	2121.94	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45279119	.	G	A	8369.34	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	45279176	.	C	T	575.26	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45279192	.	G	A	13711.79	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	45279222	.	T	G	198.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45279223	.	C	T	1078.09	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45279224	.	G	A	425.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45281269	.	G	A	394.05	PASS	AC=3;AF=0.00186;AN=1612;set=Intersection
22	45281696	.	G	A	198.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45281715	.	C	G	928.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45283897	.	C	T	13873.22	PASS	AC=207;AF=0.12778;AN=1620;DS;set=Intersection
22	45283971	.	C	T	446.51	PASS	AC=6;AF=0.00385;AN=1558;set=Intersection
22	45283999	.	G	A	106.74	PASS	AC=1;AF=0.00067;AN=1502;set=Intersection
22	45285621	.	G	A	737.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45287218	.	T	C	437.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45289325	.	C	T	41.76	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	45291943	.	C	A	4829.05	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45291948	.	C	T	920.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45291975	.	AACAG	A	1585.64	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45309653	.	C	T	123448.77	PASS	AC=1217;AF=0.74027;AN=1644;DS;set=Intersection
22	45309673	.	C	T	804.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45309680	.	C	T	1325.10	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45309685	.	G	A	430.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45309727	.	C	T	533.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45309851	.	T	C	2072.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45309892	.	G	C	846.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45312113	.	T	C	19691.09	PASS	AC=189;AF=0.11496;AN=1644;set=Intersection
22	45312124	.	G	A	667.19	PASS	AC=5;AF=0.00304;AN=1644;set=Intersection
22	45312244	.	G	A	31199.10	PASS	AC=175;AF=0.10658;AN=1642;DS;set=Intersection
22	45312245	.	G	A	219.32	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	45312274	.	G	A	376.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45312306	.	C	T	1980.86	PASS	AC=13;AF=0.00792;AN=1642;DS;set=Intersection
22	45312307	.	G	A	626.82	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	45312345	.	C	T	21695.78	PASS	AC=115;AF=0.07004;AN=1642;DS;set=Intersection
22	45312430	.	G	C	682.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45312455	.	C	T	2085.98	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45312474	.	C	T	630.34	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45316250	.	C	T	500.30	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	45316293	.	C	T	443.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45404497	.	G	A	704.33	PASS	AC=43;AF=0.02749;AN=1564;set=Intersection
22	45405433	.	C	T	1471.40	PASS	AC=56;AF=0.03851;AN=1454;set=Intersection
22	45405434	.	G	C	433.54	PASS	AC=17;AF=0.01181;AN=1440;set=Intersection
22	45564028	.	C	T	899.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45564161	.	T	G	8323.52	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	45567477	.	G	T	17061.14	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	45567544	.	C	T	632	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45567580	.	C	A	156002.06	PASS	AC=520;AF=0.31630;AN=1644;DS;set=Intersection
22	45567585	.	C	A	999.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45571735	.	A	C	1264.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45571887	.	C	T	887.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45571926	.	G	A	672.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45577231	.	T	C	134358.77	PASS	AC=524;AF=0.31873;AN=1644;DS;set=Intersection
22	45577260	.	C	G	713.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45579422	.	A	G	192275	PASS	AC=742;AF=0.45134;AN=1644;DS;set=Intersection
22	45580435	.	GAGA	G	934.23	PASS	AC=1;AF=0.00064;AN=1562;DS;set=Intersection
22	45580569	.	G	GTT	70640.38	PASS	AC=482;AF=0.29319;AN=1644;DS;set=Intersection
22	45593055	.	G	A	14596.48	PASS	AC=153;AF=0.11435;AN=1338;DS;set=Intersection
22	45593660	.	G	A	543.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45593661	.	C	T	44205.89	PASS	AC=185;AF=0.11253;AN=1644;DS;set=Intersection
22	45593696	.	C	T	902.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45593765	.	G	A	83665.28	PASS	AC=92;AF=0.05596;AN=1644;DS;set=Intersection
22	45593873	.	G	A	581.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45593874	.	C	T	1984.24	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45595707	.	A	G	5634.41	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	45595721	.	A	G	186494.54	PASS	AC=1181;AF=0.71837;AN=1644;DS;set=Intersection
22	45595726	.	G	A	913.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45595797	.	C	T	866.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45595833	.	G	C	30507.21	PASS	AC=43;AF=0.02616;AN=1644;DS;set=Intersection
22	45595872	.	C	A	28895.11	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	45595882	.	C	T	333.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45595946	.	T	C	277.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45595949	.	C	T	87.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45595963	.	C	T	885.07	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45598833	.	C	T	49243.40	PASS	AC=525;AF=0.31934;AN=1644;DS;set=Intersection
22	45599054	.	G	A	7255.12	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	45599099	.	A	G	25149.09	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	45599712	.	C	T	2074.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45601214	.	AT	A	251.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45601611	.	G	A	42688.90	PASS	AC=190;AF=0.11557;AN=1644;DS;set=Intersection
22	45601715	.	C	T	1270.58	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45607855	.	G	A	1906.15	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45608096	.	G	T	1936.17	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45608136	.	C	T	854.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45608192	.	G	A	15092.47	PASS	AC=86;AF=0.05231;AN=1644;DS;set=Intersection
22	45608215	.	G	A	824.35	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45680870	.	G	C	958.19	PASS	AC=59;AF=0.0669;AN=882;set=Intersection
22	45681841	.	A	G	1065.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45681859	.	C	T	1497.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45681947	.	G	A	834.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45681971	.	G	A	999.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45682007	.	C	T	891.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45683012	.	C	T	495.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45683036	.	C	G	36769.07	PASS	AC=104;AF=0.06326;AN=1644;DS;set=Intersection
22	45683042	.	C	T	325.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45683103	.	T	G	4565.53	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45683104	.	C	A	4584.77	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45683116	.	A	T	13913.18	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	45683200	.	T	C	1508.79	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45683246	.	C	T	115330.50	PASS	AC=985;AF=0.59915;AN=1644;DS;set=Intersection
22	45683280	.	C	T	1016.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45683291	.	G	C	533.87	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45683304	.	G	C	120616.21	PASS	AC=1260;AF=0.76642;AN=1644;DS;set=Intersection
22	45683306	.	AC	A	832.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45683309	.	C	T	11019.93	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	45683363	.	C	T	352.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45684894	.	G	A	312.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45684929	.	C	T	969.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45684998	.	G	A	10828.20	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	45685002	.	A	G	246191.16	PASS	AC=991;AF=0.60280;AN=1644;DS;set=Intersection
22	45685024	.	C	T	297.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45685025	.	G	A	2275.74	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45685074	.	C	T	13517.24	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	45689024	.	C	T	947.71	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45689025	.	G	A	745.93	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45689034	.	G	A	903.01	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45689043	.	G	C	1795.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45689056	.	C	T	711.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45689078	.	G	A	8279.14	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	45689097	.	C	A	545.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45689118	.	G	A	2627.12	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45689202	.	C	G	1845.59	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45691521	.	C	T	1063.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45691594	.	A	G	227406.88	PASS	AC=915;AF=0.55657;AN=1644;DS;set=Intersection
22	45718357	.	C	T	956.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45719015	.	C	T	1216.84	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45719104	.	G	A	1082.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45719125	.	C	T	2553.28	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45719183	.	G	A	795.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45719240	.	C	T	579.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45719327	.	C	A	221.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45723696	.	G	C	164115.51	PASS	AC=819;AF=0.49818;AN=1644;DS;set=Intersection
22	45723705	.	C	T	427.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45723749	.	C	T	327.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45723765	.	A	G	1050.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45723779	.	C	T	682.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45723799	.	G	A	459.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45723807	.	G	C	198833.90	PASS	AC=806;AF=0.49027;AN=1644;DS;set=Intersection
22	45723813	.	C	T	428.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45723821	.	G	A	501.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45723842	.	G	A	175586.30	PASS	AC=802;AF=0.48783;AN=1644;DS;set=Intersection
22	45723846	.	G	A	1946.56	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45723854	.	C	G	123525.47	PASS	AC=646;AF=0.39294;AN=1644;DS;set=Intersection
22	45723902	.	G	C	707.39	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45726601	.	G	A	751.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45726641	.	C	T	4500.93	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	45728278	.	A	G	672.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45728302	.	C	T	801.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45728370	.	G	A	317487.71	PASS	AC=777;AF=0.47263;AN=1644;DS;set=Intersection
22	45728482	.	A	G	3137	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	45728524	.	C	T	819.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45728540	.	C	G	886.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45728596	.	G	A	9288.72	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	45728615	.	C	G	623.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45728632	.	CT	C,CTTT,CTTTT	139229.41	PASS	AC=199,211,441;AF=0.12105,0.12835,0.26825;AN=1644;DS;set=Intersection
22	45731182	.	C	T	169582.75	PASS	AC=655;AF=0.39842;AN=1644;DS;set=Intersection
22	45731193	.	T	A	861.13	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45731198	.	C	T	1376.21	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45731199	.	G	A	9058.85	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	45731279	.	C	A	554.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45731303	.	T	C	1114.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45731304	.	A	G	1925.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45732165	.	G	A	787.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45732175	.	T	C	606.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45732313	.	G	A	909.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45732328	.	G	A	125680.22	PASS	AC=665;AF=0.40450;AN=1644;DS;set=Intersection
22	45736218	.	T	C	12803.54	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	45736327	.	T	G	473.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45740401	.	C	G	2298.90	PASS	AC=6;AF=0.00481;AN=1248;DS;set=Intersection
22	45740462	.	C	G	6354.59	PASS	AC=8;AF=0.00635;AN=1260;DS;set=Intersection
22	45741320	.	C	T	1597.97	PASS	AC=4;AF=0.00337;AN=1188;DS;set=Intersection
22	45741364	.	G	A	12496.65	PASS	AC=13;AF=0.01064;AN=1222;DS;set=Intersection
22	45741416	.	T	A	12198.57	PASS	AC=12;AF=0.00976;AN=1230;DS;set=Intersection
22	45745691	.	T	C	921.74	PASS	AC=2;AF=0.00182;AN=1100;DS;set=Intersection
22	45748284	.	C	CT	299486.32	PASS	AC=1124;AF=1.00000;AN=1124;DS;set=Intersection
22	45748285	.	T	TC	53434.69	PASS	AC=1122;AF=0.99822;AN=1124;DS;set=Intersection
22	45748302	.	T	G	668.66	PASS	AC=1;AF=0.00089;AN=1126;DS;set=Intersection
22	45748339	.	A	G	100327.90	PASS	AC=400;AF=0.34904;AN=1146;DS;set=Intersection
22	45749966	.	G	C	36407.88	PASS	AC=60;AF=0.04762;AN=1260;DS;set=Intersection
22	45749983	.	G	T	142588.16	PASS	AC=431;AF=0.34206;AN=1260;DS;set=Intersection
22	45750920	.	A	G	1501.43	PASS	AC=4;AF=0.00313;AN=1278;DS;set=Intersection
22	45754558	.	A	G	128288.94	PASS	AC=396;AF=0.36330;AN=1090;DS;set=Intersection
22	45755666	.	C	T	122796.08	PASS	AC=416;AF=0.35739;AN=1164;DS;set=Intersection
22	45755814	.	T	G	5276.49	PASS	AC=7;AF=0.00618;AN=1132;DS;set=Intersection
22	45755848	.	C	T	10648.83	PASS	AC=17;AF=0.01510;AN=1126;DS;set=Intersection
22	45755856	.	T	G	182.96	PASS	AC=1;AF=0.00089;AN=1118;DS;set=Intersection
22	45755888	.	G	A	1149.32	PASS	AC=2;AF=0.00180;AN=1110;DS;set=Intersection
22	45758754	.	T	C	2309.28	PASS	AC=2;AF=0.00166;AN=1208;DS;set=Intersection
22	45758758	.	T	C	128055.58	PASS	AC=415;AF=0.34699;AN=1196;DS;set=Intersection
22	45767369	.	A	G	35326.93	PASS	AC=142;AF=0.12747;AN=1114;DS;set=Intersection
22	45767391	.	C	T	39774.66	PASS	AC=151;AF=0.13678;AN=1104;DS;set=Intersection
22	45767413	.	A	G	20702.69	PASS	AC=26;AF=0.02372;AN=1096;DS;set=Intersection
22	45767421	.	C	T	31334.45	PASS	AC=122;AF=0.11172;AN=1092;DS;set=Intersection
22	45767455	.	A	G	267450.22	PASS	AC=699;AF=0.64483;AN=1084;DS;set=Intersection
22	45767996	.	G	A	595.89	PASS	AC=1;AF=0.00089;AN=1118;DS;set=Intersection
22	45779335	.	A	G	296673.45	PASS	AC=745;AF=0.65009;AN=1146;DS;set=Intersection
22	45779338	.	T	C	696.65	PASS	AC=1;AF=0.00087;AN=1144;DS;set=Intersection
22	45782720	.	A	T	8709.43	PASS	AC=7;AF=0.00625;AN=1120;DS;set=Intersection
22	45782903	.	T	C	307577.86	PASS	AC=609;AF=0.54570;AN=1116;DS;set=Intersection
22	45785562	.	T	C	7818.53	PASS	AC=7;AF=0.00636;AN=1100;DS;set=Intersection
22	45785574	.	G	T	736.47	PASS	AC=1;AF=0.00091;AN=1104;DS;set=Intersection
22	45789642	.	A	C	289649.41	PASS	AC=1132;AF=1.00000;AN=1132;DS;set=Intersection
22	45789743	.	T	G	13711.12	PASS	AC=129;AF=0.11296;AN=1142;DS;set=Intersection
22	45792291	.	G	C	2116.66	PASS	AC=3;AF=0.00245;AN=1224;DS;set=Intersection
22	45792359	.	C	T	850.07	PASS	AC=1;AF=0.00085;AN=1178;DS;set=Intersection
22	45794925	.	C	A	299265.06	PASS	AC=730;AF=0.63923;AN=1142;DS;set=Intersection
22	45794996	.	G	A	1021.20	PASS	AC=1;AF=0.00087;AN=1154;DS;set=Intersection
22	45795041	.	A	T	493.42	PASS	AC=1;AF=0.00085;AN=1176;DS;set=Intersection
22	45795126	.	T	C	551.23	PASS	AC=1;AF=0.00082;AN=1218;DS;set=Intersection
22	45798329	.	A	G	5594.90	PASS	AC=7;AF=0.00625;AN=1120;DS;set=Intersection
22	45798386	.	T	C	6722.41	PASS	AC=6;AF=0.00538;AN=1116;DS;set=Intersection
22	45802407	.	C	T	1678.06	PASS	AC=2;AF=0.00172;AN=1164;DS;set=Intersection
22	45802704	.	C	T	503.37	PASS	AC=1;AF=0.00088;AN=1138;DS;set=Intersection
22	45802760	.	AT	A	2964.34	PASS	AC=9;AF=0.00796;AN=1130;DS;set=Intersection
22	45802789	.	C	A	203.10	PASS	AC=1;AF=0.00088;AN=1142;DS;set=Intersection
22	45804568	.	GA	G	385.99	PASS	AC=2;AF=0.00170;AN=1174;DS;set=Intersection
22	45804621	.	C	T	289.18	PASS	AC=1;AF=0.00084;AN=1190;DS;set=Intersection
22	45804825	.	A	C	5436.11	PASS	AC=17;AF=0.01463;AN=1162;DS;set=Intersection
22	45809325	.	G	A	36.46	PASS	AC=1;AF=0.00092;AN=1084;set=Intersection
22	45809431	.	C	T	63.10	PASS	AC=1;AF=0.00083;AN=1208;set=Intersection
22	45914528	.	A	G	165.06	PASS	AC=4;AF=0.00244;AN=1636;DS;set=Intersection
22	45914534	.	C	T	92.85	PASS	AC=1;AF=0.00061;AN=1632;DS;set=Intersection
22	45914541	.	C	T	14191.76	PASS	AC=94;AF=0.05760;AN=1632;DS;set=Intersection
22	45914595	.	C	T	703.45	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	45914671	.	C	T	572.16	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45914675	.	T	C	37355.11	PASS	AC=278;AF=0.16910;AN=1644;DS;set=Intersection
22	45914692	.	T	G	15418.19	PASS	AC=91;AF=0.05549;AN=1640;DS;set=Intersection
22	45914714	.	G	C	8770.50	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	45921549	.	A	G	197.03	PASS	AC=7;AF=0.00477;AN=1468;DS;set=Intersection
22	45923827	.	A	G	299504.67	PASS	AC=1643;AF=0.99939;AN=1644;DS;set=Intersection
22	45923870	.	C	T	998.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45923886	.	A	G	523.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45923894	.	C	A	26323.40	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	45923937	.	C	T	883.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45927112	.	A	G	42712.54	PASS	AC=158;AF=0.09611;AN=1644;DS;set=Intersection
22	45927150	.	A	G	949.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45927220	.	C	G	81883.10	PASS	AC=242;AF=0.14720;AN=1644;DS;set=Intersection
22	45928895	.	C	A	285.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45928950	.	G	A	533.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45929080	.	C	T	5630.01	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	45929594	.	TG	T	89967.68	PASS	AC=438;AF=0.26642;AN=1644;DS;set=Intersection
22	45929597	.	GT	G	10039.94	PASS	AC=318;AF=0.19343;AN=1644;DS;set=Intersection
22	45929614	.	C	T	36076.47	PASS	AC=117;AF=0.07117;AN=1644;DS;set=Intersection
22	45929618	.	C	T	904.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45929694	.	A	C	972.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45929816	.	C	T	884.34	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	45929820	.	C	T	351.79	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	45929828	.	C	T	752.55	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	45931223	.	A	C	2406.86	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45931231	.	C	T	1497.20	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45931243	.	C	T	971.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45931244	.	G	A	2662.94	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45931262	.	C	T	172779.31	PASS	AC=1293;AF=0.78650;AN=1644;DS;set=Intersection
22	45937061	.	G	A	123464.37	PASS	AC=504;AF=0.30657;AN=1644;DS;set=Intersection
22	45937102	.	G	A	6670.26	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	45937143	.	C	T	6743.85	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	45937149	.	C	T	129965.22	PASS	AC=506;AF=0.30779;AN=1644;DS;set=Intersection
22	45938087	.	C	T	1045.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45938088	.	G	A	1887.42	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45938204	.	C	T	1788.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45939294	.	C	T	694.72	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	45939320	.	G	T	108.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45942925	.	G	A	833.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45942951	.	G	A	4385.54	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45943011	.	C	T	2370.03	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45943089	.	G	A	913.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45943093	.	G	A	2196.43	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	45943107	.	A	C	1828.56	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45943115	.	A	G	2957.15	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45943134	.	A	G	52.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45944495	.	A	T	150	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45944507	.	G	A	336.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45944518	.	C	T	957.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45944593	.	C	T	2687.20	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45944657	.	G	A	196.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45946460	.	C	T	940.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45946488	.	G	A	10754.39	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	45946495	.	C	T	899.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	45958823	.	C	T	856.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45958897	.	G	A	1114.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45958933	.	C	T	2614.97	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	45958934	.	G	A	770.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45959089	.	C	T	638.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45959157	.	C	T	9778.68	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	45960778	.	AG	A	553.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45960864	.	G	T	6816.86	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	45970360	.	C	T	5115.67	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	45970369	.	C	T	1762.10	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	45970414	.	C	T	431.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45970559	.	C	T	655.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45970572	.	G	T	5618.47	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	45970582	.	G	A	981.58	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	45972871	.	C	T	328.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45972888	.	G	A	27255.23	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	45972941	.	G	T	827.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45972983	.	C	A	507.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45996239	.	G	A	1459.78	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	45996254	.	T	C	1108.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45996266	.	C	T	723.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45996280	.	G	A	968.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	45996293	.	C	T	47565.77	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	45996298	.	A	G	8668.52	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	45996361	.	C	G	18889.47	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	46067998	.	C	T	68.31	PASS	AC=1;AF=0.00083;AN=1210;set=Intersection
22	46085654	.	C	T	562.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46085671	.	A	G	510.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46085782	.	A	G	913.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46085795	.	C	T	7108.89	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46088888	.	G	A	1577.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46088894	.	T	C	390.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46088977	.	C	T	1301.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46088978	.	A	G	1404	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	46088993	.	C	G	142.84	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46089008	.	A	G	4881.73	PASS	AC=8;AF=0.00487;AN=1642;DS;set=Intersection
22	46096174	.	G	T	1682.23	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46114244	.	C	T	83323.94	PASS	AC=209;AF=0.12713;AN=1644;DS;set=Intersection
22	46114249	.	A	G	1973.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46114289	.	C	G	817.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46114398	.	G	T	229779.91	PASS	AC=615;AF=0.37409;AN=1644;DS;set=Intersection
22	46125284	.	G	T	597.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46125296	.	G	A	774.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46125385	.	G	A	719.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46125442	.	T	A	1157.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46125462	.	G	A	771.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46125480	.	G	T	5897.59	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46136298	.	C	T	648.07	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46136372	.	G	A	474.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46136438	.	T	C	2080.73	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46202819	.	C	T	11325.12	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	46202925	.	A	G	41104.13	PASS	AC=116;AF=0.07056;AN=1644;DS;set=Intersection
22	46238838	.	G	A	5612.93	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	46238911	.	C	T	854.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46238914	.	A	C	2129.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46238930	.	C	A	4096.80	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46239534	.	TTTC	T	1207.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46318697	.	C	T	97.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46318726	.	G	A	2885.53	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	46318739	.	C	T	884.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46318757	.	G	A	6942.42	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	46318859	.	G	A	558.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46318880	.	G	A	6035	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	46318884	.	G	A	1028.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46318892	.	C	T	961.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46318934	.	C	T	6539.09	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	46319014	.	G	A	128.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46319036	.	G	T	12648	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	46319063	.	C	T	555.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46319159	.	G	A	408.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46319177	.	G	A	725.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46319244	.	C	T	288.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46319245	.	G	A	148.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46326951	.	C	T	422.87	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	46326971	.	A	C	790.45	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	46327010	.	T	C	155.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46327071	.	G	C	1102.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46327098	.	G	C	489.96	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46327122	.	G	C	601.08	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46327148	.	C	T	558.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46327188	.	G	A	897.03	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	46327227	.	C	A	214.64	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	46327265	.	G	T	565.57	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	46327266	.	G	A	2820.06	PASS	AC=32;AF=0.01951;AN=1640;DS;set=Intersection
22	46327272	.	A	G	5073.70	PASS	AC=70;AF=0.04274;AN=1638;DS;set=Intersection
22	46327296	.	CA	C	117.94	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	46345815	.	G	A	857.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46345825	.	G	A	24434.42	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	46345834	.	G	A	434.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46345837	.	G	A	1852.74	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46345900	.	C	T	389.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46345930	.	G	A	1271.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46346058	.	C	T	213.69	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46372519	.	G	T	252.13	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46372520	.	C	T	240.54	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46372528	.	G	A	488.14	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	46449810	.	C	T	37.34	PASS	AC=3;AF=0.00217;AN=1382;set=Intersection
22	46449889	.	T	G	502.15	PASS	AC=15;AF=0.01058;AN=1418;set=Intersection
22	46449891	.	G	A	8434.15	PASS	AC=344;AF=0.24090;AN=1428;set=Intersection
22	46594271	.	T	C	2515.14	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46594280	.	G	A	636.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46594319	.	A	G	858.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46594382	.	C	T	1032.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46594436	.	G	A	318.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46611026	.	A	G	512.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46611051	.	C	T	1871.49	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46611106	.	C	T	755.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46611153	.	T	C	5441.63	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	46611263	.	G	A	19058.19	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	46611265	.	C	T	1418.13	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46614137	.	TCC	T	4995.91	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46614147	.	A	G	2069.65	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46614208	.	G	A	918.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46614274	.	C	G	18801	PASS	AC=43;AF=0.02616;AN=1644;DS;set=Intersection
22	46614333	.	G	A	880.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46615732	.	A	G	977.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46615750	.	C	T	2277.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46615880	.	T	C	14870.32	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	46615905	.	C	T	7098.48	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46627735	.	C	T	568.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46627780	.	C	T	4899.69	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	46627781	.	G	A	798.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46627847	.	C	T	759.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46627970	.	G	A	1180.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46631027	.	T	C	813.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46631192	.	C	T	414.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46631206	.	A	C	712.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46631305	.	C	T	147.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46640967	.	G	A	11277.01	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	46640992	.	C	T	1411.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46642967	.	C	T	853.46	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46643023	.	A	C	29474.65	PASS	AC=146;AF=0.08881;AN=1644;DS;set=Intersection
22	46643124	.	G	A	1553.48	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46643131	.	GA	G	12246.36	PASS	AC=136;AF=0.08273;AN=1644;DS;set=Intersection
22	46643132	.	A	G	15708.58	PASS	AC=137;AF=0.08333;AN=1644;DS;set=Intersection
22	46643133	.	A	T	14841.15	PASS	AC=136;AF=0.08273;AN=1644;DS;set=Intersection
22	46643134	.	T	G	15507.31	PASS	AC=135;AF=0.08212;AN=1644;DS;set=Intersection
22	46643135	.	G	C	15951.75	PASS	AC=136;AF=0.08273;AN=1644;DS;set=Intersection
22	46644159	.	C	G	1169.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46644168	.	A	G	121599.56	PASS	AC=389;AF=0.23662;AN=1644;DS;set=Intersection
22	46644177	.	G	A	27056.07	PASS	AC=105;AF=0.06387;AN=1644;DS;set=Intersection
22	46644178	.	C	T	555.01	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46644188	.	G	A	2142.60	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	46652420	.	G	C	533.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46652426	.	C	T	932.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46652427	.	G	A	685.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46652516	.	T	A	1821.29	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46652736	.	C	T	2073.13	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46652737	.	G	A	211894.72	PASS	AC=315;AF=0.19161;AN=1644;DS;set=Intersection
22	46652892	.	C	A	97.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46652929	.	G	A	192422.74	PASS	AC=315;AF=0.19161;AN=1644;DS;set=Intersection
22	46652959	.	A	G	246075.35	PASS	AC=530;AF=0.32238;AN=1644;DS;set=Intersection
22	46652994	.	G	A	1009.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46653095	.	G	A,C	1890.92	PASS	AC=1,2;AF=0.00061,0.00122;AN=1644;DS;set=Intersection
22	46653187	.	C	T	1218.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46653398	.	CCTAA	C	628.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46653532	.	C	T	1885.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46653548	.	C	T	1411.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46653661	.	G	T	940.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46653685	.	A	C	1211.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46653781	.	C	T	946.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46653806	.	A	AT	765.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46653865	.	C	T	1035.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46654035	.	C	T	49248.83	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	46654081	.	G	T	1123.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46654159	.	T	C	2476.09	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46654188	.	C	T	1962.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46654323	.	G	A	232159.94	PASS	AC=316;AF=0.19221;AN=1644;DS;set=Intersection
22	46654454	.	C	T	1964.58	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46654515	.	G	A	644.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46654554	.	G	C	1034.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46654563	.	C	T	1176.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46654572	.	C	T	1760.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46654598	.	T	C	2140.65	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46654628	.	G	A	2344.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46654636	.	G	C	1168.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46654664	.	G	T	8557.42	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46654672	.	G	A	19481.10	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	46654759	.	G	A	1149.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46654812	.	T	C	1090.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46654850	.	G	A	1121.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655020	.	A	G	1022.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655108	.	A	G	703.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655303	.	G	A	1176.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655313	.	C	T	627.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655344	.	G	A	9824.14	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	46655347	.	C	T	10614.16	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46655365	.	C	T	54206.23	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	46655374	.	G	A	1027.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655391	.	C	T	568.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655434	.	G	A	758.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655653	.	A	G	940.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655668	.	G	C	1086.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655770	.	C	G	1084.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655779	.	G	C	50124.84	PASS	AC=103;AF=0.06265;AN=1644;DS;set=Intersection
22	46655925	.	T	C	1869.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46655948	.	T	C	210333.52	PASS	AC=319;AF=0.19404;AN=1644;DS;set=Intersection
22	46655966	.	C	T	223.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46655969	.	G	C	1214.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46656151	.	C	T	1196.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46656246	.	T	G	238048.16	PASS	AC=301;AF=0.18309;AN=1644;DS;set=Intersection
22	46656275	.	G	C	1445.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46656278	.	G	A	832.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46656304	.	G	A	4610.82	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46656323	.	A	G	1122.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46656358	.	A	G	846.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46656371	.	G	A	712.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46656445	.	C	A	1916.60	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46656479	.	A	G	248079.11	PASS	AC=319;AF=0.19404;AN=1644;DS;set=Intersection
22	46656511	.	A	G	253971.87	PASS	AC=319;AF=0.19404;AN=1644;DS;set=Intersection
22	46656562	.	A	G	57616.79	PASS	AC=54;AF=0.03285;AN=1644;DS;set=Intersection
22	46656571	.	A	G	1186.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46656607	.	G	A	206406.55	PASS	AC=319;AF=0.19404;AN=1644;DS;set=Intersection
22	46656805	.	G	A	214753.44	PASS	AC=313;AF=0.19039;AN=1644;DS;set=Intersection
22	46656812	.	A	G	1012.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46656831	.	G	A	1131.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46656976	.	A	C	916.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46657020	.	G	A	618.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46657047	.	G	A	996.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46657090	.	C	T	1171.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46657143	.	A	G	11883.21	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46657170	.	GTAAC	G	1305.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46657261	.	A	G	224186.73	PASS	AC=319;AF=0.19404;AN=1644;DS;set=Intersection
22	46657308	.	T	C	6059.89	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46657447	.	G	T	939.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46657485	.	T	C	918.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46657591	.	A	G	2222.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46657637	.	C	T	43340.29	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	46657713	.	T	C	1127.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46657768	.	A	G	416.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46657798	.	A	G	237376.25	PASS	AC=315;AF=0.19161;AN=1644;DS;set=Intersection
22	46657881	.	T	C	1747.55	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46658059	.	A	C	816.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46658122	.	C	T	1807.99	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46658204	.	A	G	1173.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46658399	.	G	A	110.41	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	46658461	.	G	T	245.67	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	46658491	.	G	C	326.76	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46658515	.	C	T	484.41	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46658619	.	G	T	421.28	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	46658719	.	G	A	5712.76	PASS	AC=104;AF=0.08025;AN=1296;set=Intersection
22	46658725	.	G	C	4729.41	PASS	AC=109;AF=0.09429;AN=1156;set=Intersection
22	46658747	.	G	A	122.89	PASS	AC=1;AF=0.0030;AN=334;set=Intersection
22	46658926	.	G	A	58.70	PASS	AC=1;AF=0.0037;AN=270;set=Intersection
22	46658978	.	T	C	554.60	PASS	AC=33;AF=0.1320;AN=250;set=Intersection
22	46659143	.	A	G	291.70	PASS	AC=20;AF=0.1064;AN=188;set=Intersection
22	46659186	.	C	A	209.42	PASS	AC=33;AF=0.0864;AN=382;set=Intersection
22	46663887	.	A	C	105.53	PASS	AC=2;AF=0.0030;AN=672;set=Intersection
22	46663917	.	G	A	68.17	PASS	AC=1;AF=0.0013;AN=768;set=Intersection
22	46664409	.	A	G	1218.91	PASS	AC=6;AF=0.00394;AN=1522;DS;set=Intersection
22	46664412	.	C	T	1510.74	PASS	AC=9;AF=0.00592;AN=1520;DS;set=Intersection
22	46664431	.	C	G	72189.55	PASS	AC=165;AF=0.10942;AN=1508;DS;set=Intersection
22	46668352	.	A	G	73149.23	PASS	AC=164;AF=0.12674;AN=1294;DS;set=Intersection
22	46669887	.	A	G	901.03	PASS	AC=2;AF=0.00145;AN=1384;DS;set=Intersection
22	46669913	.	G	T	582.27	PASS	AC=3;AF=0.00214;AN=1402;DS;set=Intersection
22	46669946	.	A	G	436.55	PASS	AC=1;AF=0.00070;AN=1434;DS;set=Intersection
22	46671154	.	G	A	25328.33	PASS	AC=26;AF=0.02131;AN=1220;DS;set=Intersection
22	46671196	.	G	A	10015.53	PASS	AC=8;AF=0.00655;AN=1222;DS;set=Intersection
22	46671241	.	C	T	843.45	PASS	AC=1;AF=0.00083;AN=1210;DS;set=Intersection
22	46674516	.	G	A	868	PASS	AC=1;AF=0.00083;AN=1212;DS;set=Intersection
22	46674554	.	A	G	2552.92	PASS	AC=3;AF=0.00257;AN=1168;DS;set=Intersection
22	46674564	.	T	G	316.55	PASS	AC=1;AF=0.00087;AN=1152;DS;set=Intersection
22	46674603	.	C	T	20113.05	PASS	AC=46;AF=0.03952;AN=1164;DS;set=Intersection
22	46677483	.	G	A	11352.58	PASS	AC=10;AF=0.00751;AN=1332;DS;set=Intersection
22	46677553	.	G	A	924.20	PASS	AC=1;AF=0.00072;AN=1380;DS;set=Intersection
22	46677573	.	G	A	703.50	PASS	AC=1;AF=0.00073;AN=1370;DS;set=Intersection
22	46677605	.	C	A	839.79	PASS	AC=1;AF=0.00073;AN=1364;DS;set=Intersection
22	46677607	.	T	C	314402.47	PASS	AC=1364;AF=1.00000;AN=1364;DS;set=Intersection
22	46679838	.	T	C	3026.59	PASS	AC=3;AF=0.00264;AN=1136;DS;set=Intersection
22	46679848	.	C	CT	29823.62	PASS	AC=91;AF=0.07872;AN=1156;DS;set=Intersection
22	46679849	.	TC	T	59510.17	PASS	AC=94;AF=0.08103;AN=1160;DS;set=Intersection
22	46679972	.	G	A	2493.17	PASS	AC=3;AF=0.00252;AN=1192;DS;set=Intersection
22	46681141	.	G	A	2342.93	PASS	AC=6;AF=0.00462;AN=1300;DS;set=Intersection
22	46681153	.	G	A	668.81	PASS	AC=1;AF=0.00078;AN=1290;DS;set=Intersection
22	46681173	.	C	G	8270.44	PASS	AC=11;AF=0.00862;AN=1276;DS;set=Intersection
22	46682946	.	C	T	63.23	PASS	AC=1;AF=0.00074;AN=1358;set=Intersection
22	46682955	.	C	T	3047.57	PASS	AC=71;AF=0.05228;AN=1358;set=Intersection
22	46682976	.	C	T	2972.98	PASS	AC=66;AF=0.04776;AN=1382;set=Intersection
22	46682993	.	C	T	553.80	PASS	AC=9;AF=0.00658;AN=1368;set=Intersection
22	46682995	.	A	G	1628.45	PASS	AC=9;AF=0.00658;AN=1368;set=Intersection
22	46683008	.	C	T	397.01	PASS	AC=1;AF=0.00075;AN=1334;set=Intersection
22	46684364	.	C	T	1569.49	PASS	AC=2;AF=0.00173;AN=1154;DS;set=Intersection
22	46684451	.	CAG	C	569.17	PASS	AC=1;AF=0.00083;AN=1212;DS;set=Intersection
22	46684506	.	G	A	682.35	PASS	AC=2;AF=0.00170;AN=1178;DS;set=Intersection
22	46684528	.	C	T	9450.86	PASS	AC=60;AF=0.05000;AN=1200;DS;set=Intersection
22	46685249	.	G	A	23349.31	PASS	AC=91;AF=0.07199;AN=1264;DS;set=Intersection
22	46685274	.	T	C	6969.74	PASS	AC=61;AF=0.05008;AN=1218;DS;set=Intersection
22	46685284	.	G	A	1264.09	PASS	AC=2;AF=0.00167;AN=1200;DS;set=Intersection
22	46685316	.	G	A	326.95	PASS	AC=1;AF=0.00083;AN=1212;DS;set=Intersection
22	46685375	.	G	A	2193.80	PASS	AC=17;AF=0.01436;AN=1184;DS;set=Intersection
22	46685380	.	C	T	9041.55	PASS	AC=61;AF=0.05259;AN=1160;DS;set=Intersection
22	46685401	.	G	A	589.40	PASS	AC=2;AF=0.00175;AN=1144;DS;set=Intersection
22	46685426	.	C	T	326.07	PASS	AC=3;AF=0.00257;AN=1166;DS;set=Intersection
22	46685432	.	G	A	343.96	PASS	AC=1;AF=0.00090;AN=1116;DS;set=Intersection
22	46685711	.	T	G	1241.98	PASS	AC=3;AF=0.00236;AN=1272;DS;set=Intersection
22	46685754	.	C	T	2058.73	PASS	AC=5;AF=0.00380;AN=1316;DS;set=Intersection
22	46688736	.	C	T	451.28	PASS	AC=1;AF=0.00083;AN=1212;DS;set=Intersection
22	46693312	.	C	T	1164.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46693319	.	G	T	1814.98	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46693375	.	A	G	7210.81	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	46704013	.	G	A	12573.84	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	46704039	.	C	T	11194.43	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	46704243	.	C	T	121351.92	PASS	AC=195;AF=0.11861;AN=1644;DS;set=Intersection
22	46704244	.	G	A	1045.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46704372	.	C	T	988.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46704390	.	A	G	996.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46704500	.	C	A	1101.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46704555	.	G	A	44789.83	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	46704580	.	C	T	11606.77	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	46704610	.	G	T	12918.54	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	46704622	.	C	T	463.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46704627	.	C	G	326.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46704676	.	A	G	85439.93	PASS	AC=191;AF=0.11618;AN=1644;DS;set=Intersection
22	46704684	.	G	A	802.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46704687	.	G	A	6248.33	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	46704690	.	G	A	1510.90	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46704734	.	C	T	40437.16	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	46704771	.	C	T	714.80	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46704874	.	C	G	767.52	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	46708152	.	G	A	29593.82	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	46708155	.	G	A	800.58	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46708180	.	G	A	768.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46709827	.	C	T	1123.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46709881	.	G	A	93066.32	PASS	AC=179;AF=0.10888;AN=1644;DS;set=Intersection
22	46711880	.	T	C	106.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46711920	.	A	AC	159530.64	PASS	AC=260;AF=0.15815;AN=1644;DS;set=Intersection
22	46712021	.	C	T	479.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46712077	.	C	T	26362.80	PASS	AC=87;AF=0.05292;AN=1644;DS;set=Intersection
22	46712149	.	G	A	120.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46712216	.	A	G	128.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46712229	.	G	A	5180.88	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46712332	.	T	C	1535.90	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46719054	.	T	C	53535.52	PASS	AC=89;AF=0.05414;AN=1644;DS;set=Intersection
22	46719100	.	C	G	79050.59	PASS	AC=165;AF=0.10036;AN=1644;DS;set=Intersection
22	46719120	.	C	T	5253.60	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	46719141	.	C	T	946.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46719171	.	T	C	42288.93	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	46719177	.	G	A	31876.91	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	46719185	.	T	C	5332.11	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	46722362	.	G	A	1104.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46722397	.	G	A	11620.76	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	46722400	.	T	C	191986.39	PASS	AC=1575;AF=0.95803;AN=1644;DS;set=Intersection
22	46722401	.	G	A	409.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46722419	.	C	T	336.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46722426	.	C	T	32247.85	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	46722436	.	C	T	374.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46722517	.	C	T	396.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46722531	.	C	T	29320.89	PASS	AC=92;AF=0.05596;AN=1644;DS;set=Intersection
22	46722560	.	C	T	100739.14	PASS	AC=286;AF=0.17397;AN=1644;DS;set=Intersection
22	46724553	.	C	G	815.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46724558	.	T	C	335760.99	PASS	AC=1579;AF=0.96046;AN=1644;DS;set=Intersection
22	46724579	.	C	G	674.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46724650	.	G	C	2341.64	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46724703	.	A	T	678	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46724729	.	T	A	1030.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46724731	.	C	G	958.64	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46724746	.	G	A	751.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46724762	.	G	C	1447.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46724769	.	G	C	1696.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46724798	.	G	A	584.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46724801	.	C	T	9815.65	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	46725288	.	G	A	48130.72	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	46725316	.	C	G	869.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46725350	.	T	C	12060.86	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	46725365	.	C	T	1042.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46725913	.	C	T	1110.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46725974	.	C	G	4647.19	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46725985	.	G	A	594.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46731618	.	G	A	44.31	PASS	AC=3;AF=0.00229;AN=1308;set=Intersection
22	46731670	.	C	G	919.42	PASS	AC=27;AF=0.01997;AN=1352;set=Intersection
22	46731671	.	T	G	1054.64	PASS	AC=30;AF=0.02206;AN=1360;set=Intersection
22	46731689	.	G	T	2727.25	PASS	AC=140;AF=0.10309;AN=1358;set=Intersection
22	46731736	.	G	T	404.17	PASS	AC=20;AF=0.01508;AN=1326;set=Intersection
22	46731769	.	C	G	94.39	PASS	AC=1;AF=0.00082;AN=1216;set=Intersection
22	46731770	.	CG	C	2412.98	PASS	AC=213;AF=0.16235;AN=1312;set=Intersection
22	46731771	.	G	C	7558.64	PASS	AC=271;AF=0.21961;AN=1234;set=Intersection
22	46731791	.	G	A	9943.90	PASS	AC=348;AF=0.26565;AN=1310;set=Intersection
22	46733657	.	T	C	46236.28	PASS	AC=56;AF=0.03406;AN=1644;DS;set=Intersection
22	46733831	.	G	A	2345.49	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46733853	.	TCACAGCA	T	835.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46733888	.	C	G	10406.33	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	46739140	.	T	A	14555.77	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	46739261	.	T	C	4217.76	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	46742350	.	A	G	4302.16	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	46742405	.	G	A	20617.83	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	46742455	.	C	T	605.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46742486	.	T	G	206341.08	PASS	AC=219;AF=0.13321;AN=1644;DS;set=Intersection
22	46746188	.	C	T	12422.09	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	46746261	.	C	T	49680.04	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	46746276	.	C	G	1712.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46746319	.	G	A	708.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46746407	.	G	A	11648.99	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	46747975	.	C	T	842.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46747995	.	C	T	2795.20	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46748026	.	C	T	803.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46748130	.	C	G	2962.57	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46748133	.	C	T	882.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46748137	.	G	A	17511.45	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	46749634	.	C	T	36848.61	PASS	AC=72;AF=0.04380;AN=1644;DS;set=Intersection
22	46749744	.	G	A	860.70	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46749755	.	C	T	8430.37	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	46751367	.	G	T	1504.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46751369	.	A	G	684.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46751377	.	C	G	1073.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46751394	.	C	T	11501.44	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	46751415	.	G	A	338.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46751426	.	C	T	260.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46751430	.	G	A	1241.20	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46751443	.	A	G	263.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46751468	.	G	A	396.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46751501	.	GCTC	G	660.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46751530	.	G	A	477.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46751863	.	C	T	103.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46751869	.	C	A	993.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46751949	.	C	T	276.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46752019	.	C	T	151.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46752708	.	C	T	489.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46752712	.	CCT	C	366.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46752795	.	G	A	660.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46752800	.	C	T	525.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46752801	.	G	A	394.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46752813	.	G	A	55783.81	PASS	AC=90;AF=0.05474;AN=1644;DS;set=Intersection
22	46752829	.	C	T	30786.46	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	46752840	.	G	C	1130.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46752911	.	G	C	2771.15	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	46752946	.	T	A,C,G	36039.24	PASS	AC=0,1,91;AF=0.00000,0.00061,0.05535;AN=1644;DS;set=Intersection
22	46759084	.	CCTGATGGTTCAAATTGAAGTTTCATTA	C	34910.94	PASS	AC=68;AF=0.04136;AN=1644;DS;set=Intersection
22	46759901	.	G	A	732.67	PASS	AC=4;AF=0.00244;AN=1642;set=Intersection
22	46759927	.	T	C	68.42	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	46759934	.	A	G	20231.74	PASS	AC=88;AF=0.05353;AN=1644;set=Intersection
22	46759940	.	G	C	504.99	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46759949	.	G	A	463.37	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	46759967	.	C	T	18670.67	PASS	AC=42;AF=0.02555;AN=1644;DS;set=Intersection
22	46759981	.	G	C	20661.86	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	46760000	.	G	A	119.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46760006	.	G	A	438.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46760011	.	C	T	578.15	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46760030	.	CGTGCGCGAGGAT	C	7459.53	PASS	AC=13;AF=0.00793;AN=1640;DS;set=Intersection
22	46760037	.	G	A	13206.67	PASS	AC=28;AF=0.01705;AN=1642;DS;set=Intersection
22	46760065	.	C	T	287.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46760086	.	C	T	70362.18	PASS	AC=253;AF=0.15389;AN=1644;DS;set=Intersection
22	46760102	.	C	T	34633.62	PASS	AC=61;AF=0.03710;AN=1644;DS;set=Intersection
22	46760121	.	G	A	776.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46760193	.	C	T	2112.92	PASS	AC=13;AF=0.00800;AN=1624;DS;set=Intersection
22	46760394	.	G	A	5354.59	PASS	AC=17;AF=0.01035;AN=1642;DS;set=Intersection
22	46760416	.	C	G	46.31	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46760470	.	C	T	370.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46760481	.	C	G	81435.08	PASS	AC=366;AF=0.22263;AN=1644;DS;set=Intersection
22	46760507	.	C	T	86.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46760605	.	G	A	158.48	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46760648	.	C	T	11019.30	PASS	AC=124;AF=0.07589;AN=1634;DS;set=Intersection
22	46760664	.	G	A	6466.42	PASS	AC=46;AF=0.02861;AN=1608;DS;set=Intersection
22	46760665	.	C	T	1474.17	PASS	AC=65;AF=0.04068;AN=1598;DS;set=Intersection
22	46761111	.	G	A	94.03	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46761135	.	G	T	45424.19	PASS	AC=109;AF=0.06630;AN=1644;DS;set=Intersection
22	46761147	.	G	A	489.43	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46761221	.	C	T	388.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46761321	.	G	A	483.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46761435	.	C	T	105.08	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46761440	.	G	A	293.13	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	46761441	.	A	T	345.59	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46761454	.	G	A	1048.51	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	46761455	.	G	A	710.45	PASS	AC=9;AF=0.00548;AN=1642;DS;set=Intersection
22	46761497	.	C	G	60774.11	PASS	AC=425;AF=0.25883;AN=1642;DS;set=Intersection
22	46761520	.	G	A	737.38	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46761561	.	C	T	55.06	PASS	AC=2;AF=0.00122;AN=1640;DS;set=Intersection
22	46761565	.	G	C	962.73	PASS	AC=11;AF=0.00671;AN=1640;DS;set=Intersection
22	46761568	.	C	T	231.72	PASS	AC=5;AF=0.00305;AN=1638;DS;set=Intersection
22	46761595	.	G	A	522.47	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	46761601	.	G	T	134.37	PASS	AC=2;AF=0.00123;AN=1630;DS;set=Intersection
22	46761623	.	G	A	488.85	PASS	AC=1;AF=0.00062;AN=1624;DS;set=Intersection
22	46762260	.	C	T	1296.89	PASS	AC=12;AF=0.00897;AN=1338;set=Intersection
22	46762266	.	C	T	4817.68	PASS	AC=71;AF=0.05175;AN=1372;set=Intersection
22	46762342	.	C	T	38.23	PASS	AC=1;AF=0.00071;AN=1406;DS;set=Intersection
22	46762345	.	G	A	1496.53	PASS	AC=11;AF=0.00786;AN=1400;DS;set=Intersection
22	46762360	.	G	A	556.21	PASS	AC=8;AF=0.00560;AN=1428;DS;set=Intersection
22	46762854	.	A	G	1983.21	PASS	AC=30;AF=0.01859;AN=1614;set=Intersection
22	46762855	.	G	A	6126.15	PASS	AC=42;AF=0.02599;AN=1616;set=Intersection
22	46762863	.	T	A	2033.33	PASS	AC=18;AF=0.01111;AN=1620;set=Intersection
22	46762891	.	G	A	382.02	PASS	AC=2;AF=0.00122;AN=1640;set=Intersection
22	46762902	.	G	A	9508.88	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	46762970	.	G	C	81.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46762988	.	C	T	12063.55	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	46763007	.	G	A	851.27	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	46763578	.	T	C	7116.25	PASS	AC=105;AF=0.06514;AN=1612;set=Intersection
22	46763583	.	G	A	98.38	PASS	AC=1;AF=0.00062;AN=1618;set=Intersection
22	46763584	.	C	T	32.12	PASS	AC=1;AF=0.00062;AN=1616;set=Intersection
22	46763665	.	C	T	260.60	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	46763671	.	A	G	40426.58	PASS	AC=297;AF=0.18110;AN=1640;DS;set=Intersection
22	46763692	.	C	A	11157.40	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	46763734	.	T	C	7877.28	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	46763757	.	G	A	7809.23	PASS	AC=64;AF=0.03893;AN=1644;DS;set=Intersection
22	46765181	.	G	GTCAGGTCGCCGAC	684176.26	PASS	AC=1637;AF=0.99939;AN=1638;DS;set=Intersection
22	46765577	.	C	T	1948.32	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	46765593	.	A	G	360.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46765713	.	G	A	9403.35	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	46768767	.	T	C	411.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46768810	.	C	T	1305.66	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46768811	.	G	A	15650.43	PASS	AC=47;AF=0.02859;AN=1644;DS;set=Intersection
22	46768889	.	G	A	444.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46772949	.	T	A	2761.94	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	46772958	.	C	T	1502.73	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46772988	.	G	A,T	25911.74	PASS	AC=5,38;AF=0.00304,0.02311;AN=1644;DS;set=Intersection
22	46773018	.	G	A	809.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46773053	.	G	A	286.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46773059	.	T	C	696.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46773120	.	G	A	2037	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46773124	.	T	C	1082.43	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46773128	.	T	A	832.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46773147	.	G	T	2689.84	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46773156	.	G	A	269.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46774446	.	C	G	7542.17	PASS	AC=200;AF=0.13123;AN=1524;set=Intersection
22	46774447	.	G	A	56.23	PASS	AC=1;AF=0.00065;AN=1540;set=Intersection
22	46774619	.	G	A	209.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46774624	.	G	A	131.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46774649	.	C	T	529.14	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46776707	.	C	T	464.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46776747	.	G	A	10351.56	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	46776762	.	G	T	328.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46776787	.	G	A	324.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46776841	.	C	T	455.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46776861	.	A	G	522.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46777719	.	G	A	1695.61	PASS	AC=48;AF=0.03183;AN=1508;set=Intersection
22	46777817	.	G	A	424.37	PASS	AC=10;AF=0.00638;AN=1568;set=Intersection
22	46777841	.	A	G	70.08	PASS	AC=1;AF=0.00065;AN=1542;set=Intersection
22	46777880	.	G	A	327.40	PASS	AC=11;AF=0.00734;AN=1498;set=Intersection
22	46777892	.	C	T	1772.16	PASS	AC=27;AF=0.01795;AN=1504;set=Intersection
22	46777896	.	C	G	698.75	PASS	AC=14;AF=0.00921;AN=1520;set=Intersection
22	46777928	.	C	T	203.52	PASS	AC=2;AF=0.00131;AN=1530;set=Intersection
22	46780413	.	C	T	341.19	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	46780426	.	C	T	716.89	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46780432	.	G	A	101.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46780446	.	C	T	1275	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46780465	.	G	C	190.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46780477	.	G	A	1076.70	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46780521	.	T	C	104832.92	PASS	AC=317;AF=0.19282;AN=1644;DS;set=Intersection
22	46780531	.	C	T	880.82	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46780552	.	G	C	671.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46780573	.	G	A	282.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46780621	.	G	C	10036.09	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	46782249	.	A	G	14705.09	PASS	AC=236;AF=0.14496;AN=1628;set=Intersection
22	46782283	.	G	A	149.14	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	46782291	.	C	T	62.07	PASS	AC=2;AF=0.00122;AN=1636;set=Intersection
22	46782327	.	C	T	85.29	PASS	AC=1;AF=0.00061;AN=1638;set=Intersection
22	46782336	.	C	T	227.79	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	46782340	.	C	T	372.60	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	46782382	.	C	T	4422.69	PASS	AC=45;AF=0.02754;AN=1634;set=Intersection
22	46782461	.	C	T	56.38	PASS	AC=3;AF=0.00185;AN=1626;set=Intersection
22	46782462	.	G	A	114.16	PASS	AC=3;AF=0.00185;AN=1624;set=Intersection
22	46782531	.	G	A	500.19	PASS	AC=21;AF=0.01332;AN=1576;set=Intersection
22	46785139	.	C	T	4840.06	PASS	AC=15;AF=0.00914;AN=1642;DS;set=Intersection
22	46785140	.	G	A	55.31	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46785145	.	TC	T	4633.94	PASS	AC=24;AF=0.01462;AN=1642;DS;set=Intersection
22	46785169	.	T	C	7059.40	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	46785201	.	C	T	391.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46785202	.	G	A	353.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46785286	.	G	A	97.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46785301	.	C	T	15470.67	PASS	AC=112;AF=0.06813;AN=1644;DS;set=Intersection
22	46785302	.	G	T	80.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46785308	.	G	A	730.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46785331	.	C	T	7684.54	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	46785370	.	C	A	7713.60	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	46785376	.	A	G	7141.72	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	46785417	.	T	C	4658.37	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	46785418	.	G	A	117.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46785432	.	C	G	94.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46786261	.	T	C	1261.87	PASS	AC=5;AF=0.00305;AN=1642;DS;set=Intersection
22	46786263	.	AAC	A	178.54	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	46786275	.	C	T	1313.80	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	46786281	.	G	A	5450.56	PASS	AC=13;AF=0.00792;AN=1642;DS;set=Intersection
22	46786315	.	T	C	88980.82	PASS	AC=359;AF=0.21837;AN=1644;DS;set=Intersection
22	46787086	.	C	T	908.91	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46787480	.	C	A	323.05	PASS	AC=2;AF=0.00122;AN=1640;set=Intersection
22	46787544	.	G	A	4838.58	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	46787570	.	G	A	117.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46787600	.	G	A	6977.25	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	46787694	.	A	G	79049.44	PASS	AC=356;AF=0.21681;AN=1642;DS;set=Intersection
22	46787697	.	A	G	43427.04	PASS	AC=257;AF=0.15652;AN=1642;DS;set=Intersection
22	46787753	.	C	T	7473.46	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	46790007	.	A	G	1657.56	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46790029	.	G	T	168094.25	PASS	AC=354;AF=0.21533;AN=1644;DS;set=Intersection
22	46790142	.	G	A	1356.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46790147	.	C	T	907.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46790156	.	G	A	366.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46790159	.	T	C	302.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46790182	.	G	T	374.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46792460	.	T	A	395.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46792689	.	C	A	9375.83	PASS	AC=55;AF=0.03345;AN=1644;DS;set=Intersection
22	46793555	.	G	A	115.18	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	46793592	.	A	G	8389.71	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	46793650	.	G	A	1187.80	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	46793713	.	G	A	982.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46793767	.	G	T	1222.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46793783	.	G	A	7994.42	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	46793789	.	G	A	1061.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46794392	.	TC	T	344.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46794398	.	C	G	60.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46794475	.	T	C	10765.07	PASS	AC=35;AF=0.02129;AN=1644;DS;set=Intersection
22	46794515	.	C	A	649.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46794525	.	C	A	735.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46794561	.	T	C	213.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46794563	.	G	A	459.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46795564	.	T	C	1706.36	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46795569	.	C	T	557.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46795580	.	T	G	1271.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46795760	.	G	A	669.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46795832	.	T	C	1005.30	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46804862	.	A	C	4235.01	PASS	AC=20;AF=0.01218;AN=1642;DS;set=Intersection
22	46804878	.	C	T	157.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46805007	.	G	A	66980.35	PASS	AC=150;AF=0.09124;AN=1644;DS;set=Intersection
22	46805034	.	G	A	2848.77	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	46805612	.	G	C	228.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46805617	.	C	T	595.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46805642	.	G	A	17572.32	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	46805643	.	G	A	17878.55	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	46805772	.	C	T	6924.24	PASS	AC=22;AF=0.01338;AN=1644;DS;set=Intersection
22	46805819	.	C	T	774.44	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46806274	.	CG	C	4968.96	PASS	AC=94;AF=0.05718;AN=1644;DS;set=Intersection
22	46806275	.	G	A	238.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46806301	.	G	A	1184.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46806326	.	G	A	1681	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46806346	.	C	T	933.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46806419	.	G	A	16346.43	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	46806486	.	C	T	254.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46807468	.	C	T	151.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46807510	.	G	A	7809.11	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	46807585	.	A	G	715.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46807698	.	A	G	170262.21	PASS	AC=312;AF=0.18978;AN=1644;DS;set=Intersection
22	46829252	.	G	A	373.89	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	46829276	.	G	A	1044.17	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46829329	.	G	A	7298.72	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	46829377	.	G	A	10467.53	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	46829412	.	A	G	1006.89	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	46829421	.	C	T	2139.01	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46829422	.	G	A	1968.34	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	46829423	.	G	C	170.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46832056	.	G	GGGAGAAGGCCCCACCTGC	6263.20	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46832075	.	A	G	1473.41	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46835036	.	G	GT	1887.56	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	46835037	.	C	T	109370.88	PASS	AC=196;AF=0.11922;AN=1644;DS;set=Intersection
22	46835054	.	C	A	25346.07	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	46835058	.	C	T	3169.12	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	46835115	.	T	C	9037.18	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	46835192	.	C	T	4724.91	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	46835265	.	G	A	561.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46835289	.	A	G	2981.88	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	46835316	.	G	A	548.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46835338	.	G	A	9040.55	PASS	AC=112;AF=0.06821;AN=1642;DS;set=Intersection
22	46859616	.	C	T	69.50	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	46859638	.	G	A	435.56	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	46859728	.	G	A	374.47	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	46859731	.	C	T	138.31	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	46859751	.	C	T	33.42	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	46859826	.	C	T	333.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46859832	.	C	T	93.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46859900	.	G	A	369.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46859920	.	C	T	366.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46859957	.	G	A	390.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46859995	.	C	T	809.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46860034	.	G	A	424.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46860049	.	G	A	4373	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46860057	.	C	T	411.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46860063	.	C	T	28923.78	PASS	AC=62;AF=0.03771;AN=1644;DS;set=Intersection
22	46860088	.	G	C	76026.42	PASS	AC=268;AF=0.16302;AN=1644;DS;set=Intersection
22	46860184	.	G	T	376.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46860223	.	C	T	9968.49	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	46860281	.	C	T	1894.41	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46929490	.	A	G	737.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46929495	.	C	A	941.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46929511	.	G	A	493.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46929597	.	C	T	368.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46929683	.	C	T	894.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46929692	.	A	G	305336.58	PASS	AC=1571;AF=0.95560;AN=1644;DS;set=Intersection
22	46929702	.	G	C	8916.27	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	46929704	.	C	T	1030.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46929816	.	T	C	926.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46929828	.	C	T	444.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46929877	.	A	G	570.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46929899	.	G	A	1136.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930013	.	C	A	21565.27	PASS	AC=27;AF=0.01642;AN=1644;DS;set=Intersection
22	46930107	.	C	T	87560.01	PASS	AC=284;AF=0.17275;AN=1644;DS;set=Intersection
22	46930138	.	G	A	4923.15	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	46930205	.	G	A	754.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930227	.	G	A	530.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930297	.	T	C	699.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930313	.	G	A	575.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46930444	.	G	A	1127.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930589	.	C	T	922.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930733	.	C	T	5418.78	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	46930736	.	T	G	313.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930750	.	G	A	5722.79	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	46930754	.	T	C	618.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930794	.	G	A	2588.18	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	46930872	.	G	T	265.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930934	.	G	A	413	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46930953	.	G	A	172.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46931004	.	C	T	305.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46931052	.	G	A	613.42	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	46931077	.	G	C	79954.49	PASS	AC=1498;AF=0.91119;AN=1644;set=Intersection
22	46931124	.	C	T	731.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46931145	.	C	T	381.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46931187	.	G	A	1127.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46931219	.	C	T	508.39	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46931247	.	C	T	28193.66	PASS	AC=64;AF=0.03893;AN=1644;DS;set=Intersection
22	46931267	.	G	A	233.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46931292	.	C	T	1385.61	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	46931309	.	T	C	12310.23	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	46931402	.	G	C	8255.93	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	46931472	.	C	T	839.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46931599	.	T	C	261.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46931700	.	G	A	401.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46931742	.	C	T	591.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46931793	.	G	C	126645.87	PASS	AC=1560;AF=0.94891;AN=1644;DS;set=Intersection
22	46931838	.	G	A	103607.78	PASS	AC=1496;AF=0.90998;AN=1644;DS;set=Intersection
22	46931953	.	A	G	128.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46932003	.	C	T	290.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46932030	.	G	A	1131	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46932032	.	T	A	430.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	46932104	.	T	C	238.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46932174	.	G	A	859.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46932318	.	G	A	245.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46932339	.	C	A	488.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	46932854	.	G	A	126.58	PASS	AC=11;AF=0.115;AN=96;set=Intersection
22	47022655	.	G	A	211.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47022691	.	C	T	457.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47022814	.	G	T	5105.34	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	47022827	.	C	T	689.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47022877	.	C	T	620.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47022889	.	G	A	1224.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47033693	.	G	A	4378.17	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	47033714	.	A	T	1042.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47033901	.	CA	C	3131.16	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	47054038	.	C	G	343.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47054058	.	T	C	15004.68	PASS	AC=27;AF=0.01644;AN=1642;DS;set=Intersection
22	47057231	.	G	T	595.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47058897	.	C	T	1507.87	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	47058903	.	T	G	216.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47058918	.	G	A	280.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47058954	.	C	T	760.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47058973	.	A	G	607.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47058992	.	T	C	283633.07	PASS	AC=1641;AF=0.99818;AN=1644;DS;set=Intersection
22	47059001	.	C	T	724.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47059773	.	G	A	661.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47059939	.	G	A	27186.64	PASS	AC=61;AF=0.03710;AN=1644;DS;set=Intersection
22	47060025	.	C	A	1401.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47060037	.	G	A	513.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47061641	.	C	T	9509.64	PASS	AC=61;AF=0.03710;AN=1644;DS;set=Intersection
22	47062801	.	C	T	727.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47063961	.	A	C	266.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47063963	.	T	C	345.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47064052	.	C	T	4334.54	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	47064075	.	G	A	2673.78	PASS	AC=26;AF=0.01583;AN=1642;DS;set=Intersection
22	47064082	.	GGCCAGGGGTGTGTCTGCGCCAGCCATGGGCACCA	G	195.24	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	47064617	.	A	T	526.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47064665	.	C	T	109332.65	PASS	AC=544;AF=0.33090;AN=1644;DS;set=Intersection
22	47064670	.	G	A	1757.18	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47064678	.	C	T	472.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47064743	.	C	T	411.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47064824	.	G	A	1101.89	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47064834	.	T	G	818.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47064837	.	A	C	56575.67	PASS	AC=485;AF=0.29501;AN=1644;DS;set=Intersection
22	47064850	.	C	T	2498.53	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	47068804	.	C	T	511.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47068822	.	C	G	431.09	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47068880	.	G	A	49.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47068882	.	A	G	150.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47068929	.	TG	T	14633.50	PASS	AC=428;AF=0.26098;AN=1640;set=Intersection
22	47068935	.	G	T	18140.64	PASS	AC=426;AF=0.26007;AN=1638;set=Intersection
22	47069525	.	G	A	157.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47069563	.	G	A	952.12	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47069581	.	G	A	857.11	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47069671	.	C	T	1013.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47069700	.	G	A	709.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47070550	.	T	A	11603.66	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	47070558	.	C	T	268.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47070642	.	G	A	959.78	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47070683	.	G	A	1031.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47071341	.	C	T	7984.60	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	47071467	.	C	T	4531.31	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	47071470	.	C	T	468.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47072477	.	G	A	43335.64	PASS	AC=504;AF=0.38949;AN=1294;DS;set=Intersection
22	47072996	.	G	A	1886.54	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	47073022	.	G	A	443.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47073142	.	C	T	272.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47073176	.	A	ATTTTCT	857.12	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47073183	.	T	TTTTCTA	514.59	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	47073198	.	TC	T	356.62	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47083010	.	T	C	222150.69	PASS	AC=823;AF=0.50061;AN=1644;DS;set=Intersection
22	47083012	.	T	A	185090.87	PASS	AC=790;AF=0.48054;AN=1644;DS;set=Intersection
22	47083016	.	C	A	662.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47083052	.	C	T	743.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47083136	.	C	T	889.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47083137	.	G	A	1743.24	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47085859	.	C	G	41.94	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	47085860	.	G	A	537.15	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	47085903	.	A	T	5721.03	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	47085924	.	G	A	42496.05	PASS	AC=211;AF=0.12835;AN=1644;DS;set=Intersection
22	47085983	.	T	C	1418.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47086007	.	C	A,G,T	782.30	PASS	AC=1,1,0;AF=0.00061,0.00061,0.00000;AN=1644;DS;set=Intersection
22	47086016	.	G	A	331.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47086048	.	G	A	1218.55	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47087432	.	C	T	352.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47087460	.	C	T	926.08	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47087541	.	G	T	738.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47087670	.	G	A	34745.99	PASS	AC=169;AF=0.10280;AN=1644;DS;set=Intersection
22	47089274	.	G	A	67687.22	PASS	AC=216;AF=0.13139;AN=1644;DS;set=Intersection
22	47089409	.	C	A	2219.46	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47089439	.	C	T	1529.55	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47089445	.	G	A	2980.31	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	47091092	.	A	G	4651.14	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	47091113	.	C	T	897.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47091231	.	G	A	2448.51	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	47091258	.	G	T	3139.42	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	47095172	.	C	G	97216.78	PASS	AC=270;AF=0.16423;AN=1644;DS;set=Intersection
22	47095186	.	C	T	1514.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47095214	.	A	G	749.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47095235	.	C	A	14768.14	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	47095300	.	C	T	3164.38	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	47095373	.	G	C	288.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47095376	.	C	T	1883.57	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47095381	.	G	A	356.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47095409	.	C	G	99191.67	PASS	AC=418;AF=0.25426;AN=1644;DS;set=Intersection
22	47097496	.	G	A	806.09	PASS	AC=2;AF=0.00130;AN=1536;DS;set=Intersection
22	47097505	.	C	T	12591.70	PASS	AC=173;AF=0.11133;AN=1554;DS;set=Intersection
22	47097650	.	A	T	860.36	PASS	AC=2;AF=0.00130;AN=1534;DS;set=Intersection
22	47103729	.	C	T	879.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47103743	.	C	A	485.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47103744	.	G	A	1301.82	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	47103810	.	G	A	1137.12	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47103823	.	G	A	15976.20	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	47103840	.	G	A	2648.68	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47103884	.	T	C	2757.32	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	47103905	.	G	A	658.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47106968	.	A	G	2799.03	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47106996	.	C	G	170.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47108031	.	C	G	1141.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47108084	.	G	A	904.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47108189	.	C	T	9774.58	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	47108199	.	C	A	4300.95	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	47108219	.	C	T	10599.55	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	47116023	.	G	A	50574.53	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	47116041	.	T	C	439.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47116075	.	C	T	964.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47116076	.	G	A	924.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47116108	.	G	T	296.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47116793	.	T	C	2249.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47116905	.	G	A	47815.93	PASS	AC=129;AF=0.07847;AN=1644;DS;set=Intersection
22	47116947	.	C	T	4620.83	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	47133984	.	C	T	129.65	PASS	AC=8;AF=0.0182;AN=440;set=Intersection
22	47134013	.	T	C	354.36	PASS	AC=18;AF=0.0439;AN=410;set=Intersection
22	47158793	.	G	A	657.56	PASS	AC=3;AF=0.00222;AN=1354;DS;set=Intersection
22	47188369	.	G	A	841.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47188499	.	G	A	19089.72	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	47189509	.	C	T	237.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47189533	.	G	A	265.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47189536	.	G	A	4304.77	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	47189551	.	C	T	311.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47189552	.	G	A	651.48	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47189569	.	G	A	390.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47189616	.	C	T	461.88	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	47189630	.	C	T	874.61	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	47189678	.	C	G	424.07	PASS	AC=11;AF=0.00672;AN=1638;set=Intersection
22	47189679	.	C	G	85.15	PASS	AC=1;AF=0.00061;AN=1638;set=Intersection
22	47189686	.	C	T	442.11	PASS	AC=3;AF=0.00184;AN=1634;set=Intersection
22	47189747	.	G	C	70.72	PASS	AC=2;AF=0.00123;AN=1624;set=Intersection
22	47193295	.	C	T	16772.44	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	47193392	.	C	T	591.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47193393	.	G	A	533.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47193404	.	C	T	11284.98	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	47274631	.	C	T	525.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47274638	.	C	T	181440.65	PASS	AC=973;AF=0.59185;AN=1644;DS;set=Intersection
22	47274647	.	G	A	592.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47287126	.	A	G	1039.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47287129	.	A	G	517.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47287174	.	G	A	606.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47287248	.	C	T	504.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47287260	.	C	T	565.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47287299	.	C	G	1108.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47287310	.	T	A	46575.65	PASS	AC=53;AF=0.03224;AN=1644;DS;set=Intersection
22	47287311	.	TC	T	323	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47287333	.	T	C	46666.75	PASS	AC=66;AF=0.04015;AN=1644;DS;set=Intersection
22	47307934	.	A	T	21714.93	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	47307949	.	A	T	6956.03	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	47308023	.	C	T	680.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47370141	.	G	A	1001.80	PASS	AC=16;AF=0.00999;AN=1602;DS;set=Intersection
22	47370205	.	G	A	181.60	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	47370226	.	C	T	213.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47370306	.	G	A	812.90	PASS	AC=7;AF=0.00427;AN=1640;DS;set=Intersection
22	47370308	.	G	A	56.61	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	47370336	.	C	T	1312.86	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	47370343	.	G	A	26357.59	PASS	AC=365;AF=0.22311;AN=1636;DS;set=Intersection
22	47393493	.	T	C	15418.69	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	47393623	.	G	A	125.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47393643	.	G	A	24707.18	PASS	AC=45;AF=0.02737;AN=1644;DS;set=Intersection
22	47432923	.	A	G	1063.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47432980	.	G	A	905.19	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47432995	.	C	T	5176.13	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	47433018	.	C	G	1602.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47433034	.	C	T	451.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47433062	.	C	T	567.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47433116	.	C	T	690.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47433122	.	T	C	83.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47433140	.	G	A	2327.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	47507365	.	G	A	26233.06	PASS	AC=32;AF=0.01946;AN=1644;DS;set=Intersection
22	47507512	.	C	A	1051.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47507519	.	A	G	1286.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47569097	.	C	T	6518.05	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	47569123	.	T	C	616.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	47569209	.	G	C	11229.97	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	47569278	.	C	A	334.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47569292	.	C	T	421.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47569300	.	TC	T	406.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	47569308	.	G	C	901.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	48972321	.	T	C	495.68	PASS	AC=2;AF=0.0020;AN=988;set=Intersection
22	48972352	.	C	T	37.22	PASS	AC=1;AF=0.0010;AN=996;set=Intersection
22	49042380	.	C	T	1242.17	PASS	AC=11;AF=0.00770;AN=1428;DS;set=Intersection
22	49042476	.	G	A	336.90	PASS	AC=2;AF=0.00158;AN=1264;DS;set=Intersection
22	49042491	.	C	T	70.10	PASS	AC=1;AF=0.00081;AN=1240;DS;set=Intersection
22	49103499	.	C	T	31312.22	PASS	AC=103;AF=0.08009;AN=1286;set=Intersection
22	49103591	.	G	A	885.62	PASS	AC=1;AF=0.00074;AN=1358;DS;set=Intersection
22	49103626	.	G	T	991.17	PASS	AC=1;AF=0.00076;AN=1320;DS;set=Intersection
22	49103628	.	A	G	787.33	PASS	AC=1;AF=0.00076;AN=1324;DS;set=Intersection
22	49103660	.	T	C	160476.15	PASS	AC=946;AF=0.71342;AN=1326;DS;set=Intersection
22	49103669	.	C	T	20651.73	PASS	AC=25;AF=0.01885;AN=1326;DS;set=Intersection
22	49103670	.	G	A	1573.38	PASS	AC=2;AF=0.00151;AN=1324;DS;set=Intersection
22	50167902	.	G	A	1249.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50167923	.	G	A	537.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50167960	.	C	T	1176.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50168042	.	T	C	424.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50169205	.	G	A	138471.97	PASS	AC=195;AF=0.11861;AN=1644;DS;set=Intersection
22	50169211	.	C	T	1008.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50169313	.	C	G	1088.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50169346	.	G	C	7563.25	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50169399	.	C	T	393.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50169410	.	C	T	824.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50169421	.	T	C	115286.07	PASS	AC=245;AF=0.14903;AN=1644;DS;set=Intersection
22	50169676	.	G	A	8788.35	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	50169682	.	C	G	501.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50169683	.	G	A	577.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50169691	.	T	C	2122.62	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	50169714	.	G	A	144.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50169722	.	G	A	284.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50169770	.	G	A	12327.02	PASS	AC=41;AF=0.02494;AN=1644;DS;set=Intersection
22	50169851	.	C	T	581.25	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	50169852	.	G	A	9685.47	PASS	AC=104;AF=0.06341;AN=1640;DS;set=Intersection
22	50170633	.	G	A	192.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50170674	.	C	T	1571.97	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50170743	.	G	A	10980.53	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	50170846	.	C	T	309.71	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50171276	.	G	A	117.38	PASS	AC=2;AF=0.00125;AN=1594;set=Intersection
22	50171451	.	G	A	312.23	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	50171474	.	C	T	1818.80	PASS	AC=16;AF=0.00973;AN=1644;set=Intersection
22	50181005	.	AG	A	5457.24	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	50181022	.	C	T	563.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50181023	.	G	A	844.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50187644	.	G	A	4568.99	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	50187646	.	C	T	7176.49	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	50187708	.	G	A	592.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50187715	.	C	T	10048.39	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	50187793	.	G	A	538.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50187853	.	C	T	23486.32	PASS	AC=70;AF=0.04258;AN=1644;DS;set=Intersection
22	50191438	.	G	A	5070.21	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	50191441	.	G	A	137.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50191454	.	G	A	335	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50191479	.	G	A	126.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50191485	.	G	A	710.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50191532	.	G	A	542.42	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50191810	.	A	G	1176.02	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50192171	.	A	G	724.68	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50192174	.	C	T	105245.56	PASS	AC=186;AF=0.11314;AN=1644;DS;set=Intersection
22	50192228	.	G	A	728.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50192334	.	C	T	55.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50192616	.	C	T	200.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50197912	.	G	A	296.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50216625	.	C	A	574.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50216725	.	T	C	3173.50	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50216739	.	G	A	79820.22	PASS	AC=80;AF=0.04866;AN=1644;DS;set=Intersection
22	50216754	.	G	A	142748.48	PASS	AC=210;AF=0.12774;AN=1644;DS;set=Intersection
22	50216758	.	T	C	5736.21	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50216763	.	G	A	1861.79	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50216799	.	C	T	5060.03	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50216932	.	T	C	983.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50216964	.	G	A	779.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50216988	.	T	C	1755.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50217033	.	G	A	2216.35	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50217174	.	C	G	1087.11	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50217279	.	G	A	303.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50217321	.	G	A	165.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50217387	.	G	A	39236.24	PASS	AC=99;AF=0.06022;AN=1644;DS;set=Intersection
22	50217429	.	G	A	508.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50217435	.	G	A	667.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50217633	.	C	T	10987.90	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	50217649	.	C	G	1757.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50217867	.	G	A	1067.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50217903	.	A	G	911.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50277333	.	G	T	848.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50277346	.	C	T	128.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50277352	.	T	G	7095.49	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50277410	.	C	T	808.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50277469	.	C	T	842.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50277475	.	T	G	1075.76	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50277485	.	G	C	1460.68	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50277487	.	G	A	1924.67	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50277494	.	G	A	1952.83	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50277501	.	C	T	769.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50277523	.	G	T	43770.14	PASS	AC=47;AF=0.02859;AN=1644;DS;set=Intersection
22	50277614	.	G	A	591.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50277639	.	G	A	815.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50277754	.	C	T	1079.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50277835	.	T	C	274776.79	PASS	AC=1522;AF=0.92579;AN=1644;DS;set=Intersection
22	50277883	.	A	G	277740.79	PASS	AC=1522;AF=0.92579;AN=1644;DS;set=Intersection
22	50277898	.	G	A	21716.11	PASS	AC=36;AF=0.02190;AN=1644;DS;set=Intersection
22	50277977	.	A	G	807.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278026	.	T	C	627.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278218	.	A	G	519.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278348	.	G	A	131.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278356	.	C	G	857.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278404	.	C	T	481.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278438	.	A	G	304596.04	PASS	AC=1520;AF=0.92457;AN=1644;DS;set=Intersection
22	50278446	.	C	T	1328.14	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50278455	.	A	T	895.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278510	.	C	T	1049.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278541	.	G	A	1458.06	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50278568	.	A	G	235298.42	PASS	AC=1129;AF=0.68674;AN=1644;DS;set=Intersection
22	50278584	.	C	T	2942.49	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50278588	.	C	T	1750.33	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50278642	.	C	T	262965.44	PASS	AC=1121;AF=0.68187;AN=1644;DS;set=Intersection
22	50278745	.	T	C	656.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278810	.	T	C	3182.08	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50278879	.	T	C	4202.13	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50278936	.	A	G	3061.69	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50278939	.	A	C	2212.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50278947	.	C	G	1243.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278956	.	A	G	623.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50278971	.	C	T	526.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50279035	.	A	G	7485.26	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	50279061	.	G	A	583.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50279086	.	G	A	881.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50279184	.	C	T	342.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50279221	.	C	T	516.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50279389	.	C	T	297.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50279610	.	C	T	598.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50279615	.	C	T	669.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50279628	.	C	T	162.99	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50279641	.	C	T	225.96	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50279740	.	C	T	1362.52	PASS	AC=4;AF=0.00243;AN=1644;set=Intersection
22	50279749	.	C	T	521.10	PASS	AC=2;AF=0.00122;AN=1644;set=Intersection
22	50279782	.	C	T	9232.18	PASS	AC=21;AF=0.01277;AN=1644;set=Intersection
22	50279803	.	G	A	66.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50279812	.	G	A	1103.80	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50279941	.	C	T	2759.52	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50279962	.	C	T	574.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50280044	.	A	T	463.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50280118	.	G	A	734.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50280136	.	T	C	138247.81	PASS	AC=1121;AF=0.68187;AN=1644;DS;set=Intersection
22	50280322	.	C	T	592.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50280472	.	G	A	2536.74	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50280475	.	G	A	631.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50280646	.	G	A	906.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50280655	.	C	T	54101.57	PASS	AC=86;AF=0.05231;AN=1644;DS;set=Intersection
22	50280688	.	A	C	55669.51	PASS	AC=83;AF=0.05049;AN=1644;DS;set=Intersection
22	50280733	.	C	T	12103.71	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	50280759	.	T	C	5948.60	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50280834	.	G	A	407.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50280837	.	G	A	644.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50280856	.	C	T	7285.55	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	50280857	.	G	A	812.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50280870	.	C	T	683.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50280874	.	A	G	574.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50297444	.	C	T	395.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50297485	.	C	G	347.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50297525	.	T	C	444.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50297591	.	G	A	1325.84	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50297654	.	G	A	776.92	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50297714	.	C	G	616.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50297754	.	C	T	507.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50297757	.	C	T	363.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50297841	.	G	A	649.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50297888	.	T	C	28495.61	PASS	AC=143;AF=0.08698;AN=1644;DS;set=Intersection
22	50297921	.	C	T	884.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50297992	.	G	A	1740.07	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50298100	.	G	A	942.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50298118	.	C	T	10514.26	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	50298173	.	C	T	807.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50301422	.	G	A	6404.03	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	50301476	.	T	C	184360.13	PASS	AC=526;AF=0.31995;AN=1644;DS;set=Intersection
22	50301488	.	C	T	501.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50301494	.	G	A	884.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50301584	.	C	T	209.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50301613	.	GCCACGCACCTGT	G	795.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50301622	.	C	T	330.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50302875	.	C	T	2299.48	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50302891	.	C	T	691.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50302962	.	C	T	6377.56	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50302995	.	C	G	448.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50303024	.	C	T	11204.86	PASS	AC=57;AF=0.03467;AN=1644;DS;set=Intersection
22	50303495	.	A	G	562.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50303515	.	A	C	71810.36	PASS	AC=329;AF=0.20012;AN=1644;DS;set=Intersection
22	50303524	.	CCA	C	325.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50303530	.	T	C	73310.45	PASS	AC=330;AF=0.20073;AN=1644;DS;set=Intersection
22	50303533	.	C	G	77601.35	PASS	AC=330;AF=0.20073;AN=1644;DS;set=Intersection
22	50303554	.	T	C	657.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50303561	.	C	T	7755.22	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50303567	.	G	A	1028.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50303569	.	C	T	663.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50303575	.	G	A	9232.24	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	50303666	.	G	A	461.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50303705	.	G	A	714.08	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50303748	.	T	A	288.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50304068	.	C	T	1555.84	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50304069	.	G	A	5065.01	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	50304086	.	A	G	90.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50304136	.	G	A	941.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50304166	.	T	C	1212.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50304192	.	C	T	2839.03	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50304232	.	C	T	747.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50307139	.	G	A	1924.20	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50307162	.	C	T	422.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50307184	.	G	T	34344.91	PASS	AC=131;AF=0.07968;AN=1644;DS;set=Intersection
22	50307229	.	CA	C	9300.30	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	50307236	.	A	C	1001.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50307282	.	G	A	682.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50307315	.	C	T	35880.30	PASS	AC=46;AF=0.02798;AN=1644;DS;set=Intersection
22	50307366	.	C	G	1446.29	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50307386	.	G	A	515.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50312382	.	G	A	590.01	PASS	AC=82;AF=0.2092;AN=392;set=Intersection
22	50312543	.	C	T	60.29	PASS	AC=5;AF=0.00488;AN=1024;set=Intersection
22	50312869	.	T	C	27385.26	PASS	AC=177;AF=0.10766;AN=1644;DS;set=Intersection
22	50312895	.	AAAG	A	884.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50312979	.	C	T	41180.64	PASS	AC=317;AF=0.19282;AN=1644;DS;set=Intersection
22	50313344	.	G	C	820.31	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50313358	.	G	C	49139.49	PASS	AC=421;AF=0.25608;AN=1644;DS;set=Intersection
22	50313359	.	G	A	23150.44	PASS	AC=313;AF=0.19039;AN=1644;DS;set=Intersection
22	50313438	.	T	C	44851.06	PASS	AC=320;AF=0.19465;AN=1644;DS;set=Intersection
22	50313452	.	C	T	547.56	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50313791	.	C	T	813.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50313810	.	C	T	2188.44	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50313826	.	T	C	554.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50313846	.	G	A	6825.33	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	50313880	.	G	A	746.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50313899	.	C	T	902.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50313930	.	G	C	1091.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50315228	.	T	C	100888.20	PASS	AC=251;AF=0.15268;AN=1644;DS;set=Intersection
22	50315303	.	C	T	3005.59	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50315306	.	C	T	633.38	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50315361	.	G	A	2777.16	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50315363	.	C	A	160736.83	PASS	AC=251;AF=0.15268;AN=1644;DS;set=Intersection
22	50315382	.	C	G	7931.68	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	50315386	.	A	G	572.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50315413	.	C	T	22943.19	PASS	AC=105;AF=0.06387;AN=1644;DS;set=Intersection
22	50315421	.	G	A	2319.97	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50315902	.	G	C	320.13	PASS	AC=6;AF=0.00376;AN=1596;set=Intersection
22	50315904	.	TAGTCAGGACCGGCCTCTCCGATTCTTACGCCCCTCAGC	T	4497.91	PASS	AC=78;AF=0.04869;AN=1602;set=Intersection
22	50315924	.	G	T	18386.76	PASS	AC=166;AF=0.10388;AN=1598;set=Intersection
22	50315928	.	C	G	18685.14	PASS	AC=165;AF=0.10236;AN=1612;set=Intersection
22	50315935	.	CCCTCAGCAGTCAGGACCGGCCTCTCCGATTCTTACCCG	C	12551.11	PASS	AC=71;AF=0.04421;AN=1606;set=Intersection
22	50315938	.	TC	T	392.12	PASS	AC=21;AF=0.01311;AN=1602;set=Intersection
22	50315961	.	C	T	127.73	PASS	AC=1;AF=0.00061;AN=1628;set=Intersection
22	50315973	.	G	C	44525.42	PASS	AC=346;AF=0.21201;AN=1632;set=Intersection
22	50316007	.	G	A	1403.28	PASS	AC=5;AF=0.00305;AN=1642;set=Intersection
22	50316015	.	C	T	11126.98	PASS	AC=44;AF=0.02696;AN=1632;set=Intersection
22	50316288	.	G	A	660.27	PASS	AC=3;AF=0.00183;AN=1636;DS;set=Intersection
22	50316369	.	C	T	20523.41	PASS	AC=260;AF=0.16818;AN=1546;DS;set=Intersection
22	50316374	.	G	A	19522.79	PASS	AC=195;AF=0.12548;AN=1554;DS;set=Intersection
22	50316835	.	T	C	25403.77	PASS	AC=425;AF=0.25852;AN=1644;set=Intersection
22	50316839	.	C	T	59.97	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	50316901	.	C	T	1551.71	PASS	AC=7;AF=0.00426;AN=1644;set=Intersection
22	50316902	.	G	A	148.61	PASS	AC=3;AF=0.00182;AN=1644;set=Intersection
22	50316906	.	C	T	452.99	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50316925	.	G	A	179.28	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50316984	.	T	TCTGCACTCCGGGGC	29214.86	PASS	AC=272;AF=0.16585;AN=1640;DS;set=Intersection
22	50317004	.	G	A	1568.64	PASS	AC=7;AF=0.00426;AN=1644;set=Intersection
22	50317980	.	G	A	676.20	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50317989	.	C	T	29018.72	PASS	AC=208;AF=0.12667;AN=1642;DS;set=Intersection
22	50318061	.	G	C	2997.59	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	50318079	.	G	A	388.02	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50318090	.	C	T	1612.36	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	50318091	.	G	A	886.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50318128	.	C	T	541.56	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	50319017	.	G	A	4590.88	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50319072	.	C	T	622.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50319078	.	C	T	1865.97	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50319079	.	T	G	41217.96	PASS	AC=128;AF=0.07786;AN=1644;DS;set=Intersection
22	50319102	.	G	A	446.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50319135	.	G	C	685.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50319141	.	C	T	962.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50319159	.	C	T	1187.67	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50319170	.	A	G	39471.12	PASS	AC=128;AF=0.07786;AN=1644;DS;set=Intersection
22	50319174	.	G	A	771.85	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50319193	.	C	T	1561.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50319216	.	C	T	883.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50319223	.	C	T	2118	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50319231	.	C	T	231.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50320853	.	C	T	853.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50320943	.	C	T	68091.11	PASS	AC=148;AF=0.09002;AN=1644;DS;set=Intersection
22	50320994	.	C	T	828.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50354558	.	G	T	69.71	PASS	AC=8;AF=0.0169;AN=472;set=Intersection
22	50354819	.	C	A	7638.38	PASS	AC=470;AF=0.34970;AN=1344;set=Intersection
22	50355407	.	C	T	504.22	PASS	AC=2;AF=0.00122;AN=1642;set=Intersection
22	50356293	.	G	C	305.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50356302	.	C	T	102152.65	PASS	AC=795;AF=0.48358;AN=1644;DS;set=Intersection
22	50356313	.	G	C	453.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50356330	.	C	T	264.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50356367	.	TCCGCTACCA	T	332.52	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50356368	.	C	T	292.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50356386	.	C	T	11176.32	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	50356473	.	C	T	1233.88	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50356497	.	G	A	994	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50356503	.	G	A	244.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50356506	.	C	G	230.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50356555	.	T	C	108939.38	PASS	AC=1289;AF=0.78406;AN=1644;DS;set=Intersection
22	50356570	.	C	T	93.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50356658	.	G	A	529.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50356693	.	T	C	61089.09	PASS	AC=1291;AF=0.78528;AN=1644;DS;set=Intersection
22	50356731	.	C	T	1118.11	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50356811	.	G	T	215.70	PASS	AC=5;AF=0.00306;AN=1632;set=Intersection
22	50435480	.	A	G	71612.15	PASS	AC=892;AF=0.54457;AN=1638;DS;set=Intersection
22	50435723	.	G	A	1366.59	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	50435733	.	C	T	600.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50435784	.	G	A	931.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50435827	.	C	T	2448.83	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	50436211	.	T	C	1178.61	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50436212	.	G	T	1381.49	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50436215	.	A	G	334.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50436488	.	G	A	1779.57	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	50436546	.	C	T	177.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50436553	.	A	C	591.23	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50436571	.	G	A	710.28	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50436604	.	G	C	658.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50437711	.	G	T	810.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50437747	.	G	C	408.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50437784	.	G	C	885.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50437814	.	T	A	258.19	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50437830	.	G	A	545.07	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50437841	.	A	T	159.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50437949	.	C	T	1271.66	PASS	AC=15;AF=0.00921;AN=1628;DS;set=Intersection
22	50437976	.	G	T	12947.78	PASS	AC=599;AF=0.39048;AN=1534;set=Intersection
22	50438279	.	T	C	171.79	PASS	AC=6;AF=0.00461;AN=1302;set=Intersection
22	50438379	.	A	C	104.47	PASS	AC=4;AF=0.00322;AN=1242;set=Intersection
22	50438918	.	T	C	462.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50439194	.	C	T	21672.51	PASS	AC=528;AF=0.32117;AN=1644;set=Intersection
22	50439202	.	C	T	115.05	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	50439203	.	G	A	613.90	PASS	AC=3;AF=0.00183;AN=1642;set=Intersection
22	50439240	.	C	T	270.83	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	50439284	.	G	A	120.59	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	50439496	.	G	A	46.04	PASS	AC=1;AF=0.00062;AN=1626;DS;set=Intersection
22	50439626	.	G	A	2160.67	PASS	AC=27;AF=0.01654;AN=1632;DS;set=Intersection
22	50439637	.	G	A	181.67	PASS	AC=1;AF=0.00061;AN=1632;DS;set=Intersection
22	50454825	.	A	G	9181.13	PASS	AC=376;AF=0.30274;AN=1242;set=Intersection
22	50454855	.	G	T	85.92	PASS	AC=2;AF=0.00156;AN=1284;set=Intersection
22	50454859	.	A	T	1187.58	PASS	AC=42;AF=0.03216;AN=1306;set=Intersection
22	50454933	.	C	G	200.76	PASS	AC=10;AF=0.00853;AN=1172;set=Intersection
22	50454962	.	G	C	595.15	PASS	AC=22;AF=0.01996;AN=1102;set=Intersection
22	50455014	.	G	A	50.45	PASS	AC=1;AF=0.00086;AN=1166;set=Intersection
22	50468819	.	G	A	609.53	PASS	AC=36;AF=0.03516;AN=1024;set=Intersection
22	50468873	.	G	A	159.73	PASS	AC=1;AF=0.00089;AN=1124;set=Intersection
22	50468907	.	C	T	33681.05	PASS	AC=575;AF=0.49655;AN=1158;set=Intersection
22	50468933	.	G	T	21099.94	PASS	AC=402;AF=0.35263;AN=1140;set=Intersection
22	50468977	.	G	A	158.73	PASS	AC=1;AF=0.00083;AN=1202;set=Intersection
22	50468991	.	T	C	577.72	PASS	AC=2;AF=0.00167;AN=1200;set=Intersection
22	50469215	.	G	T	547.69	PASS	AC=6;AF=0.00519;AN=1156;set=Intersection
22	50470102	.	G	A	39.47	PASS	AC=1;AF=0.00092;AN=1092;set=Intersection
22	50470155	.	C	T	299.25	PASS	AC=3;AF=0.00247;AN=1214;set=Intersection
22	50470162	.	C	T	803.14	PASS	AC=3;AF=0.00244;AN=1228;set=Intersection
22	50470176	.	G	C	185.36	PASS	AC=1;AF=0.00081;AN=1230;set=Intersection
22	50470196	.	A	G	867.57	PASS	AC=5;AF=0.00394;AN=1270;set=Intersection
22	50470215	.	G	A	1022.67	PASS	AC=5;AF=0.00378;AN=1322;DS;set=Intersection
22	50470291	.	C	T	379.02	PASS	AC=1;AF=0.00075;AN=1342;DS;set=Intersection
22	50470514	.	G	A	332.92	PASS	AC=1;AF=0.00071;AN=1410;DS;set=Intersection
22	50470516	.	C	T	59970.93	PASS	AC=314;AF=0.22082;AN=1422;DS;set=Intersection
22	50471620	.	AC	A	13047.03	PASS	AC=383;AF=0.30349;AN=1262;set=Intersection
22	50471646	.	A	G	176.23	PASS	AC=1;AF=0.00076;AN=1312;set=Intersection
22	50471685	.	T	C	1131.10	PASS	AC=3;AF=0.00227;AN=1324;set=Intersection
22	50471771	.	C	T	538.77	PASS	AC=1;AF=0.00075;AN=1332;set=Intersection
22	50472743	.	G	T	165.75	PASS	AC=1;AF=0.00070;AN=1430;set=Intersection
22	50472838	.	G	A	817.55	PASS	AC=5;AF=0.00363;AN=1378;DS;set=Intersection
22	50472865	.	C	T	846.51	PASS	AC=1;AF=0.00072;AN=1392;DS;set=Intersection
22	50472908	.	C	A	544.09	PASS	AC=1;AF=0.00070;AN=1424;DS;set=Intersection
22	50479676	.	G	A	683.21	PASS	AC=1;AF=0.00070;AN=1432;DS;set=Intersection
22	50479680	.	A	G	4645.87	PASS	AC=5;AF=0.00346;AN=1444;DS;set=Intersection
22	50479753	.	C	T	623.89	PASS	AC=1;AF=0.00066;AN=1516;DS;set=Intersection
22	50480002	.	T	C	1809.49	PASS	AC=7;AF=0.00463;AN=1512;set=Intersection
22	50480054	.	C	T	190.06	PASS	AC=1;AF=0.00067;AN=1488;DS;set=Intersection
22	50480073	.	G	A	1465.66	PASS	AC=4;AF=0.00274;AN=1462;DS;set=Intersection
22	50480108	.	C	T	58662.52	PASS	AC=596;AF=0.40990;AN=1454;DS;set=Intersection
22	50483671	.	C	T	254.86	PASS	AC=1;AF=0.00072;AN=1392;set=Intersection
22	50483672	.	G	A	198.94	PASS	AC=4;AF=0.00289;AN=1386;set=Intersection
22	50483826	.	G	C	303.13	PASS	AC=1;AF=0.00073;AN=1372;DS;set=Intersection
22	50483850	.	T	C	29232.28	PASS	AC=340;AF=0.25449;AN=1336;DS;set=Intersection
22	50484271	.	G	A	681.15	PASS	AC=11;AF=0.00820;AN=1342;set=Intersection
22	50484329	.	C	T	6813.37	PASS	AC=39;AF=0.02932;AN=1330;set=Intersection
22	50484343	.	G	T	85.31	PASS	AC=1;AF=0.00075;AN=1334;set=Intersection
22	50484345	.	C	T	345.13	PASS	AC=1;AF=0.00075;AN=1326;set=Intersection
22	50484353	.	GC	G	605.44	PASS	AC=4;AF=0.00300;AN=1334;set=Intersection
22	50484405	.	G	A	6070.43	PASS	AC=36;AF=0.02620;AN=1374;set=Intersection
22	50485701	.	G	C	1850.48	PASS	AC=3;AF=0.00239;AN=1254;DS;set=Intersection
22	50485718	.	A	C	651.99	PASS	AC=1;AF=0.00079;AN=1260;DS;set=Intersection
22	50487660	.	C	T	847.57	PASS	AC=1;AF=0.00077;AN=1302;DS;set=Intersection
22	50487661	.	G	A	2727.48	PASS	AC=3;AF=0.00232;AN=1294;DS;set=Intersection
22	50487683	.	C	T	31270.05	PASS	AC=33;AF=0.02558;AN=1290;DS;set=Intersection
22	50487790	.	T	C	5261.95	PASS	AC=6;AF=0.00462;AN=1300;DS;set=Intersection
22	50488502	.	C	T	280.43	PASS	AC=1;AF=0.00079;AN=1270;set=Intersection
22	50488527	.	C	T	1741.25	PASS	AC=5;AF=0.00388;AN=1290;set=Intersection
22	50488528	.	G	A	237.76	PASS	AC=1;AF=0.00077;AN=1294;set=Intersection
22	50488533	.	G	T	253.02	PASS	AC=1;AF=0.00077;AN=1298;set=Intersection
22	50488547	.	G	A	2194.15	PASS	AC=26;AF=0.02022;AN=1286;set=Intersection
22	50488562	.	C	T	324.87	PASS	AC=1;AF=0.00078;AN=1288;set=Intersection
22	50488628	.	C	T	90.09	PASS	AC=1;AF=0.00079;AN=1272;set=Intersection
22	50488642	.	G	A	1501.09	PASS	AC=6;AF=0.00477;AN=1258;set=Intersection
22	50492955	.	T	TGGAG	1439.93	PASS	AC=7;AF=0.00571;AN=1226;set=Intersection
22	50492970	.	C	T	7317.64	PASS	AC=156;AF=0.12893;AN=1210;set=Intersection
22	50493008	.	G	A	476.33	PASS	AC=8;AF=0.00657;AN=1218;set=Intersection
22	50493062	.	T	C	8030.54	PASS	AC=187;AF=0.15278;AN=1224;set=Intersection
22	50493072	.	A	G	84.71	PASS	AC=1;AF=0.00082;AN=1222;set=Intersection
22	50493074	.	C	A	1680.06	PASS	AC=26;AF=0.02128;AN=1222;set=Intersection
22	50499964	.	T	C	80263.31	PASS	AC=430;AF=0.26156;AN=1644;DS;set=Intersection
22	50499965	.	G	A	1081.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50499993	.	C	T	1117.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50500000	.	C	T	5704.76	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50500032	.	C	T	331.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50502447	.	C	T	19032.69	PASS	AC=271;AF=0.16565;AN=1636;set=Intersection
22	50502448	.	CTG	C	454.10	PASS	AC=58;AF=0.03541;AN=1638;set=Intersection
22	50502451	.	C	T	369.53	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	50502490	.	G	A	467.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50502491	.	T	C	7326.60	PASS	AC=174;AF=0.10584;AN=1644;DS;set=Intersection
22	50502496	.	G	C	300.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50502526	.	A	G	10703.54	PASS	AC=180;AF=0.10949;AN=1644;DS;set=Intersection
22	50502544	.	G	A	11421.39	PASS	AC=178;AF=0.10827;AN=1644;DS;set=Intersection
22	50502556	.	G	A	258.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50502590	.	A	T	653.63	PASS	AC=9;AF=0.00549;AN=1638;DS;set=Intersection
22	50506936	.	T	C	736.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50507009	.	G	A	990.70	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50507019	.	G	A	46132.57	PASS	AC=190;AF=0.11557;AN=1644;DS;set=Intersection
22	50512705	.	G	T	1844.55	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50512732	.	G	A	413.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50512758	.	C	T	394.50	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50512761	.	C	A	1124.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50512770	.	G	A	677.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50515226	.	C	T	974.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50515236	.	T	C	77758.85	PASS	AC=100;AF=0.06083;AN=1644;DS;set=Intersection
22	50515270	.	T	C	51088.81	PASS	AC=182;AF=0.11071;AN=1644;DS;set=Intersection
22	50515273	.	G	A	52401.66	PASS	AC=182;AF=0.11071;AN=1644;DS;set=Intersection
22	50515808	.	C	T	37321.21	PASS	AC=269;AF=0.16363;AN=1644;DS;set=Intersection
22	50515843	.	C	A	19952.17	PASS	AC=168;AF=0.10219;AN=1644;DS;set=Intersection
22	50515966	.	C	T	103.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50515977	.	C	T	228.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50518300	.	T	C	574.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50518320	.	G	A	1895.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50518325	.	C	T	1491.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50518416	.	C	T	936.48	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50518723	.	A	G	148229.62	PASS	AC=1579;AF=0.96046;AN=1644;DS;set=Intersection
22	50518815	.	C	T	1082.75	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50521564	.	C	T	2467.09	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50521582	.	C	G	654.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50521642	.	C	T	1210.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50523120	.	G	A	801.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50523140	.	T	C	858.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50523237	.	G	A	1341.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50523238	.	C	T	243.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50523239	.	G	A	1369.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50523256	.	C	T	353.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50523267	.	C	T	815.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50523297	.	T	G	283.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50528497	.	A	G	379.56	PASS	AC=90;AF=0.2394;AN=376;set=Intersection
22	50528569	.	A	T	1432.05	PASS	AC=215;AF=0.2322;AN=926;set=Intersection
22	50528623	.	C	A	422.18	PASS	AC=77;AF=0.0786;AN=980;set=Intersection
22	50530381	.	G	C	1724.92	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50530389	.	G	C	1144.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50530501	.	A	T	130485.81	PASS	AC=411;AF=0.25000;AN=1644;DS;set=Intersection
22	50530564	.	A	G	802.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50530566	.	T	G	762.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50530651	.	G	A	62112.69	PASS	AC=301;AF=0.18309;AN=1644;DS;set=Intersection
22	50530657	.	G	C	12190.72	PASS	AC=38;AF=0.02311;AN=1644;DS;set=Intersection
22	50537888	.	A	G	1200.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50537901	.	C	T	26104.26	PASS	AC=79;AF=0.04805;AN=1644;DS;set=Intersection
22	50537916	.	T	C	273.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50537957	.	G	C	1114.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50537961	.	G	C	1096.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50537980	.	G	A	1598.94	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50538028	.	G	A	844.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50538053	.	C	G	1124.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50546544	.	C	T	913.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50546612	.	C	T	818.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50546622	.	C	T	259.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50546637	.	C	G	88.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50546666	.	C	T	67264.68	PASS	AC=404;AF=0.24574;AN=1644;DS;set=Intersection
22	50546688	.	G	A	433.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50546725	.	C	T	648.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50547082	.	C	T	1043.43	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50547101	.	C	T	1249.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50547247	.	A	G	319177.88	PASS	AC=1634;AF=0.99392;AN=1644;DS;set=Intersection
22	50552053	.	G	A	510.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50552119	.	G	T	1418.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50553013	.	C	T	1006	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50553033	.	A	G	781.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50553085	.	C	T	3183.86	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50553086	.	G	A	505.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50553514	.	A	T	118668.85	PASS	AC=406;AF=0.24696;AN=1644;DS;set=Intersection
22	50553610	.	G	C	960.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50553645	.	A	G	1061.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50553702	.	C	T	1739.97	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50553703	.	C	T	745.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50555619	.	C	T	356783.96	PASS	AC=1510;AF=0.91849;AN=1644;DS;set=Intersection
22	50555635	.	C	T	57857.32	PASS	AC=229;AF=0.13929;AN=1644;DS;set=Intersection
22	50555644	.	C	T	661.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50555686	.	A	C	63931.43	PASS	AC=266;AF=0.16180;AN=1644;DS;set=Intersection
22	50555694	.	G	C	1275.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50555696	.	G	A	907.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50555697	.	C	A	1027.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50555704	.	T	C	1613.33	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50555746	.	G	A	856.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50555777	.	A	G	863.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50555825	.	T	A	23431.64	PASS	AC=100;AF=0.06083;AN=1644;DS;set=Intersection
22	50558924	.	T	G	4649.73	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50558941	.	C	T	779.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50558946	.	A	G	21966.26	PASS	AC=44;AF=0.02676;AN=1644;DS;set=Intersection
22	50559021	.	G	A	2476.30	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50559055	.	G	A	796.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50563972	.	C	T	951.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50564583	.	T	A	251.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50564618	.	A	AT	71065.57	PASS	AC=408;AF=0.24818;AN=1644;DS;set=Intersection
22	50564738	.	A	G	250.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50564750	.	C	A	4604.91	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	50566807	.	T	C	6575.45	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50566835	.	C	T	92114.82	PASS	AC=409;AF=0.24878;AN=1644;DS;set=Intersection
22	50566849	.	A	G	429.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50566950	.	T	G	481.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50566969	.	CTTTTTTTTTTT	C,CTTTTTTTTT	38006.76	PASS	AC=635,53;AF=0.38625,0.03224;AN=1644;DS;set=Intersection
22	50572406	.	A	G	54272.12	PASS	AC=275;AF=0.16727;AN=1644;DS;set=Intersection
22	50572473	.	G	A	84673.44	PASS	AC=409;AF=0.24878;AN=1644;DS;set=Intersection
22	50572517	.	G	A	452.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50572542	.	T	C	1080.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50572915	.	CT	C	1635.40	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50573036	.	A	G	2295.03	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50573081	.	T	G	134769.91	PASS	AC=390;AF=0.23723;AN=1644;DS;set=Intersection
22	50573090	.	C	G	542.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50573106	.	G	A	972.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50580542	.	T	A	4760.17	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50580611	.	C	T	575.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50580660	.	CTG	C	227.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50580665	.	G	A	386.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50580668	.	T	C	30.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50582482	.	G	A	8365.62	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50582550	.	C	A	110831.11	PASS	AC=363;AF=0.22080;AN=1644;DS;set=Intersection
22	50582583	.	G	A	664.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50582626	.	A	G	131598.39	PASS	AC=565;AF=0.34367;AN=1644;DS;set=Intersection
22	50582630	.	G	A	18352.78	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	50582643	.	C	T	1153.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50584123	.	T	C	1242.24	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50584130	.	G	A	6986.11	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50584201	.	A	C	133177.52	PASS	AC=420;AF=0.25547;AN=1644;DS;set=Intersection
22	50584248	.	C	T	12491.85	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	50584261	.	C	A	32566.82	PASS	AC=63;AF=0.03832;AN=1644;DS;set=Intersection
22	50584262	.	G	A	2726.10	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50584279	.	G	C	15467.20	PASS	AC=18;AF=0.01095;AN=1644;DS;set=Intersection
22	50584288	.	C	T	1099.63	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50588026	.	A	G	389.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50588131	.	C	T	62714.21	PASS	AC=245;AF=0.14903;AN=1644;DS;set=Intersection
22	50588153	.	G	A	67609.06	PASS	AC=416;AF=0.25304;AN=1644;DS;set=Intersection
22	50588163	.	T	C	265.53	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50588184	.	C	T	192.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50589161	.	C	T	190.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50589174	.	C	T	75.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50589196	.	C	A	41532.19	PASS	AC=248;AF=0.15085;AN=1644;DS;set=Intersection
22	50591455	.	C	T	4715.22	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50591459	.	A	G	11133.19	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	50591469	.	C	T	933.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50591470	.	G	A	8452.79	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	50591521	.	G	A	938.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50591566	.	G	A	1350.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50591668	.	G	A	4451.78	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50591677	.	C	T	370.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50591678	.	G	A	27059.92	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	50591683	.	G	A	52858.19	PASS	AC=249;AF=0.15146;AN=1644;DS;set=Intersection
22	50596612	.	G	A	913.56	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50596651	.	G	T	415.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50596655	.	G	A	2775.67	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	50598109	.	G	A	517.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50598136	.	T	C	9284.82	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	50598233	.	C	T	2178.83	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50599111	.	T	C	61363.24	PASS	AC=262;AF=0.15937;AN=1644;DS;set=Intersection
22	50599253	.	G	A	1276.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50599344	.	A	T	699.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50599383	.	T	C	1231.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50599466	.	C	A	58587.36	PASS	AC=217;AF=0.13200;AN=1644;DS;set=Intersection
22	50599491	.	G	A	521.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50599777	.	C	T	494.88	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	50609407	.	C	A	125.83	PASS	AC=8;AF=0.00662;AN=1208;set=Intersection
22	50615417	.	G	A	55.21	PASS	AC=4;AF=0.00246;AN=1626;set=Intersection
22	50616005	.	C	G	7665.40	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	50616122	.	G	A	706.18	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50616215	.	C	A	811.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50616224	.	C	G	2108.60	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50616266	.	C	T	189.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50616322	.	C	A	106.97	PASS	AC=1;AF=0.00062;AN=1614;set=Intersection
22	50616386	.	C	T	281.90	PASS	AC=8;AF=0.00609;AN=1314;set=Intersection
22	50616646	.	C	A	50.14	PASS	AC=1;AF=0.0014;AN=706;set=Intersection
22	50616656	.	T	C	6642.83	PASS	AC=795;AF=0.7950;AN=1000;set=Intersection
22	50616806	.	A	G	6023.60	PASS	AC=719;AF=0.55910;AN=1286;set=Intersection
22	50616841	.	G	C	196	PASS	AC=7;AF=0.00568;AN=1232;set=Intersection
22	50616851	.	G	C	79.18	PASS	AC=6;AF=0.00521;AN=1152;set=Intersection
22	50617355	.	G	A	424.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50617443	.	G	A	133.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50617544	.	G	A	530.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50617574	.	C	A	553.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50617589	.	C	T	166.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50617595	.	C	T	239.51	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50617599	.	C	T	934.56	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50617606	.	C	T	623.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50617618	.	G	A	332.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50617653	.	C	T	742.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50617717	.	C	T	180.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50617726	.	C	T	7636.07	PASS	AC=127;AF=0.07725;AN=1644;DS;set=Intersection
22	50617738	.	C	T	111.57	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	50631562	.	G	A	488.38	PASS	AC=19;AF=0.01336;AN=1422;set=Intersection
22	50631963	.	G	A	250.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50632028	.	G	A	15590.92	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	50632110	.	G	A	683.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50632116	.	C	T	635.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50632117	.	G	A	4244.89	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50632771	.	G	A	330.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50632820	.	G	A	164.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50632839	.	G	A	243.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50632841	.	G	A	38.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50632869	.	C	T	5177.14	PASS	AC=53;AF=0.03228;AN=1642;DS;set=Intersection
22	50632963	.	G	T	6436.50	PASS	AC=78;AF=0.04827;AN=1616;set=Intersection
22	50632964	.	A	T	6405.47	PASS	AC=76;AF=0.04703;AN=1616;set=Intersection
22	50633291	.	C	T	443.34	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50633358	.	G	A	1543.35	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50633382	.	T	C	435.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50633394	.	G	A	386.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50633436	.	C	T	229.12	PASS	AC=5;AF=0.00305;AN=1642;DS;set=Intersection
22	50633490	.	G	A	1113.48	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50635627	.	C	T	65014.23	PASS	AC=617;AF=0.37530;AN=1644;DS;set=Intersection
22	50635628	.	G	C	33740.37	PASS	AC=100;AF=0.06083;AN=1644;DS;set=Intersection
22	50635629	.	C	G	20471.95	PASS	AC=60;AF=0.03650;AN=1644;DS;set=Intersection
22	50635634	.	G	A	1547.32	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50635714	.	G	C	869.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50635729	.	C	T	146.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50635795	.	A	G	920.39	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50635831	.	G	A	349.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50635848	.	C	G	57694.72	PASS	AC=328;AF=0.19951;AN=1644;DS;set=Intersection
22	50635892	.	T	A	164.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50635949	.	C	T	648.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50636058	.	T	C	57.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50636211	.	G	A	134.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50636238	.	A	G	308.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50636357	.	C	T	850.47	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50636391	.	G	A	351.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50636429	.	C	T	503.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50636514	.	G	A	445.03	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50636731	.	G	A	67	PASS	AC=1;AF=0.00063;AN=1582;set=Intersection
22	50636755	.	C	T	585.40	PASS	AC=2;AF=0.00127;AN=1574;set=Intersection
22	50636760	.	C	T	108.75	PASS	AC=1;AF=0.00063;AN=1584;set=Intersection
22	50636770	.	A	T	97.17	PASS	AC=1;AF=0.00063;AN=1580;set=Intersection
22	50636774	.	C	T	94.15	PASS	AC=1;AF=0.00063;AN=1582;set=Intersection
22	50636962	.	G	A	37.41	PASS	AC=3;AF=0.00198;AN=1512;set=Intersection
22	50636965	.	C	T	1825.68	PASS	AC=35;AF=0.02303;AN=1520;set=Intersection
22	50639473	.	T	C	1217.54	PASS	AC=133;AF=0.4182;AN=318;set=Intersection
22	50639528	.	T	C	758.59	PASS	AC=86;AF=0.4057;AN=212;set=Intersection
22	50639636	.	C	G	241.92	PASS	AC=26;AF=0.333;AN=78;set=Intersection
22	50639778	.	T	C	145.32	PASS	AC=16;AF=0.364;AN=44;set=Intersection
22	50639965	.	C	A	1769.46	PASS	AC=186;AF=0.5886;AN=316;set=Intersection
22	50644711	.	C	G	385.81	PASS	AC=1;AF=0.00076;AN=1308;DS;set=Intersection
22	50644807	.	A	G	350.86	PASS	AC=1;AF=0.00076;AN=1314;DS;set=Intersection
22	50644812	.	C	T	326.52	PASS	AC=1;AF=0.00077;AN=1304;DS;set=Intersection
22	50644858	.	G	A	139.43	PASS	AC=1;AF=0.00077;AN=1292;DS;set=Intersection
22	50644957	.	C	T	450	PASS	AC=1;AF=0.00081;AN=1232;DS;set=Intersection
22	50644960	.	G	C	4329.90	PASS	AC=19;AF=0.01557;AN=1220;DS;set=Intersection
22	50644969	.	G	A	35303.53	PASS	AC=489;AF=0.40082;AN=1220;set=Intersection
22	50646936	.	G	C	177690.76	PASS	AC=894;AF=0.70505;AN=1268;DS;set=Intersection
22	50646998	.	T	C	388.70	PASS	AC=1;AF=0.00079;AN=1268;DS;set=Intersection
22	50647038	.	G	A	794.90	PASS	AC=1;AF=0.00080;AN=1248;DS;set=Intersection
22	50647085	.	C	T	6791.37	PASS	AC=11;AF=0.00870;AN=1264;DS;set=Intersection
22	50647086	.	G	A	559.18	PASS	AC=1;AF=0.00079;AN=1268;DS;set=Intersection
22	50647098	.	G	A	2126.30	PASS	AC=3;AF=0.00238;AN=1260;DS;set=Intersection
22	50647166	.	C	T	4818.52	PASS	AC=8;AF=0.00673;AN=1188;DS;set=Intersection
22	50647178	.	G	A	553.21	PASS	AC=1;AF=0.00086;AN=1166;DS;set=Intersection
22	50648577	.	C	T	22345.62	PASS	AC=225;AF=0.16892;AN=1332;DS;set=Intersection
22	50648617	.	G	A	346.04	PASS	AC=1;AF=0.00077;AN=1300;DS;set=Intersection
22	50648681	.	C	T	17798.38	PASS	AC=50;AF=0.04006;AN=1248;DS;set=Intersection
22	50648788	.	G	A	367.97	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	50648789	.	T	C	1102.59	PASS	AC=7;AF=0.00573;AN=1222;DS;set=Intersection
22	50649011	.	C	T	982.22	PASS	AC=1;AF=0.00081;AN=1242;DS;set=Intersection
22	50649034	.	C	T	290.79	PASS	AC=1;AF=0.00082;AN=1226;DS;set=Intersection
22	50649103	.	C	T	213.79	PASS	AC=1;AF=0.00082;AN=1216;DS;set=Intersection
22	50649104	.	G	A	396.82	PASS	AC=1;AF=0.00083;AN=1210;DS;set=Intersection
22	50649120	.	G	T	446.45	PASS	AC=1;AF=0.00082;AN=1222;DS;set=Intersection
22	50649126	.	C	T	2958.65	PASS	AC=5;AF=0.00411;AN=1216;DS;set=Intersection
22	50649210	.	C	T	896.02	PASS	AC=1;AF=0.00082;AN=1222;DS;set=Intersection
22	50649211	.	G	A	569.62	PASS	AC=1;AF=0.00082;AN=1224;DS;set=Intersection
22	50649223	.	G	C	666.37	PASS	AC=1;AF=0.00081;AN=1240;DS;set=Intersection
22	50649297	.	C	T	11195.36	PASS	AC=40;AF=0.03072;AN=1302;DS;set=Intersection
22	50649355	.	C	T	5149.13	PASS	AC=8;AF=0.00590;AN=1356;DS;set=Intersection
22	50654153	.	C	T	724.29	PASS	AC=1;AF=0.00076;AN=1314;DS;set=Intersection
22	50654168	.	C	T	1002.91	PASS	AC=1;AF=0.00075;AN=1328;DS;set=Intersection
22	50654186	.	C	T	5077.55	PASS	AC=11;AF=0.00814;AN=1352;DS;set=Intersection
22	50654198	.	A	G	708.96	PASS	AC=2;AF=0.00146;AN=1366;DS;set=Intersection
22	50654204	.	G	A	1105.61	PASS	AC=1;AF=0.00073;AN=1364;DS;set=Intersection
22	50654253	.	C	T	520.14	PASS	AC=1;AF=0.00072;AN=1380;DS;set=Intersection
22	50654305	.	T	C	4694.57	PASS	AC=8;AF=0.00541;AN=1478;DS;set=Intersection
22	50654328	.	G	A	916.80	PASS	AC=3;AF=0.00195;AN=1536;DS;set=Intersection
22	50655098	.	A	G	21616.05	PASS	AC=921;AF=0.71395;AN=1290;set=Intersection
22	50655320	.	C	T	148.29	PASS	AC=1;AF=0.00075;AN=1336;DS;set=Intersection
22	50655329	.	C	T	4651.14	PASS	AC=17;AF=0.01286;AN=1322;DS;set=Intersection
22	50655344	.	C	T	72.12	PASS	AC=1;AF=0.00077;AN=1296;DS;set=Intersection
22	50655355	.	A	G	321.37	PASS	AC=3;AF=0.00231;AN=1296;DS;set=Intersection
22	50655370	.	C	A	786.79	PASS	AC=9;AF=0.00691;AN=1302;DS;set=Intersection
22	50655376	.	CTCCAGAGCCCGGATGTCAT	C	809.16	PASS	AC=2;AF=0.00152;AN=1312;DS;set=Intersection
22	50655397	.	C	T	204.34	PASS	AC=1;AF=0.00075;AN=1334;DS;set=Intersection
22	50655468	.	G	A	773.03	PASS	AC=1;AF=0.00077;AN=1302;DS;set=Intersection
22	50655488	.	G	A	173.14	PASS	AC=1;AF=0.00076;AN=1318;DS;set=Intersection
22	50655528	.	G	A	561.47	PASS	AC=1;AF=0.00079;AN=1262;DS;set=Intersection
22	50655543	.	G	A	761.47	PASS	AC=4;AF=0.00323;AN=1240;DS;set=Intersection
22	50655590	.	A	AG	1907.12	PASS	AC=5;AF=0.00417;AN=1200;DS;set=Intersection
22	50655628	.	C	T	180.93	PASS	AC=1;AF=0.00083;AN=1208;DS;set=Intersection
22	50655669	.	C	T	58.89	PASS	AC=1;AF=0.00087;AN=1152;DS;set=Intersection
22	50655676	.	G	A	1275.44	PASS	AC=19;AF=0.01638;AN=1160;DS;set=Intersection
22	50655700	.	G	A	19841.16	PASS	AC=51;AF=0.03978;AN=1282;DS;set=Intersection
22	50655722	.	C	T	1058.95	PASS	AC=3;AF=0.00230;AN=1302;DS;set=Intersection
22	50655723	.	G	A	2289.77	PASS	AC=6;AF=0.00456;AN=1316;DS;set=Intersection
22	50655736	.	C	T	207.62	PASS	AC=1;AF=0.00078;AN=1274;DS;set=Intersection
22	50655758	.	C	T	301.93	PASS	AC=1;AF=0.00074;AN=1358;DS;set=Intersection
22	50655781	.	G	A	306.63	PASS	AC=3;AF=0.00213;AN=1406;DS;set=Intersection
22	50655799	.	C	T	2307.83	PASS	AC=12;AF=0.00813;AN=1476;DS;set=Intersection
22	50655815	.	C	T	894.86	PASS	AC=5;AF=0.00326;AN=1532;DS;set=Intersection
22	50655822	.	C	T	10882.93	PASS	AC=79;AF=0.05163;AN=1530;DS;set=Intersection
22	50656126	.	G	A	1020.13	PASS	AC=7;AF=0.00426;AN=1642;DS;set=Intersection
22	50656147	.	G	A	366.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50656192	.	G	A	1497.43	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50656247	.	T	C	381.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50656262	.	G	GA	107.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50656269	.	G	A	786.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50656317	.	C	G	265.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50656322	.	C	T	1258.98	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50656428	.	G	A	15441.07	PASS	AC=79;AF=0.04805;AN=1644;DS;set=Intersection
22	50656429	.	CGGGCCCCCAGG	C	621.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50656430	.	G	A	1084.03	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50656461	.	T	C	514.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50656534	.	C	T	2894.86	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50656587	.	C	G	446.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50656647	.	G	A	727.40	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50656650	.	C	T	310.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50656734	.	G	A	552.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50656736	.	T	C	2445.78	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50656818	.	G	A	187.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50656897	.	G	GGGCTCCA	664.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50656942	.	G	A	4451.35	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50656951	.	C	T	531.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50657008	.	C	T	62.04	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50657010	.	C	G	203721.45	PASS	AC=1639;AF=0.99696;AN=1644;DS;set=Intersection
22	50657112	.	C	T	18096.05	PASS	AC=138;AF=0.08394;AN=1644;DS;set=Intersection
22	50657118	.	G	A	3173.46	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	50657189	.	G	A	4754.24	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50657206	.	C	T	397.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50657207	.	G	A	858.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50657219	.	G	A	38141.58	PASS	AC=54;AF=0.03285;AN=1644;DS;set=Intersection
22	50657225	.	G	A	11501.51	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	50657610	.	C	T	407.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50657611	.	G	A	16948.21	PASS	AC=39;AF=0.02372;AN=1644;DS;set=Intersection
22	50657616	.	C	T	389.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50657708	.	G	T	114.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50657764	.	C	T	228.71	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	50657803	.	G	A	37.86	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	50657875	.	G	A	2378.02	PASS	AC=16;AF=0.00976;AN=1640;set=Intersection
22	50657884	.	G	T	654.72	PASS	AC=14;AF=0.00856;AN=1636;set=Intersection
22	50658030	.	A	G	159.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658033	.	C	T	189.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658035	.	G	A	475.79	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50658045	.	C	T	6587.60	PASS	AC=30;AF=0.01825;AN=1644;DS;set=Intersection
22	50658053	.	A	G	223000.44	PASS	AC=1601;AF=0.97384;AN=1644;DS;set=Intersection
22	50658099	.	C	T	227.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658116	.	CCCTGCCAGG	C	437.52	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50658161	.	C	T	578.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658165	.	G	A	5457.17	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	50658170	.	T	C	1186.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658203	.	C	A	1199.99	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50658244	.	C	G	379.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658253	.	C	T	486.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658260	.	C	T	632.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658261	.	G	A	2889.86	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	50658339	.	G	C	574.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658357	.	G	A	14234.72	PASS	AC=33;AF=0.02007;AN=1644;DS;set=Intersection
22	50658424	.	T	C	75444.07	PASS	AC=707;AF=0.43005;AN=1644;DS;set=Intersection
22	50658430	.	C	T	943.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658466	.	C	T	97.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658467	.	G	A	212.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658494	.	C	A	28494.65	PASS	AC=308;AF=0.18735;AN=1644;DS;set=Intersection
22	50658640	.	CCA	C	1044.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658686	.	C	T	327.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50658695	.	C	G	552.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50658698	.	T	A	33999.53	PASS	AC=284;AF=0.17275;AN=1644;DS;set=Intersection
22	50658702	.	TC	T	300.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658847	.	A	G	437.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658885	.	C	T	307.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658906	.	T	C	144.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50658966	.	C	T	433.14	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659033	.	A	G	678.94	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50659056	.	G	A	1203.72	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50659082	.	G	A	782.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659094	.	C	T	13324.90	PASS	AC=23;AF=0.01399;AN=1644;DS;set=Intersection
22	50659095	.	G	A	652.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659275	.	C	T	7079.66	PASS	AC=17;AF=0.01034;AN=1644;DS;set=Intersection
22	50659292	.	C	T	1013.68	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50659298	.	C	T	2213.64	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50659329	.	G	A	671.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659341	.	C	T	689.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659347	.	G	A	70416.40	PASS	AC=65;AF=0.03954;AN=1644;DS;set=Intersection
22	50659380	.	G	A	8166.25	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	50659386	.	G	A	549.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659452	.	G	A	420.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659481	.	G	A	9185.61	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50659548	.	G	A	346.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659595	.	C	T	836.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659598	.	C	T	13880.62	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	50659599	.	G	C	974.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50659613	.	C	T	773.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659690	.	C	T	674.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659696	.	C	G	5645.39	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50659788	.	C	A	196.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659796	.	C	T	177.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659797	.	G	A	210.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50659874	.	C	G	1203.58	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	50660043	.	G	A	400.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660122	.	G	A	366.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660137	.	G	A	7041.71	PASS	AC=51;AF=0.03102;AN=1644;DS;set=Intersection
22	50660176	.	G	A	236.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660214	.	C	G	2898.43	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50660296	.	G	A	296.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660298	.	C	G	417.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660301	.	G	C	544.19	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50660341	.	G	A	283.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660437	.	G	T	554.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660498	.	G	A	744.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660581	.	C	A	339.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660896	.	T	C	983.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50660972	.	G	A	569.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50661058	.	G	A	1090.95	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50662531	.	C	T	668.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50662558	.	G	A	401.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50662586	.	G	A	551.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50662705	.	T	C	666.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50662731	.	C	T	1013.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50662860	.	A	G	2969.42	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50662895	.	C	CA	4477.77	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50662925	.	C	G	1058.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50662984	.	G	A	8410.54	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50662986	.	G	A	520.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50663060	.	G	C	1039.83	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50664351	.	C	T	742.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50664381	.	G	A	1432.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50664402	.	A	G	670.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50664448	.	C	T	2400.74	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50664462	.	CAT	C	1141.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50664611	.	C	T	959.67	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50664612	.	A	G	344224.71	PASS	AC=1349;AF=0.82056;AN=1644;DS;set=Intersection
22	50664640	.	G	A	1277.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50664683	.	C	T	876.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50664684	.	G	A	1319.18	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50664735	.	G	A	827.25	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50664797	.	C	T	695.46	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50664798	.	G	A	205.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50664801	.	G	A	389.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50664818	.	G	A	1084.05	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50665126	.	T	C	292.69	PASS	AC=9;AF=0.00570;AN=1578;set=Intersection
22	50665129	.	G	A	135.41	PASS	AC=2;AF=0.00126;AN=1582;set=Intersection
22	50665137	.	C	T	261.92	PASS	AC=2;AF=0.00126;AN=1592;set=Intersection
22	50665287	.	G	C	213.17	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	50665306	.	C	T	669.53	PASS	AC=11;AF=0.00679;AN=1620;set=Intersection
22	50665446	.	G	A	212.36	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	50665476	.	A	G	619.54	PASS	AC=3;AF=0.00182;AN=1644;set=Intersection
22	50665513	.	CCA	C	726.72	PASS	AC=3;AF=0.00182;AN=1644;set=Intersection
22	50665539	.	C	T	89.91	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	50666389	.	G	C	42.84	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	50666409	.	C	T	945.10	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	50666485	.	C	T	450.36	PASS	AC=2;AF=0.00123;AN=1626;DS;set=Intersection
22	50666507	.	C	T	50950.66	PASS	AC=369;AF=0.22891;AN=1612;DS;set=Intersection
22	50667795	.	C	T	2012.50	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50667807	.	T	C	331.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50667842	.	G	A	414.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50667859	.	A	G	43521.77	PASS	AC=71;AF=0.04319;AN=1644;DS;set=Intersection
22	50667872	.	G	A	352.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50667905	.	G	A	253.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50667930	.	G	A	1336.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50668005	.	G	A	2074.23	PASS	AC=6;AF=0.00365;AN=1642;DS;set=Intersection
22	50671835	.	C	T	516.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50671849	.	C	T	214.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50671889	.	G	A	554.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50671990	.	C	T	738.43	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50678593	.	G	C	649.12	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50678620	.	G	C	36342.45	PASS	AC=67;AF=0.04075;AN=1644;DS;set=Intersection
22	50678630	.	C	CA	329.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50678643	.	G	A	228.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50678700	.	C	G	618.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50678701	.	G	A	3071.82	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50678739	.	T	A	1460.69	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50678830	.	T	C	5855.32	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50682161	.	C	A	257.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50682208	.	G	A	2476.17	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50682215	.	T	C	417.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50682234	.	C	A	403.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50682300	.	A	G	276.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50682351	.	G	T	1624.96	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50682361	.	C	G	500.13	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50682446	.	T	C	1658.37	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50682578	.	A	G	21045.64	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	50682644	.	A	C	745	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50682758	.	G	A	650.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50682771	.	C	T	555.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50682800	.	C	T	2424.78	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50682847	.	G	T	396.27	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50682865	.	G	A	47209.56	PASS	AC=492;AF=0.29927;AN=1644;DS;set=Intersection
22	50682879	.	T	C	22280.95	PASS	AC=69;AF=0.04197;AN=1644;DS;set=Intersection
22	50682913	.	G	A	888.99	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50683935	.	T	A,C,G	287.40	PASS	AC=1,0,1;AF=0.00061,0.00000,0.00061;AN=1644;DS;set=Intersection
22	50683973	.	C	G	278.38	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50683997	.	C	A	507.67	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50684097	.	G	A	1470.50	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50684256	.	T	C	10568	PASS	AC=89;AF=0.05420;AN=1642;DS;set=Intersection
22	50684296	.	T	C	56943.37	PASS	AC=1329;AF=0.81634;AN=1628;DS;set=Intersection
22	50684312	.	G	A	20581.36	PASS	AC=238;AF=0.14655;AN=1624;DS;set=Intersection
22	50684374	.	G	T	128.39	PASS	AC=1;AF=0.00061;AN=1642;set=Intersection
22	50684395	.	G	C	49.20	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	50684415	.	T	C	9216.08	PASS	AC=85;AF=0.05170;AN=1644;set=Intersection
22	50684471	.	G	C	2286.42	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50684515	.	C	T	119.32	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50684561	.	C	G	2436.74	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50684702	.	C	T	2947.64	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50684708	.	G	A	71903.18	PASS	AC=294;AF=0.17883;AN=1644;DS;set=Intersection
22	50684747	.	C	T	28903.97	PASS	AC=80;AF=0.04866;AN=1644;DS;set=Intersection
22	50684822	.	G	C	2526.87	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50684852	.	G	C	23744.44	PASS	AC=80;AF=0.04866;AN=1644;DS;set=Intersection
22	50685063	.	C	T	290.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50685069	.	C	T	5091.72	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50685086	.	A	G	839.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50685154	.	C	A	226.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50685290	.	C	T	2408.58	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50685310	.	G	A	739.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50685332	.	G	A	1393.81	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50685370	.	G	A	337.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50685402	.	G	T	295.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686283	.	C	T	456.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686284	.	G	A	2560.46	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50686333	.	T	G	292.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686371	.	C	T	12225.78	PASS	AC=50;AF=0.03041;AN=1644;DS;set=Intersection
22	50686399	.	C	T	559.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686400	.	G	A	656.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686403	.	G	A	399.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686424	.	C	A	546.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686473	.	G	A	334.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686495	.	C	T	41.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686501	.	A	T	6644.48	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	50686558	.	C	A	135.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686588	.	G	A	631.16	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50686590	.	A	G	1033.72	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50686607	.	A	G	4973.52	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50686642	.	G	A	680.23	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50686679	.	C	T	245	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686737	.	A	G	371.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686767	.	G	C	12300.90	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	50686772	.	G	C	949.61	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686775	.	C	T	478.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686807	.	G	A	824.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686821	.	CAG	C	176.27	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50686830	.	G	A	9809	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	50686938	.	A	G	103.34	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50687115	.	G	A	153.76	PASS	AC=1;AF=0.00061;AN=1630;set=Intersection
22	50687117	.	C	T	73.23	PASS	AC=1;AF=0.00061;AN=1636;set=Intersection
22	50687118	.	G	A	49.29	PASS	AC=1;AF=0.00061;AN=1630;set=Intersection
22	50687178	.	C	T	7496.56	PASS	AC=70;AF=0.04268;AN=1640;DS;set=Intersection
22	50687294	.	G	A	861.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50687302	.	C	T	89.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50687328	.	C	A	11168.26	PASS	AC=71;AF=0.04324;AN=1642;DS;set=Intersection
22	50687334	.	G	A	124.19	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	50687351	.	CAG	C	273.60	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50687487	.	C	A	968.37	PASS	AC=2;AF=0.00123;AN=1624;DS;set=Intersection
22	50687521	.	C	T	316.57	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	50687558	.	G	A	141.72	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50687573	.	C	T	52.02	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	50687595	.	A	G	15209.66	PASS	AC=94;AF=0.05739;AN=1638;DS;set=Intersection
22	50687800	.	C	T	556.98	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50688023	.	CTG	C	731.89	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688049	.	C	T	1063.87	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50688051	.	C	T	548.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688259	.	C	A	370.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688335	.	C	T	126.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688348	.	A	G	124534.72	PASS	AC=1349;AF=0.82056;AN=1644;DS;set=Intersection
22	50688398	.	G	A	385.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688456	.	C	T	624.26	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688533	.	A	T	633.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688550	.	G	A	526.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688572	.	C	T	513.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688573	.	G	A	219.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688605	.	C	T	293.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50688635	.	C	T	508.89	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50689000	.	A	AG	590.46	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50689002	.	G	A	11017.34	PASS	AC=77;AF=0.04684;AN=1644;DS;set=Intersection
22	50689267	.	G	A	85.51	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	50689311	.	G	A	365.18	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	50689427	.	G	A	229.29	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50689460	.	A	G	298.86	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	50691793	.	A	G	395.82	PASS	AC=2;AF=0.00142;AN=1404;DS;set=Intersection
22	50691870	.	C	T	599.02	PASS	AC=1;AF=0.00068;AN=1468;DS;set=Intersection
22	50691914	.	C	T	249.43	PASS	AC=1;AF=0.00077;AN=1306;DS;set=Intersection
22	50691920	.	T	TG	104.79	PASS	AC=1;AF=0.00076;AN=1320;DS;set=Intersection
22	50693704	.	C	T	428.50	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50693705	.	G	A	2016.23	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50693741	.	G	A	710.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50693764	.	C	T	719.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50693889	.	G	A	22761.77	PASS	AC=67;AF=0.04075;AN=1644;DS;set=Intersection
22	50693899	.	G	A	437.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50693919	.	C	T	8249.53	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	50693934	.	G	A	799.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50693939	.	G	C	428.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50694131	.	G	A	425.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50694279	.	C	T	252.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50694297	.	A	G	135631.93	PASS	AC=1303;AF=0.79258;AN=1644;DS;set=Intersection
22	50694529	.	G	A	1950.59	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50694568	.	G	A	348.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50694676	.	G	A	332.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695045	.	C	T	609.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695370	.	G	A	11163.34	PASS	AC=77;AF=0.04684;AN=1644;DS;set=Intersection
22	50695379	.	G	A	1234.88	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50695401	.	G	A	671.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695412	.	T	G	185.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695427	.	G	A	253.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695439	.	A	T	1104.79	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50695488	.	G	A	608.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695500	.	G	A	5909.77	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	50695503	.	G	A	384.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695506	.	C	T	265.35	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695586	.	G	T	560.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695593	.	T	A	164.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50695651	.	G	A	596.55	PASS	AC=5;AF=0.00305;AN=1642;DS;set=Intersection
22	50696623	.	G	A	931.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50696639	.	C	T	744.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50696644	.	C	T	742.03	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50696648	.	C	T	58641.63	PASS	AC=292;AF=0.17762;AN=1644;DS;set=Intersection
22	50696662	.	C	T	97258.24	PASS	AC=488;AF=0.29684;AN=1644;DS;set=Intersection
22	50696678	.	G	A	36172.69	PASS	AC=130;AF=0.07908;AN=1644;DS;set=Intersection
22	50699625	.	G	A	42.56	PASS	AC=1;AF=0.00063;AN=1590;set=Intersection
22	50699668	.	A	G	24417.43	PASS	AC=1090;AF=0.68987;AN=1580;set=Intersection
22	50703501	.	G	A	88.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50703710	.	G	A	1804.83	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50703960	.	G	A	769.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50704028	.	C	T	7799.81	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	50704075	.	G	C	267.73	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50704655	.	G	A	647.97	PASS	AC=1;AF=0.00061;AN=1628;DS;set=Intersection
22	50704661	.	T	C	111589.45	PASS	AC=1132;AF=0.69193;AN=1636;DS;set=Intersection
22	50704951	.	A	C	251.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50704979	.	C	T	455.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50705059	.	A	G	102674.64	PASS	AC=1145;AF=0.69647;AN=1644;DS;set=Intersection
22	50705060	.	C	T	271.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50705442	.	C	G	194.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50705466	.	A	G	151032.97	PASS	AC=1641;AF=0.99818;AN=1644;DS;set=Intersection
22	50705517	.	T	G	57.93	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50705528	.	C	T	259.17	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50705546	.	C	T	291.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50705547	.	G	C	1348.65	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	50705749	.	C	T	218.26	PASS	AC=1;AF=0.00062;AN=1610;set=Intersection
22	50705764	.	C	G	62.63	PASS	AC=2;AF=0.00124;AN=1614;set=Intersection
22	50705821	.	G	A	9565.45	PASS	AC=52;AF=0.03178;AN=1636;set=Intersection
22	50705921	.	G	A	790.32	PASS	AC=13;AF=0.00821;AN=1584;set=Intersection
22	50705947	.	C	T	183.29	PASS	AC=4;AF=0.00267;AN=1500;set=Intersection
22	50706381	.	G	A	3145.54	PASS	AC=174;AF=0.12083;AN=1440;set=Intersection
22	50708594	.	C	T	2739.72	PASS	AC=228;AF=0.20765;AN=1098;set=Intersection
22	50708731	.	A	G	3671.62	PASS	AC=392;AF=0.5490;AN=714;set=Intersection
22	50714211	.	A	G	1109.65	PASS	AC=3;AF=0.00198;AN=1516;DS;set=Intersection
22	50714244	.	G	A	298.05	PASS	AC=1;AF=0.00067;AN=1496;DS;set=Intersection
22	50714250	.	C	T	16140.98	PASS	AC=49;AF=0.03267;AN=1500;DS;set=Intersection
22	50714289	.	T	C	69167.83	PASS	AC=1100;AF=0.77031;AN=1428;DS;set=Intersection
22	50714298	.	C	T	242.98	PASS	AC=1;AF=0.00072;AN=1398;DS;set=Intersection
22	50714320	.	C	T	747.52	PASS	AC=2;AF=0.00137;AN=1456;DS;set=Intersection
22	50714389	.	G	A	78.34	PASS	AC=1;AF=0.00066;AN=1510;DS;set=Intersection
22	50715020	.	G	C	185.37	PASS	AC=1;AF=0.00077;AN=1292;DS;set=Intersection
22	50715023	.	G	A	221.75	PASS	AC=1;AF=0.00078;AN=1284;DS;set=Intersection
22	50715029	.	T	C	197159.67	PASS	AC=1275;AF=0.98532;AN=1294;DS;set=Intersection
22	50715165	.	C	T	686.55	PASS	AC=1;AF=0.00078;AN=1290;DS;set=Intersection
22	50715271	.	T	C	223.55	PASS	AC=2;AF=0.00164;AN=1222;DS;set=Intersection
22	50715339	.	T	C	123	PASS	AC=1;AF=0.00082;AN=1224;set=Intersection
22	50715970	.	G	A	2741.20	PASS	AC=7;AF=0.00494;AN=1416;DS;set=Intersection
22	50715973	.	G	T	49217.51	PASS	AC=629;AF=0.44801;AN=1404;DS;set=Intersection
22	50716010	.	C	A,T	2067.16	PASS	AC=1,9;AF=0.00070,0.00629;AN=1430;DS;set=Intersection
22	50716044	.	C	T	794.71	PASS	AC=1;AF=0.00071;AN=1408;DS;set=Intersection
22	50716068	.	C	T	74833.30	PASS	AC=103;AF=0.07074;AN=1456;DS;set=Intersection
22	50716167	.	G	A	111618.49	PASS	AC=760;AF=0.50870;AN=1494;DS;set=Intersection
22	50716302	.	G	A	955.96	PASS	AC=3;AF=0.00208;AN=1444;DS;set=Intersection
22	50716375	.	G	A	1080.37	PASS	AC=1;AF=0.00070;AN=1430;DS;set=Intersection
22	50716446	.	TG	T	92.53	PASS	AC=3;AF=0.00220;AN=1364;DS;set=Intersection
22	50716479	.	G	A	180.86	PASS	AC=1;AF=0.00077;AN=1294;DS;set=Intersection
22	50716480	.	C	T	2243.25	PASS	AC=18;AF=0.01385;AN=1300;DS;set=Intersection
22	50716490	.	G	T	358.63	PASS	AC=1;AF=0.00080;AN=1244;DS;set=Intersection
22	50716492	.	G	A	4215.35	PASS	AC=10;AF=0.00810;AN=1234;DS;set=Intersection
22	50716538	.	G	T	250.65	PASS	AC=1;AF=0.00083;AN=1206;DS;set=Intersection
22	50717015	.	A	G	1407.38	PASS	AC=11;AF=0.00788;AN=1396;set=Intersection
22	50717129	.	T	G	24841.43	PASS	AC=702;AF=0.50796;AN=1382;set=Intersection
22	50717263	.	C	T	63.16	PASS	AC=1;AF=0.00068;AN=1478;DS;set=Intersection
22	50717291	.	C	T	420.68	PASS	AC=2;AF=0.00132;AN=1518;DS;set=Intersection
22	50717405	.	G	A	406.89	PASS	AC=1;AF=0.00064;AN=1552;DS;set=Intersection
22	50717476	.	C	A	18198.83	PASS	AC=80;AF=0.05540;AN=1444;DS;set=Intersection
22	50718101	.	G	A	1041.27	PASS	AC=1;AF=0.00077;AN=1296;DS;set=Intersection
22	50718217	.	C	T	739.79	PASS	AC=1;AF=0.00076;AN=1308;DS;set=Intersection
22	50718397	.	A	G	97548.89	PASS	AC=873;AF=0.60794;AN=1436;DS;set=Intersection
22	50718873	.	G	A	11367.87	PASS	AC=48;AF=0.03797;AN=1264;DS;set=Intersection
22	50718893	.	C	T	221.87	PASS	AC=1;AF=0.00075;AN=1326;DS;set=Intersection
22	50718894	.	G	A	362.25	PASS	AC=1;AF=0.00075;AN=1326;DS;set=Intersection
22	50718941	.	C	T	29532.47	PASS	AC=50;AF=0.03587;AN=1394;DS;set=Intersection
22	50719040	.	C	A	566.47	PASS	AC=1;AF=0.00075;AN=1340;DS;set=Intersection
22	50719046	.	G	A	540.32	PASS	AC=1;AF=0.00075;AN=1334;DS;set=Intersection
22	50719113	.	C	T	96.34	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	50719155	.	G	A	82.10	PASS	AC=4;AF=0.00342;AN=1170;set=Intersection
22	50719161	.	C	T	94.06	PASS	AC=2;AF=0.00164;AN=1216;set=Intersection
22	50719165	.	T	C	26720.66	PASS	AC=662;AF=0.53909;AN=1228;set=Intersection
22	50719166	.	G	A	245.50	PASS	AC=1;AF=0.00081;AN=1234;set=Intersection
22	50719237	.	G	A	630.65	PASS	AC=2;AF=0.00165;AN=1214;DS;set=Intersection
22	50719251	.	A	G	46976.10	PASS	AC=701;AF=0.57271;AN=1224;DS;set=Intersection
22	50719443	.	G	A	1325.05	PASS	AC=12;AF=0.00786;AN=1526;DS;set=Intersection
22	50719484	.	G	A	333.87	PASS	AC=1;AF=0.00063;AN=1596;DS;set=Intersection
22	50719632	.	C	A	50.86	PASS	AC=1;AF=0.00064;AN=1566;DS;set=Intersection
22	50719643	.	G	C	560.64	PASS	AC=2;AF=0.00128;AN=1558;DS;set=Intersection
22	50719652	.	G	A	1006.79	PASS	AC=11;AF=0.00711;AN=1548;DS;set=Intersection
22	50719774	.	G	A	156.59	PASS	AC=1;AF=0.00073;AN=1362;set=Intersection
22	50719842	.	C	T	242.47	PASS	AC=1;AF=0.00076;AN=1322;DS;set=Intersection
22	50719860	.	C	T	11146.44	PASS	AC=38;AF=0.02960;AN=1284;DS;set=Intersection
22	50719869	.	G	A	437.68	PASS	AC=3;AF=0.00237;AN=1266;DS;set=Intersection
22	50719942	.	C	T	1056.62	PASS	AC=1;AF=0.00083;AN=1204;DS;set=Intersection
22	50719976	.	C	T	34219.30	PASS	AC=179;AF=0.14482;AN=1236;DS;set=Intersection
22	50720181	.	C	G	34261.18	PASS	AC=470;AF=0.35714;AN=1316;DS;set=Intersection
22	50720191	.	C	T	2202.06	PASS	AC=6;AF=0.00461;AN=1302;DS;set=Intersection
22	50720215	.	G	A	665.07	PASS	AC=4;AF=0.00315;AN=1268;set=Intersection
22	50720264	.	G	A	241.70	PASS	AC=1;AF=0.00081;AN=1242;DS;set=Intersection
22	50720295	.	G	A	6281.97	PASS	AC=10;AF=0.00822;AN=1216;DS;set=Intersection
22	50720319	.	G	A	10514.89	PASS	AC=21;AF=0.01744;AN=1204;DS;set=Intersection
22	50720408	.	C	T	4816.61	PASS	AC=6;AF=0.00510;AN=1176;DS;set=Intersection
22	50720430	.	G	C	36971.31	PASS	AC=86;AF=0.07179;AN=1198;DS;set=Intersection
22	50720580	.	C	T	117.32	PASS	AC=1;AF=0.00082;AN=1220;DS;set=Intersection
22	50720591	.	C	G	440.35	PASS	AC=2;AF=0.00165;AN=1210;set=Intersection
22	50720622	.	C	T	41653.06	PASS	AC=451;AF=0.38220;AN=1180;set=Intersection
22	50721118	.	G	C	5935.39	PASS	AC=50;AF=0.03876;AN=1290;set=Intersection
22	50721170	.	C	T	94.58	PASS	AC=2;AF=0.00158;AN=1264;set=Intersection
22	50721177	.	C	T	137.57	PASS	AC=1;AF=0.00079;AN=1258;set=Intersection
22	50721188	.	C	T	147	PASS	AC=1;AF=0.00079;AN=1258;set=Intersection
22	50721244	.	C	T	456.21	PASS	AC=2;AF=0.00164;AN=1222;DS;set=Intersection
22	50721252	.	T	C	628.85	PASS	AC=2;AF=0.00162;AN=1234;DS;set=Intersection
22	50721295	.	C	T	500.81	PASS	AC=1;AF=0.00086;AN=1162;DS;set=Intersection
22	50721296	.	G	A	1119.23	PASS	AC=5;AF=0.00429;AN=1166;DS;set=Intersection
22	50721492	.	C	T	2963.07	PASS	AC=41;AF=0.03480;AN=1178;set=Intersection
22	50721497	.	T	C	1056.87	PASS	AC=8;AF=0.00681;AN=1174;set=Intersection
22	50721723	.	C	T	75.50	PASS	AC=1;AF=0.00088;AN=1130;DS;set=Intersection
22	50721732	.	C	T	228.48	PASS	AC=1;AF=0.00087;AN=1144;DS;set=Intersection
22	50721756	.	G	A	27689.16	PASS	AC=119;AF=0.10644;AN=1118;DS;set=Intersection
22	50721758	.	G	A	486.03	PASS	AC=1;AF=0.00089;AN=1128;DS;set=Intersection
22	50721835	.	C	T	1555.69	PASS	AC=4;AF=0.00333;AN=1202;DS;set=Intersection
22	50721879	.	C	T	1769.79	PASS	AC=7;AF=0.00570;AN=1228;DS;set=Intersection
22	50722007	.	C	T	90.78	PASS	AC=1;AF=0.00084;AN=1196;set=Intersection
22	50722134	.	T	C	87787.85	PASS	AC=760;AF=0.63123;AN=1204;DS;set=Intersection
22	50722167	.	T	C	1822	PASS	AC=26;AF=0.02121;AN=1226;DS;set=Intersection
22	50722227	.	G	A	85.64	PASS	AC=1;AF=0.00081;AN=1230;DS;set=Intersection
22	50722277	.	C	T	5636.26	PASS	AC=27;AF=0.02246;AN=1202;DS;set=Intersection
22	50722289	.	G	A	422.78	PASS	AC=1;AF=0.00084;AN=1194;DS;set=Intersection
22	50722408	.	T	C	1360.17	PASS	AC=88;AF=0.08000;AN=1100;set=Intersection
22	50722424	.	G	A	192.01	PASS	AC=5;AF=0.00471;AN=1062;set=Intersection
22	50722468	.	G	A	575.38	PASS	AC=18;AF=0.0200;AN=898;set=Intersection
22	50722534	.	G	A	772.92	PASS	AC=1;AF=0.00087;AN=1148;DS;set=Intersection
22	50722646	.	G	A	127.46	PASS	AC=1;AF=0.00082;AN=1222;DS;set=Intersection
22	50722685	.	G	A	84.35	PASS	AC=1;AF=0.00086;AN=1162;DS;set=Intersection
22	50722691	.	C	T	82.32	PASS	AC=1;AF=0.00087;AN=1144;DS;set=Intersection
22	50723013	.	G	A	1010.23	PASS	AC=1;AF=0.00079;AN=1266;DS;set=Intersection
22	50724190	.	G	T	66145.22	PASS	AC=707;AF=0.64625;AN=1094;DS;set=Intersection
22	50724206	.	A	G	2328.64	PASS	AC=11;AF=0.00926;AN=1188;DS;set=Intersection
22	50724207	.	G	A	75707.50	PASS	AC=205;AF=0.17285;AN=1186;DS;set=Intersection
22	50724401	.	G	C	1844.15	PASS	AC=5;AF=0.00401;AN=1246;DS;set=Intersection
22	50724515	.	G	A	211.45	PASS	AC=1;AF=0.00078;AN=1276;DS;set=Intersection
22	50724593	.	G	A	8628.68	PASS	AC=22;AF=0.01513;AN=1454;DS;set=Intersection
22	50724666	.	G	A	1108.40	PASS	AC=2;AF=0.00135;AN=1480;DS;set=Intersection
22	50724731	.	G	T	2867.36	PASS	AC=5;AF=0.00331;AN=1510;DS;set=Intersection
22	50724733	.	G	T	43442.35	PASS	AC=425;AF=0.28333;AN=1500;DS;set=Intersection
22	50724751	.	G	A	393.72	PASS	AC=1;AF=0.00065;AN=1530;DS;set=Intersection
22	50725514	.	C	T	93.97	PASS	AC=2;AF=0.0025;AN=806;set=Intersection
22	50725516	.	C	T	267.27	PASS	AC=22;AF=0.0270;AN=814;set=Intersection
22	50725553	.	T	C	983.22	PASS	AC=112;AF=0.1290;AN=868;set=Intersection
22	50726237	.	G	T	184.46	PASS	AC=1;AF=0.00089;AN=1120;set=Intersection
22	50726240	.	G	A	1727.03	PASS	AC=23;AF=0.02057;AN=1118;set=Intersection
22	50726477	.	G	A	34.47	PASS	AC=2;AF=0.00185;AN=1080;set=Intersection
22	50726510	.	C	T	305.52	PASS	AC=8;AF=0.00742;AN=1078;set=Intersection
22	50727152	.	C	T	344.84	PASS	AC=1;AF=0.00078;AN=1276;DS;set=Intersection
22	50727290	.	G	A	652.79	PASS	AC=1;AF=0.00080;AN=1250;DS;set=Intersection
22	50727327	.	G	T	1594.56	PASS	AC=3;AF=0.00251;AN=1194;DS;set=Intersection
22	50727333	.	G	A	229.34	PASS	AC=1;AF=0.00085;AN=1170;DS;set=Intersection
22	50727399	.	C	T	320.92	PASS	AC=1;AF=0.00086;AN=1164;DS;set=Intersection
22	50727443	.	G	C	219.67	PASS	AC=2;AF=0.00175;AN=1146;DS;set=Intersection
22	50727512	.	G	A	935.28	PASS	AC=8;AF=0.00716;AN=1118;DS;set=Intersection
22	50727513	.	C	T	90.41	PASS	AC=1;AF=0.00090;AN=1114;DS;set=Intersection
22	50727576	.	G	A	79.10	PASS	AC=1;AF=0.00086;AN=1166;set=Intersection
22	50727899	.	C	T	124.76	PASS	AC=7;AF=0.00566;AN=1236;set=Intersection
22	50727921	.	T	C	17883.70	PASS	AC=491;AF=0.40985;AN=1198;set=Intersection
22	50728062	.	T	C	98989.10	PASS	AC=541;AF=0.45616;AN=1186;DS;set=Intersection
22	50728168	.	G	A	3053.43	PASS	AC=11;AF=0.00879;AN=1252;DS;set=Intersection
22	50728170	.	C	T	293.70	PASS	AC=1;AF=0.00080;AN=1246;DS;set=Intersection
22	50728219	.	C	G	354.66	PASS	AC=1;AF=0.00080;AN=1252;DS;set=Intersection
22	50728355	.	G	A	2559.32	PASS	AC=6;AF=0.00474;AN=1266;DS;set=Intersection
22	50728478	.	T	C	448.70	PASS	AC=1;AF=0.00077;AN=1304;DS;set=Intersection
22	50728606	.	G	A	402.52	PASS	AC=1;AF=0.00077;AN=1304;DS;set=Intersection
22	50728774	.	C	T	386.42	PASS	AC=1;AF=0.00088;AN=1130;DS;set=Intersection
22	50728777	.	C	T	416	PASS	AC=1;AF=0.00089;AN=1126;DS;set=Intersection
22	50728966	.	T	C	492.86	PASS	AC=2;AF=0.00169;AN=1180;DS;set=Intersection
22	50728969	.	G	T	76.29	PASS	AC=1;AF=0.00084;AN=1184;DS;set=Intersection
22	50729021	.	C	T	171.50	PASS	AC=1;AF=0.00081;AN=1230;DS;set=Intersection
22	50750529	.	C	G	220.38	PASS	AC=1;AF=0.00083;AN=1198;DS;set=Intersection
22	50750573	.	G	A	407.49	PASS	AC=1;AF=0.00083;AN=1208;DS;set=Intersection
22	50750606	.	G	A	484.40	PASS	AC=2;AF=0.00162;AN=1236;DS;set=Intersection
22	50750720	.	G	A	369.25	PASS	AC=2;AF=0.00161;AN=1240;DS;set=Intersection
22	50750805	.	G	A	201.43	PASS	AC=1;AF=0.00075;AN=1338;set=Intersection
22	50750835	.	G	A	2644.49	PASS	AC=38;AF=0.02798;AN=1358;set=Intersection
22	50750879	.	G	A	17302.90	PASS	AC=111;AF=0.08346;AN=1330;set=Intersection
22	50751529	.	G	C	5444.52	PASS	AC=341;AF=0.26516;AN=1286;set=Intersection
22	50751547	.	GA	G	1087.56	PASS	AC=32;AF=0.02446;AN=1308;set=Intersection
22	50751563	.	C	T	56.13	PASS	AC=1;AF=0.00076;AN=1308;set=Intersection
22	50752024	.	C	T	91.24	PASS	AC=4;AF=0.0053;AN=748;set=Intersection
22	50752105	.	G	A	359.28	PASS	AC=1;AF=0.00086;AN=1162;set=Intersection
22	50752133	.	C	T	1918.65	PASS	AC=26;AF=0.02203;AN=1180;set=Intersection
22	50752150	.	C	T	13927.50	PASS	AC=295;AF=0.24790;AN=1190;set=Intersection
22	50752169	.	G	A	14101.65	PASS	AC=334;AF=0.27973;AN=1194;set=Intersection
22	50752185	.	C	T	171.29	PASS	AC=2;AF=0.00165;AN=1210;set=Intersection
22	50752213	.	T	C	3052.51	PASS	AC=18;AF=0.01463;AN=1230;set=Intersection
22	50752258	.	G	A	4329.24	PASS	AC=15;AF=0.01161;AN=1292;DS;set=Intersection
22	50752297	.	G	A	327.27	PASS	AC=1;AF=0.00081;AN=1238;DS;set=Intersection
22	50752330	.	G	A	40.92	PASS	AC=1;AF=0.00084;AN=1196;set=Intersection
22	50752705	.	C	T	229.95	PASS	AC=2;AF=0.00168;AN=1192;DS;set=Intersection
22	50752747	.	G	C	39.04	PASS	AC=1;AF=0.00083;AN=1200;set=Intersection
22	50752784	.	C	T	120.50	PASS	AC=2;AF=0.00163;AN=1230;set=Intersection
22	50752968	.	G	A	3007.67	PASS	AC=35;AF=0.02249;AN=1556;set=Intersection
22	50753042	.	C	T	32.96	PASS	AC=1;AF=0.00064;AN=1570;set=Intersection
22	50753069	.	G	A	82.94	PASS	AC=1;AF=0.00063;AN=1598;set=Intersection
22	50753184	.	G	A	138.25	PASS	AC=1;AF=0.00070;AN=1420;set=Intersection
22	50753206	.	C	T	48.33	PASS	AC=1;AF=0.00068;AN=1478;set=Intersection
22	50753260	.	G	A	322.19	PASS	AC=1;AF=0.00069;AN=1454;set=Intersection
22	50753262	.	C	T	256.80	PASS	AC=1;AF=0.00068;AN=1464;set=Intersection
22	50753263	.	G	A	684.74	PASS	AC=9;AF=0.00615;AN=1464;set=Intersection
22	50753290	.	C	T	329.32	PASS	AC=1;AF=0.00070;AN=1422;set=Intersection
22	50753334	.	G	A	30382.31	PASS	AC=456;AF=0.33188;AN=1374;DS;set=Intersection
22	50754170	.	G	A	125.78	PASS	AC=1;AF=0.00073;AN=1364;set=Intersection
22	50754202	.	AGAG	A	10482.18	PASS	AC=73;AF=0.05432;AN=1344;set=Intersection
22	50754203	.	G	C	59.66	PASS	AC=1;AF=0.00096;AN=1046;set=Intersection
22	50754416	.	C	T	599.21	PASS	AC=1;AF=0.00075;AN=1332;DS;set=Intersection
22	50754445	.	A	T	7223.41	PASS	AC=21;AF=0.01570;AN=1338;DS;set=Intersection
22	50754466	.	C	T	85268.80	PASS	AC=408;AF=0.30267;AN=1348;DS;set=Intersection
22	50754512	.	C	T	19524.35	PASS	AC=70;AF=0.05452;AN=1284;DS;set=Intersection
22	50754519	.	G	A	721.65	PASS	AC=1;AF=0.00078;AN=1280;DS;set=Intersection
22	50754648	.	T	C	60019.08	PASS	AC=559;AF=0.45008;AN=1242;DS;set=Intersection
22	50754649	.	G	A	346.97	PASS	AC=1;AF=0.00081;AN=1236;DS;set=Intersection
22	50754705	.	C	T	125.46	PASS	AC=1;AF=0.00078;AN=1276;set=Intersection
22	50754772	.	C	T	9771.48	PASS	AC=97;AF=0.07326;AN=1324;set=Intersection
22	50754836	.	G	A	51.72	PASS	AC=4;AF=0.00287;AN=1396;set=Intersection
22	50754874	.	C	G	97.53	PASS	AC=1;AF=0.00068;AN=1464;set=Intersection
22	50755782	.	G	A	1341.33	PASS	AC=5;AF=0.00419;AN=1192;DS;set=Intersection
22	50755840	.	C	T	159.56	PASS	AC=1;AF=0.00081;AN=1228;DS;set=Intersection
22	50756320	.	C	T	266.20	PASS	AC=3;AF=0.00254;AN=1182;set=Intersection
22	50756388	.	G	A	426.45	PASS	AC=1;AF=0.00082;AN=1214;DS;set=Intersection
22	50756413	.	C	A	398.80	PASS	AC=1;AF=0.00080;AN=1246;DS;set=Intersection
22	50756452	.	A	G	25561.11	PASS	AC=93;AF=0.07776;AN=1196;DS;set=Intersection
22	50756486	.	G	A	64.20	PASS	AC=1;AF=0.00084;AN=1184;DS;set=Intersection
22	50757242	.	C	T	632.64	PASS	AC=3;AF=0.00245;AN=1226;set=Intersection
22	50757245	.	G	C	252.92	PASS	AC=3;AF=0.00241;AN=1246;set=Intersection
22	50757337	.	C	T	1906.31	PASS	AC=8;AF=0.00605;AN=1322;DS;set=Intersection
22	50757348	.	G	A	45961.23	PASS	AC=653;AF=0.49470;AN=1320;DS;set=Intersection
22	50757365	.	T	C	4370.91	PASS	AC=45;AF=0.03399;AN=1324;DS;set=Intersection
22	50757470	.	T	C	31608.17	PASS	AC=693;AF=0.51031;AN=1358;set=Intersection
22	50832305	.	T	A	2947.54	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50832326	.	GC	G	3106.51	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50832366	.	C	T	668.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50832373	.	T	C	1948.76	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50832506	.	C	T	1651.41	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50845178	.	C	T	664.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50845314	.	G	A	826.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50852952	.	G	A	1324	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50853008	.	A	G	521.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50853021	.	T	A	1659.15	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50853095	.	G	A	2438.99	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	50853132	.	TC	T	80619.62	PASS	AC=810;AF=0.49270;AN=1644;DS;set=Intersection
22	50853140	.	C	T	5769	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	50854501	.	G	T	832.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50854604	.	C	T	508.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50857273	.	CTG	C	1268.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50857832	.	G	T	2660.20	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50857916	.	G	A	246.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50857917	.	T	C	2393.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50860674	.	C	T	347.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50860818	.	C	T	1470.45	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50869667	.	T	C	748.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50869692	.	G	C	13672.18	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	50869709	.	C	T	800.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50869757	.	C	T	1247.53	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50869761	.	G	A	554.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50869776	.	G	T	466.87	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50869795	.	A	C	858.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50873355	.	G	T	309.40	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50873356	.	G	T	255.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50873415	.	G	A	1434.69	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50873450	.	G	T	1713.26	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50873451	.	C	T	1680.13	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50873497	.	C	T	23812.01	PASS	AC=116;AF=0.07056;AN=1644;DS;set=Intersection
22	50873542	.	G	A	490.12	PASS	AC=1;AF=0.00061;AN=1634;DS;set=Intersection
22	50873546	.	C	T	37052.03	PASS	AC=415;AF=0.25429;AN=1632;DS;set=Intersection
22	50873557	.	A	G	32216.89	PASS	AC=402;AF=0.24845;AN=1618;DS;set=Intersection
22	50874850	.	C	T	439.68	PASS	AC=1;AF=0.00062;AN=1612;DS;set=Intersection
22	50874851	.	G	A	2857.24	PASS	AC=18;AF=0.01115;AN=1614;DS;set=Intersection
22	50874873	.	G	A	760.07	PASS	AC=4;AF=0.00250;AN=1602;DS;set=Intersection
22	50874893	.	C	T	28191.37	PASS	AC=369;AF=0.23237;AN=1588;DS;set=Intersection
22	50874899	.	T	C	1230.52	PASS	AC=21;AF=0.01324;AN=1586;DS;set=Intersection
22	50874918	.	C	T	332.79	PASS	AC=4;AF=0.00261;AN=1534;DS;set=Intersection
22	50874929	.	C	T	1288.83	PASS	AC=14;AF=0.00933;AN=1500;DS;set=Intersection
22	50874930	.	G	A	242.54	PASS	AC=1;AF=0.00067;AN=1496;DS;set=Intersection
22	50875908	.	GTCCC	G	8073.03	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	50876021	.	C	T	316.25	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50876050	.	G	A	2420.94	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	50876065	.	C	T	205.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50876077	.	T	C	163341.21	PASS	AC=1401;AF=0.85219;AN=1644;DS;set=Intersection
22	50876081	.	G	C	130.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50876235	.	T	C	135035.80	PASS	AC=1237;AF=0.77024;AN=1606;DS;set=Intersection
22	50876243	.	C	T	628.07	PASS	AC=7;AF=0.00434;AN=1612;DS;set=Intersection
22	50876357	.	C	G	75886.52	PASS	AC=1098;AF=0.67033;AN=1638;DS;set=Intersection
22	50876640	.	G	A	1072.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50876662	.	T	G	18290.41	PASS	AC=60;AF=0.03650;AN=1644;DS;set=Intersection
22	50876708	.	C	T	918.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50876731	.	C	T	911.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50876755	.	C	T	65025.55	PASS	AC=289;AF=0.17579;AN=1644;DS;set=Intersection
22	50876761	.	C	A	2682.94	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50876767	.	A	G	538.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50876770	.	T	C	717.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50876775	.	C	T	10209.45	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	50877144	.	C	T	7964.17	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	50877156	.	A	C	294.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50877165	.	CG	C	4348.20	PASS	AC=389;AF=0.23662;AN=1644;DS;set=Intersection
22	50877166	.	G	C	112403.35	PASS	AC=1173;AF=0.71350;AN=1644;DS;set=Intersection
22	50877170	.	C	G	586.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50877203	.	C	T	912.33	PASS	AC=7;AF=0.00426;AN=1642;DS;set=Intersection
22	50877216	.	G	C	504.19	PASS	AC=4;AF=0.00244;AN=1640;DS;set=Intersection
22	50877229	.	G	A	118.12	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	50878134	.	C	T	3123.23	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50878143	.	G	A	1132.67	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50878183	.	C	G	768.22	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50878196	.	G	A	59680.84	PASS	AC=357;AF=0.21715;AN=1644;DS;set=Intersection
22	50878275	.	A	G	14368.05	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	50878306	.	G	C	448.48	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50878409	.	T	A	87.65	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50878419	.	C	T	530.10	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50878441	.	T	C	111.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50878449	.	G	A	410.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50879257	.	C	T	316.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50879346	.	G	A	424.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50879354	.	C	T	891.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50879355	.	G	A	520.86	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50879373	.	G	C	1694.64	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50879447	.	T	G	20653	PASS	AC=323;AF=0.19647;AN=1644;DS;set=Intersection
22	50879471	.	C	T	190.47	PASS	AC=1;AF=0.00062;AN=1620;DS;set=Intersection
22	50879486	.	C	T	160.52	PASS	AC=1;AF=0.00062;AN=1602;set=Intersection
22	50882314	.	C	T	250.66	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50882317	.	C	A	249.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50882323	.	A	C	117.66	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50882338	.	G	A	1363.87	PASS	AC=22;AF=0.01340;AN=1642;DS;set=Intersection
22	50882367	.	C	T	412.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50882368	.	G	A	91.66	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	50882376	.	G	A	81.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50882427	.	C	T	1337.39	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50882428	.	G	C	289.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50882544	.	C	T	392.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50882572	.	G	T	623.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50882589	.	C	G	561.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50882590	.	G	A	61045.05	PASS	AC=353;AF=0.21472;AN=1644;DS;set=Intersection
22	50882600	.	C	T	343.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50882635	.	G	C	172.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50882671	.	G	T	405.83	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50920375	.	C	T	45.38	PASS	AC=1;AF=0.00069;AN=1444;set=Intersection
22	50921076	.	G	A	65.05	PASS	AC=1;AF=0.00061;AN=1632;set=Intersection
22	50921129	.	C	T	140.21	PASS	AC=2;AF=0.00122;AN=1642;set=Intersection
22	50921132	.	C	A	973.88	PASS	AC=7;AF=0.00427;AN=1640;set=Intersection
22	50921148	.	AACACTCGGGCCCCCGAAG	A	11421.63	PASS	AC=176;AF=0.10745;AN=1638;set=Intersection
22	50921154	.	CGGGCCCCCGAAGACA	C	6960.08	PASS	AC=146;AF=0.08902;AN=1640;set=Intersection
22	50925285	.	G	A	518.82	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50925298	.	T	A	427.68	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50925765	.	C	T	497.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50925771	.	G	A	37536.94	PASS	AC=159;AF=0.09672;AN=1644;DS;set=Intersection
22	50925908	.	C	T	2502.92	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50925914	.	GC	G	22884.40	PASS	AC=166;AF=0.10097;AN=1644;DS;set=Intersection
22	50925943	.	G	A	1358.34	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50926045	.	C	T	391.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50926070	.	C	T	486.43	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50926082	.	G	A	26070.62	PASS	AC=43;AF=0.02616;AN=1644;DS;set=Intersection
22	50926132	.	C	T	5897.41	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50926181	.	T	G	1336.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50926192	.	C	T	211.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50926366	.	G	A	2254.88	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50926407	.	C	T	6062.19	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	50926439	.	A	G	549.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50926466	.	A	G	905.04	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50926657	.	C	T	984.61	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	50926731	.	A	G	301.91	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50926765	.	G	T	240.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50926768	.	C	T	26756.85	PASS	AC=172;AF=0.10462;AN=1644;DS;set=Intersection
22	50927441	.	G	GACTCCCGTC,GCCGCCCGTC	68641.22	PASS	AC=1066,4;AF=0.64842,0.00243;AN=1644;set=Intersection
22	50927442	.	C	A	15661.16	PASS	AC=149;AF=0.09063;AN=1644;set=Intersection
22	50927447	.	C	CGTCCCTCCT	141980.20	PASS	AC=983;AF=0.59793;AN=1644;set=Intersection
22	50927545	.	A	T	299.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50927563	.	A	G	940.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50927618	.	C	T	449.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50927693	.	C	T	244.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50927745	.	TGGGGCGGTGG	T	145.20	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	50927769	.	A	G	240.65	PASS	AC=14;AF=0.00972;AN=1440;set=Intersection
22	50927779	.	G	A	798.92	PASS	AC=20;AF=0.01333;AN=1500;set=Intersection
22	50927870	.	C	T	652.22	PASS	AC=2;AF=0.00122;AN=1644;set=Intersection
22	50927916	.	C	T	231.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50927937	.	G	A	129.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50927956	.	C	T	2024.66	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	50927976	.	C	T	222.41	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50927990	.	C	T	205.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50928005	.	G	A	14652.47	PASS	AC=85;AF=0.05170;AN=1644;DS;set=Intersection
22	50928010	.	G	A	2144.94	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50928012	.	G	A	1150.86	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	50928026	.	G	A	30618.96	PASS	AC=366;AF=0.22263;AN=1644;DS;set=Intersection
22	50928082	.	C	T	905.36	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	50928083	.	G	A	162.63	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50928179	.	A	G	369.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50928217	.	G	A	251.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50928311	.	G	A	728.33	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50928312	.	G	A	395.99	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50928331	.	G	A	26766.87	PASS	AC=380;AF=0.23143;AN=1642;DS;set=Intersection
22	50954868	.	T	C	668.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50954990	.	T	TC	3764.21	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50955833	.	C	T	2115.08	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50955946	.	A	G	1230.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50955980	.	G	A	820.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956026	.	C	T	940.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956071	.	C	G	820.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956116	.	C	T	909.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956117	.	G	A	727.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956142	.	C	T	18874.52	PASS	AC=48;AF=0.02920;AN=1644;DS;set=Intersection
22	50956174	.	T	C	688.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956237	.	G	A	361.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956370	.	G	T	892.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956386	.	C	A,G,T	6853.73	PASS	AC=0,31,2;AF=0.00000,0.01886,0.00122;AN=1644;DS;set=Intersection
22	50956395	.	C	T	150.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956501	.	G	A	3126.14	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50956503	.	C	T	494.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956510	.	G	A	1212.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50956610	.	G	A	534.66	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956614	.	G	A	742.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50956676	.	G	A	1348.54	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50956723	.	C	T	255.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956724	.	G	A	554.58	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50956742	.	GA	G	321.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50957115	.	C	T	5715.68	PASS	AC=21;AF=0.01277;AN=1644;DS;set=Intersection
22	50957143	.	G	A	545.91	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50957150	.	C	G	45.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50957180	.	G	A	301.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50957183	.	G	A	1202.81	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50957598	.	A	G	2795.25	PASS	AC=51;AF=0.03106;AN=1642;set=Intersection
22	50957625	.	C	G	6661.11	PASS	AC=26;AF=0.01582;AN=1644;set=Intersection
22	50957701	.	G	A	76.75	PASS	AC=2;AF=0.00122;AN=1640;set=Intersection
22	50957733	.	C	T	926.85	PASS	AC=9;AF=0.00547;AN=1644;set=Intersection
22	50957827	.	A	G	366.70	PASS	AC=4;AF=0.00243;AN=1644;set=Intersection
22	50959456	.	C	G	791.22	PASS	AC=6;AF=0.00401;AN=1498;DS;set=Intersection
22	50959478	.	G	A	1626.46	PASS	AC=3;AF=0.00208;AN=1442;DS;set=Intersection
22	50959949	.	G	A	661.47	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960010	.	C	T	799.71	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960125	.	C	T	907.02	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960172	.	A	G	949.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960191	.	C	G	787.49	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50960220	.	C	T	294.30	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960235	.	G	A	2058.98	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50960270	.	G	A	1502.55	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50960302	.	G	A	987.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50960316	.	T	TG	2957.01	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	50960428	.	C	T	873.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960434	.	C	G	1899.11	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50960439	.	G	A	530.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960445	.	G	A	437.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960682	.	C	T	59115.25	PASS	AC=351;AF=0.21350;AN=1644;DS;set=Intersection
22	50960694	.	G	C	2634.73	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50960769	.	C	T	511.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960790	.	C	A	457.75	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960791	.	G	A	7475.30	PASS	AC=16;AF=0.00973;AN=1644;DS;set=Intersection
22	50960792	.	G	A	580.75	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50960851	.	G	A	259.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960852	.	C	T	294.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960965	.	G	A	842.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50960988	.	C	T	19329.35	PASS	AC=28;AF=0.01703;AN=1644;DS;set=Intersection
22	50960989	.	G	A	654.79	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961020	.	A	T	362.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961058	.	C	T	116.56	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961092	.	C	G	793.36	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50961134	.	G	C	713.42	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961169	.	A	G	140112.80	PASS	AC=1404;AF=0.85401;AN=1644;DS;set=Intersection
22	50961173	.	G	A	343.83	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50961211	.	C	G	282.05	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961365	.	G	A	2647.82	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	50961373	.	C	T	1505.47	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	50961387	.	C	A	484.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961418	.	G	T	443.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961475	.	C	T	304.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961503	.	C	T	579.03	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961521	.	T	C	233.95	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961536	.	C	T	28732.11	PASS	AC=66;AF=0.04015;AN=1644;DS;set=Intersection
22	50961614	.	G	A	325.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961622	.	G	A	453.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50961714	.	C	T	220.78	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50961786	.	C	T	2253.83	PASS	AC=25;AF=0.01530;AN=1634;DS;set=Intersection
22	50961816	.	C	T	229.88	PASS	AC=1;AF=0.00062;AN=1618;DS;set=Intersection
22	50961842	.	T	C	438.43	PASS	AC=4;AF=0.00248;AN=1616;DS;set=Intersection
22	50961854	.	T	C	43162.35	PASS	AC=1023;AF=0.63619;AN=1608;DS;set=Intersection
22	50962009	.	C	T	340.77	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50962057	.	G	A	509.39	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50962065	.	G	A	6229.54	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	50962078	.	G	T	2660.71	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	50962117	.	C	T	1000.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50962208	.	T	G	220849.54	PASS	AC=1059;AF=0.64416;AN=1644;DS;set=Intersection
22	50962259	.	G	A	23820.79	PASS	AC=61;AF=0.03710;AN=1644;DS;set=Intersection
22	50962265	.	G	A	2044.71	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50962381	.	C	T	843.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50962424	.	G	A	363.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50962438	.	CAG	C	607.87	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50962463	.	C	T	944.51	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50962514	.	G	A	20586.07	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	50962560	.	A	G	166.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50962640	.	G	A	187.92	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50962782	.	C	G	98061.19	PASS	AC=1049;AF=0.63808;AN=1644;DS;set=Intersection
22	50964153	.	T	C	23007.22	PASS	AC=1262;AF=0.86202;AN=1464;set=Intersection
22	50964236	.	G	A	5940.84	PASS	AC=193;AF=0.12798;AN=1508;set=Intersection
22	50964255	.	C	T	1436.75	PASS	AC=32;AF=0.02213;AN=1446;set=Intersection
22	50964402	.	G	A	320.97	PASS	AC=13;AF=0.0342;AN=380;set=Intersection
22	50964446	.	A	T	616.52	PASS	AC=56;AF=0.1667;AN=336;set=Intersection
22	50964599	.	G	C	116.92	PASS	AC=8;AF=0.0090;AN=884;set=Intersection
22	50964618	.	C	T	1037.79	PASS	AC=21;AF=0.0228;AN=922;set=Intersection
22	50964637	.	G	T	42.28	PASS	AC=1;AF=0.0010;AN=980;set=Intersection
22	50964653	.	C	A	47.72	PASS	AC=1;AF=0.0011;AN=936;set=Intersection
22	50964663	.	C	T	378.53	PASS	AC=5;AF=0.0050;AN=996;set=Intersection
22	50964862	.	G	A	6297.90	PASS	AC=501;AF=0.5693;AN=880;set=Intersection
22	50964907	.	TGCGG	T	221.27	PASS	AC=7;AF=0.00676;AN=1036;set=Intersection
22	50965102	.	C	T	1564.75	PASS	AC=38;AF=0.02493;AN=1524;set=Intersection
22	50965559	.	A	T	354.08	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50965624	.	C	T	1362.98	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50965724	.	G	A	293.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50966051	.	C	T	379.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50966144	.	C	T	243.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50966173	.	G	A	473.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50966184	.	A	G	28566.07	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	50966908	.	C	G	294.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50966914	.	T	C	191714.38	PASS	AC=935;AF=0.56943;AN=1642;DS;set=Intersection
22	50966932	.	G	A	875.99	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	50967020	.	C	T	696.72	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50967024	.	C	T	503.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50967538	.	C	G	523.41	PASS	AC=12;AF=0.00730;AN=1644;set=Intersection
22	50967540	.	G	A	601.96	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50967666	.	C	G	491.10	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50967740	.	C	T	688.52	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50967801	.	C	T	71.64	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50967905	.	G	A	585.55	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50967912	.	C	T	1915.11	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	50967913	.	C	T	265.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50967935	.	G	A	15750.52	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	50968184	.	C	A	149.36	PASS	AC=2;AF=0.00123;AN=1630;set=Intersection
22	50969312	.	C	T	107.15	PASS	AC=1;AF=0.00093;AN=1072;set=Intersection
22	50969352	.	G	T	80.20	PASS	AC=1;AF=0.00090;AN=1112;set=Intersection
22	50969450	.	C	T	90.03	PASS	AC=2;AF=0.00172;AN=1164;set=Intersection
22	50969647	.	C	G	2415.88	PASS	AC=21;AF=0.01659;AN=1266;DS;set=Intersection
22	50969752	.	G	C	2924.85	PASS	AC=23;AF=0.01724;AN=1334;DS;set=Intersection
22	50969765	.	G	A	3119.28	PASS	AC=13;AF=0.00964;AN=1348;DS;set=Intersection
22	50970068	.	C	T	143.86	PASS	AC=11;AF=0.0149;AN=740;set=Intersection
22	50970219	.	T	C	1936.72	PASS	AC=73;AF=0.0941;AN=776;set=Intersection
22	50970231	.	G	C	75.90	PASS	AC=10;AF=0.0136;AN=736;set=Intersection
22	50970354	.	C	A	102.32	PASS	AC=2;AF=0.0022;AN=926;set=Intersection
22	50970516	.	G	A	617.68	PASS	AC=25;AF=0.0353;AN=708;set=Intersection
22	50970517	.	G	C	44.55	PASS	AC=2;AF=0.0029;AN=700;set=Intersection
22	50987175	.	G	T	1488.41	PASS	AC=52;AF=0.04031;AN=1290;set=Intersection
22	50987273	.	G	T	126.05	PASS	AC=1;AF=0.00070;AN=1420;set=Intersection
22	50987287	.	A	G	11549.72	PASS	AC=476;AF=0.32692;AN=1456;set=Intersection
22	50987353	.	T	C	223.58	PASS	AC=1;AF=0.00064;AN=1558;set=Intersection
22	50987601	.	A	T	39.90	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	50987609	.	GC	G	919.94	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50987690	.	C	T	1034.35	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	50987843	.	C	T	50054.52	PASS	AC=113;AF=0.06873;AN=1644;DS;set=Intersection
22	50987859	.	G	A	77.85	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	50987990	.	G	A	24186.90	PASS	AC=29;AF=0.01764;AN=1644;DS;set=Intersection
22	50988038	.	C	T	813.57	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	50988062	.	G	T	97872.90	PASS	AC=745;AF=0.45316;AN=1644;DS;set=Intersection
22	50988105	.	G	A	4889.71	PASS	AC=34;AF=0.02073;AN=1640;DS;set=Intersection
22	50988141	.	G	A	3001.88	PASS	AC=12;AF=0.00731;AN=1642;DS;set=Intersection
22	50988183	.	G	A	93.92	PASS	AC=1;AF=0.00061;AN=1640;DS;set=Intersection
22	50988192	.	C	A	61.40	PASS	AC=1;AF=0.00061;AN=1638;DS;set=Intersection
22	50988193	.	A	G	39271.81	PASS	AC=967;AF=0.58963;AN=1640;DS;set=Intersection
22	50988317	.	C	T	81.08	PASS	AC=2;AF=0.00122;AN=1642;set=Intersection
22	50988352	.	C	A	90.18	PASS	AC=1;AF=0.00061;AN=1638;set=Intersection
22	50988376	.	T	C	194.74	PASS	AC=2;AF=0.00122;AN=1634;set=Intersection
22	50988413	.	C	G	48.02	PASS	AC=1;AF=0.00062;AN=1618;set=Intersection
22	51007725	.	C	T	821.24	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51007847	.	C	T	746.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51007848	.	G	A	2095.88	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	51007987	.	C	A	4826.81	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	51007989	.	G	T	446.40	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51008045	.	A	G	764.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51008048	.	G	A	618.28	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51008055	.	C	T	1420.22	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51008121	.	G	A	27000.84	PASS	AC=70;AF=0.04258;AN=1644;DS;set=Intersection
22	51008135	.	A	G	4584.34	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	51008141	.	G	A	1381.06	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	51008731	.	G	A	653.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51008816	.	C	T	817.60	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51008850	.	A	G	81602.51	PASS	AC=301;AF=0.18309;AN=1644;DS;set=Intersection
22	51009310	.	C	T	2153.59	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51009371	.	G	C	1735.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51009468	.	G	T	6244.04	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	51009486	.	G	T	9863.81	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	51009487	.	T	C	10336.95	PASS	AC=14;AF=0.00852;AN=1644;DS;set=Intersection
22	51009560	.	A	AC	10606.76	PASS	AC=13;AF=0.00791;AN=1644;DS;set=Intersection
22	51009624	.	G	A	633.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51009736	.	G	C	464.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51009806	.	G	A	663.16	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51009856	.	C	T	923.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51009918	.	G	A	590.04	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51009938	.	C	T	563.98	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51009953	.	C	T	133781.26	PASS	AC=637;AF=0.38747;AN=1644;DS;set=Intersection
22	51010416	.	C	T	25074.10	PASS	AC=49;AF=0.02981;AN=1644;DS;set=Intersection
22	51010540	.	G	A	528.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51010558	.	G	C	733.01	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51010603	.	C	A	895.43	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51010609	.	G	C	1000.88	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51010668	.	C	T	6277.01	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	51010737	.	C	T	297.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51010743	.	G	A	18758.75	PASS	AC=26;AF=0.01582;AN=1644;DS;set=Intersection
22	51011300	.	G	A	602.36	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51011348	.	G	A	12937.75	PASS	AC=34;AF=0.02068;AN=1644;DS;set=Intersection
22	51011376	.	G	C	234259.81	PASS	AC=588;AF=0.35766;AN=1644;DS;set=Intersection
22	51011453	.	G	A	557.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51011522	.	G	A	369.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51011926	.	A	G	262.07	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51011936	.	T	C	170798.70	PASS	AC=1296;AF=0.78832;AN=1644;DS;set=Intersection
22	51012057	.	C	T	610.54	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51012117	.	C	T	281.23	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51012175	.	G	A	204.35	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	51012775	.	C	T	35175	PASS	AC=96;AF=0.05839;AN=1644;DS;set=Intersection
22	51012777	.	C	T	880.45	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51012854	.	G	A	10466.45	PASS	AC=20;AF=0.01217;AN=1644;DS;set=Intersection
22	51012979	.	G	T	960.77	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51013003	.	G	A	10062.45	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	51013072	.	G	A	87298.86	PASS	AC=299;AF=0.18187;AN=1644;DS;set=Intersection
22	51014691	.	T	C	882.19	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51014787	.	C	T	668.97	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51014925	.	A	T	691.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51014966	.	C	A,T	735.47	PASS	AC=1,1;AF=0.00061,0.00061;AN=1644;DS;set=Intersection
22	51015003	.	T	C	474.81	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51015069	.	G	A	256	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51015403	.	C	A	818.46	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51015481	.	G	A	119127.04	PASS	AC=646;AF=0.39294;AN=1644;DS;set=Intersection
22	51015490	.	G	A	5367.58	PASS	AC=11;AF=0.00669;AN=1644;DS;set=Intersection
22	51015706	.	C	T	4829.86	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	51015793	.	A	G	6198.81	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	51015801	.	T	G	650.80	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51015838	.	T	C	74232.07	PASS	AC=293;AF=0.17822;AN=1644;DS;set=Intersection
22	51015931	.	C	T	3071.22	PASS	AC=19;AF=0.01156;AN=1644;DS;set=Intersection
22	51016158	.	G	A	17384.59	PASS	AC=24;AF=0.01460;AN=1644;DS;set=Intersection
22	51016165	.	G	A	378.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51016170	.	C	T	981.69	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51016360	.	G	A	35309.88	PASS	AC=93;AF=0.05657;AN=1644;DS;set=Intersection
22	51016370	.	C	G	228.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51017690	.	G	A	1277.06	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51017713	.	G	A	80053.53	PASS	AC=296;AF=0.18005;AN=1644;DS;set=Intersection
22	51018129	.	T	TA	7165.52	PASS	AC=6;AF=0.00365;AN=1644;DS;set=Intersection
22	51018204	.	T	C	1194.66	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51018297	.	T	C	1859.05	PASS	AC=3;AF=0.00182;AN=1644;DS;set=Intersection
22	51018574	.	G	A	868.21	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51018579	.	A	G	174906.49	PASS	AC=655;AF=0.39842;AN=1644;DS;set=Intersection
22	51018623	.	A	G	1485.70	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51018814	.	C	T	914.37	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51018955	.	G	A	786.53	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51019105	.	T	C	974.59	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51019113	.	A	C	41416.96	PASS	AC=130;AF=0.07908;AN=1644;DS;set=Intersection
22	51019138	.	C	T	4967.93	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	51019802	.	A	T	777.31	PASS	AC=2;AF=0.00122;AN=1642;DS;set=Intersection
22	51019857	.	G	T	112.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51019914	.	C	T	1023.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51019929	.	A	C	522.44	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51019973	.	A	G	1025.57	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51019978	.	C	T	945.33	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51020279	.	G	A	583.17	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51020668	.	C	A	39602.15	PASS	AC=1158;AF=0.71130;AN=1628;set=Intersection
22	51020762	.	G	A	201.43	PASS	AC=2;AF=0.00126;AN=1582;set=Intersection
22	51020995	.	G	A	4367.36	PASS	AC=28;AF=0.01724;AN=1624;set=Intersection
22	51021258	.	C	A	122.65	PASS	AC=6;AF=0.00457;AN=1314;set=Intersection
22	51063571	.	C	T	44.66	PASS	AC=1;AF=0.00061;AN=1634;set=Intersection
22	51063610	.	C	T	5774.16	PASS	AC=69;AF=0.04197;AN=1644;set=Intersection
22	51063616	.	G	A	163.66	PASS	AC=1;AF=0.00061;AN=1644;set=Intersection
22	51063656	.	C	T	287.49	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51063758	.	C	T	469.57	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51063778	.	T	C	1757.61	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51063806	.	G	C	471.14	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51063852	.	G	A	1291.84	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51063959	.	G	A	2314.81	PASS	AC=5;AF=0.00304;AN=1644;DS;set=Intersection
22	51063987	.	G	C	212846.92	PASS	AC=1361;AF=0.82786;AN=1644;DS;set=Intersection
22	51063994	.	G	T	11364.98	PASS	AC=15;AF=0.00912;AN=1644;DS;set=Intersection
22	51064039	.	G	C	155051.64	PASS	AC=706;AF=0.42944;AN=1644;DS;set=Intersection
22	51064068	.	G	A	12251.89	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	51064138	.	G	A	696.51	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51064141	.	G	A	106492.43	PASS	AC=1327;AF=0.80718;AN=1644;DS;set=Intersection
22	51064365	.	T	G	378.62	PASS	AC=1;AF=0.00061;AN=1636;DS;set=Intersection
22	51064416	.	T	C	17018.76	PASS	AC=332;AF=0.20219;AN=1642;DS;set=Intersection
22	51064469	.	G	A	325.52	PASS	AC=3;AF=0.00183;AN=1642;DS;set=Intersection
22	51064489	.	C	T	695.50	PASS	AC=4;AF=0.00244;AN=1642;DS;set=Intersection
22	51064524	.	C	T	398.62	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51064544	.	T	C	5502.27	PASS	AC=37;AF=0.02251;AN=1644;DS;set=Intersection
22	51064589	.	G	A	160.07	PASS	AC=1;AF=0.00061;AN=1642;DS;set=Intersection
22	51064659	.	C	T	175.31	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51064668	.	C	A	536.12	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51065229	.	G	A	16130.03	PASS	AC=56;AF=0.03406;AN=1644;DS;set=Intersection
22	51065266	.	G	C	744.15	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51065287	.	G	A	2958.89	PASS	AC=8;AF=0.00487;AN=1644;DS;set=Intersection
22	51065310	.	G	A	1106.67	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51065322	.	A	G	2638.05	PASS	AC=9;AF=0.00547;AN=1644;DS;set=Intersection
22	51065341	.	C	T	768.56	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51065361	.	C	A	9336.93	PASS	AC=40;AF=0.02433;AN=1644;DS;set=Intersection
22	51065382	.	G	A	1169.81	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51065451	.	C	T	348.06	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51065487	.	C	G	192.27	PASS	AC=2;AF=0.00126;AN=1588;DS;set=Intersection
22	51065524	.	C	A	1253.47	PASS	AC=17;AF=0.01037;AN=1640;DS;set=Intersection
22	51065581	.	G	A	416.22	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51065600	.	G	A	12390.80	PASS	AC=73;AF=0.04440;AN=1644;DS;set=Intersection
22	51065610	.	G	A	83.84	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51065642	.	G	A	36.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51065816	.	G	A	5256.21	PASS	AC=25;AF=0.01528;AN=1636;set=Intersection
22	51117002	.	C	T	308.70	PASS	AC=1;AF=0.00061;AN=1640;set=Intersection
22	51117137	.	G	A	28536.99	PASS	AC=445;AF=0.27401;AN=1624;DS;set=Intersection
22	51117159	.	C	A	1156.52	PASS	AC=6;AF=0.00376;AN=1596;DS;set=Intersection
22	51117175	.	C	T	240.15	PASS	AC=1;AF=0.00063;AN=1588;DS;set=Intersection
22	51117219	.	C	T	402.11	PASS	AC=1;AF=0.00064;AN=1552;DS;set=Intersection
22	51117231	.	C	T	416.31	PASS	AC=3;AF=0.00196;AN=1532;DS;set=Intersection
22	51117369	.	G	A	129.76	PASS	AC=1;AF=0.00074;AN=1358;set=Intersection
22	51117521	.	G	T	220.94	PASS	AC=1;AF=0.00075;AN=1342;set=Intersection
22	51117564	.	C	T	184.77	PASS	AC=1;AF=0.00073;AN=1372;set=Intersection
22	51117580	.	T	C	22435.48	PASS	AC=507;AF=0.35805;AN=1416;set=Intersection
22	51117660	.	T	G	5340.32	PASS	AC=37;AF=0.02450;AN=1510;set=Intersection
22	51117713	.	C	G	279.04	PASS	AC=5;AF=0.00315;AN=1588;set=Intersection
22	51117865	.	G	A	6195.59	PASS	AC=25;AF=0.01532;AN=1632;DS;set=Intersection
22	51121760	.	C	T	2240.23	PASS	AC=12;AF=0.00889;AN=1350;set=Intersection
22	51121773	.	C	T	286.84	PASS	AC=1;AF=0.00075;AN=1332;set=Intersection
22	51121852	.	C	T	410.12	PASS	AC=2;AF=0.00155;AN=1292;set=Intersection
22	51122989	.	G	A	10413.36	PASS	AC=17;AF=0.01349;AN=1260;DS;set=Intersection
22	51123008	.	C	T	2928.71	PASS	AC=5;AF=0.00387;AN=1292;DS;set=Intersection
22	51123101	.	G	A	1226.10	PASS	AC=12;AF=0.00905;AN=1326;DS;set=Intersection
22	51123122	.	G	A	561.24	PASS	AC=1;AF=0.00075;AN=1332;DS;set=Intersection
22	51133246	.	G	A	63.72	PASS	AC=3;AF=0.00273;AN=1098;set=Intersection
22	51133329	.	C	T	32.85	PASS	AC=1;AF=0.00079;AN=1258;set=Intersection
22	51133417	.	C	T	382.35	PASS	AC=5;AF=0.00358;AN=1396;set=Intersection
22	51133518	.	G	A	9322.58	PASS	AC=558;AF=0.38804;AN=1438;set=Intersection
22	51133524	.	C	T	266.08	PASS	AC=20;AF=0.01370;AN=1460;set=Intersection
22	51135990	.	T	G	89.66	PASS	AC=12;AF=0.750;AN=16;set=Intersection
22	51135991	.	T	G	146.47	PASS	AC=19;AF=0.950;AN=20;set=Intersection
22	51137093	.	C	T	152.56	PASS	AC=1;AF=0.00079;AN=1262;set=Intersection
22	51137094	.	G	A	7508.98	PASS	AC=140;AF=0.11164;AN=1254;set=Intersection
22	51137096	.	C	T	146.66	PASS	AC=1;AF=0.00080;AN=1252;set=Intersection
22	51137249	.	T	C	60819.58	PASS	AC=1008;AF=0.77538;AN=1300;DS;set=Intersection
22	51137253	.	C	G	52	PASS	AC=1;AF=0.00076;AN=1308;DS;set=Intersection
22	51142255	.	C	T	270	PASS	AC=5;AF=0.00408;AN=1224;set=Intersection
22	51142280	.	C	T	2746.73	PASS	AC=31;AF=0.02433;AN=1274;set=Intersection
22	51142381	.	G	A	6482.23	PASS	AC=183;AF=0.14547;AN=1258;set=Intersection
22	51142642	.	C	T	45.54	PASS	AC=1;AF=0.00085;AN=1182;set=Intersection
22	51142692	.	T	A	1363.59	PASS	AC=20;AF=0.01650;AN=1212;set=Intersection
22	51142703	.	C	T	77.09	PASS	AC=2;AF=0.00162;AN=1232;set=Intersection
22	51143124	.	C	T	51.18	PASS	AC=1;AF=0.00080;AN=1244;set=Intersection
22	51143197	.	G	A	593.46	PASS	AC=5;AF=0.00329;AN=1518;set=Intersection
22	51143226	.	A	G	211.37	PASS	AC=1;AF=0.00066;AN=1516;DS;set=Intersection
22	51143287	.	C	T	705.29	PASS	AC=3;AF=0.00202;AN=1484;DS;set=Intersection
22	51143308	.	G	A	921.69	PASS	AC=3;AF=0.00199;AN=1504;DS;set=Intersection
22	51143309	.	G	C	19438.59	PASS	AC=88;AF=0.05836;AN=1508;DS;set=Intersection
22	51143351	.	C	T	2537.47	PASS	AC=6;AF=0.00401;AN=1496;DS;set=Intersection
22	51143401	.	G	A	417.98	PASS	AC=3;AF=0.00199;AN=1508;DS;set=Intersection
22	51143462	.	G	A	333.30	PASS	AC=1;AF=0.00069;AN=1446;DS;set=Intersection
22	51143508	.	C	T	336.48	PASS	AC=1;AF=0.00069;AN=1456;DS;set=Intersection
22	51143520	.	C	T	304.82	PASS	AC=1;AF=0.00069;AN=1456;DS;set=Intersection
22	51144464	.	T	C	35.77	PASS	AC=2;AF=0.0021;AN=954;set=Intersection
22	51144541	.	C	T	76.02	PASS	AC=1;AF=0.00075;AN=1328;set=Intersection
22	51144589	.	C	T	147.56	PASS	AC=1;AF=0.00079;AN=1266;set=Intersection
22	51150038	.	C	T	291.87	PASS	AC=1;AF=0.00069;AN=1448;set=Intersection
22	51150075	.	T	C	441.92	PASS	AC=2;AF=0.00134;AN=1488;set=Intersection
22	51153355	.	C	T	72.50	PASS	AC=1;AF=0.00063;AN=1578;set=Intersection
22	51153371	.	G	A	550.94	PASS	AC=22;AF=0.01465;AN=1502;set=Intersection
22	51153463	.	C	T	82.65	PASS	AC=1;AF=0.00064;AN=1574;set=Intersection
22	51153501	.	G	A	34.10	PASS	AC=3;AF=0.00201;AN=1494;set=Intersection
22	51153509	.	G	A	254.31	PASS	AC=7;AF=0.00474;AN=1478;set=Intersection
22	51154048	.	G	A	536.37	PASS	AC=1;AF=0.00077;AN=1300;DS;set=Intersection
22	51154141	.	G	A	1013.53	PASS	AC=1;AF=0.00075;AN=1328;DS;set=Intersection
22	51159258	.	C	T	101.91	PASS	AC=5;AF=0.0373;AN=134;set=Intersection
22	51159408	.	C	T	722.44	PASS	AC=5;AF=0.00434;AN=1152;set=Intersection
22	51159417	.	C	T	71.68	PASS	AC=1;AF=0.00087;AN=1154;set=Intersection
22	51159624	.	C	T	314.26	PASS	AC=2;AF=0.00152;AN=1314;set=Intersection
22	51159652	.	G	C	139.45	PASS	AC=2;AF=0.00153;AN=1310;set=Intersection
22	51159667	.	G	A	163.85	PASS	AC=2;AF=0.00156;AN=1282;set=Intersection
22	51159778	.	G	A	1168.25	PASS	AC=7;AF=0.00579;AN=1208;DS;set=Intersection
22	51159798	.	G	A	562.60	PASS	AC=5;AF=0.00417;AN=1200;DS;set=Intersection
22	51159802	.	C	A	342.17	PASS	AC=1;AF=0.00084;AN=1192;DS;set=Intersection
22	51160536	.	G	A	282.95	PASS	AC=1;AF=0.00074;AN=1352;set=Intersection
22	51160539	.	G	A	414.79	PASS	AC=1;AF=0.00074;AN=1360;set=Intersection
22	51160707	.	G	A	803.39	PASS	AC=8;AF=0.00637;AN=1256;DS;set=Intersection
22	51160839	.	C	T	526.46	PASS	AC=1;AF=0.00071;AN=1400;DS;set=Intersection
22	51160876	.	C	T	505.34	PASS	AC=1;AF=0.00074;AN=1360;DS;set=Intersection
22	51160877	.	G	A	1110.12	PASS	AC=6;AF=0.00437;AN=1372;DS;set=Intersection
22	51176616	.	G	A	1494.76	PASS	AC=7;AF=0.00426;AN=1644;DS;set=Intersection
22	51176660	.	G	A	433.90	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51176664	.	A	G	6805.32	PASS	AC=10;AF=0.00608;AN=1644;DS;set=Intersection
22	51176734	.	C	T	6610.61	PASS	AC=12;AF=0.00730;AN=1644;DS;set=Intersection
22	51176739	.	G	GA	782.11	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51176775	.	T	C	51.74	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51177751	.	G	A	323.93	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51177756	.	C	T	250.78	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51177812	.	C	T	181.38	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51177864	.	A	T	867.20	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51177891	.	C	T	517.09	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51177928	.	G	A	17909.80	PASS	AC=31;AF=0.01886;AN=1644;DS;set=Intersection
22	51178077	.	C	G	376.76	PASS	AC=1;AF=0.00061;AN=1644;DS;set=Intersection
22	51178090	.	G	A	44402.23	PASS	AC=101;AF=0.06144;AN=1644;DS;set=Intersection
22	51178224	.	C	A	1950.73	PASS	AC=2;AF=0.00122;AN=1644;DS;set=Intersection
22	51178419	.	C	T	1479.93	PASS	AC=4;AF=0.00243;AN=1644;DS;set=Intersection
22	51208005	.	GTC	G	68620.85	PASS	AC=148;AF=0.09002;AN=1644;DS;set=Intersection
22	51216332	.	G	A,T	14526.01	PASS	AC=13,1;AF=0.00791,0.00061;AN=1644;DS;set=Intersection
